A kind of Corynebacterium glutamicum with high yield of ectoine and its application

Abstract

The invention discloses a Corynebacterium glutamicum with high yield of ectoine and its application, belonging to the field of genetic engineering technology. The invention performs aspartate kinase LysC S301Y , Homoserine dehydrogenase Hom V59A and isocitrate dehydrogenase ICD start codon mutations, knocked out genes LysE, PCK and ODX, enhanced the expression of genes FBP, TKT, PYC and PPC, and overexpressed the ectABC gene cluster, thereby enhancing the accumulation of ectoine precursors and greatly promoting the expression of ectoine; it can feedback inhibit the synthesis of competitive products of ectoine and enhance the metabolic pathway of ectoine precursor conversion to ectoine; at the same time, heterologous ectoine key synthases were transferred, and through a more reasonable gene element sequence, the production of ectoine was significantly improved, laying the foundation for the efficient synthesis and further industrialization of ectoine.

Description

Technical Field

[0001] The invention relates to Corynebacterium glutamicum with high ectoine production and application thereof, belonging to the technical field of genetic engineering. Background Art

[0002] Ectoine, also known as tetrahydropyrimidine, is a polar, water-soluble, small molecule cyclic amino acid derivative with a molar mass of 142.2 g / mol and a molecular formula of C6H 10 N2O2. Ecdoin is widely found in halophilic and salt-tolerant bacteria. It can protect and stabilize proteins, nucleic acids, biofilms and entire cells. It has very important commercial value in the fields of cosmetics, enzyme preparations, and medical treatment. At present, domestic ecdoin raw materials have also achieved large-scale production. They are obtained from halophilic bacterial strains, mainly using high-concentration glycerol as a carbon source, and are produced using a process called "bacterial milking". Only about 2 grams of ecdoin can be extracted per liter of culture medium, and the yield is relatively low. It is urgent to develop an engineered strain that produces high ecdoin yields.

[0003] Corynebacterium glutamicum is widely used in the production of various amino acids, fine chemicals, nutritional supplements and many other high value-added products. It is an important green and efficient chassis microorganism and has been developed into an industrial microbial cell factory. The production of ectoine by Corynebacterium glutamicum has the characteristics of high efficiency, greenness, safety and simple subsequent separation and purification. Ectoine can be produced from aspartic acid through a series of enzyme catalysis, and Corynebacterium glutamicum contains a metabolic pathway for high production of aspartic acid. Corynebacterium glutamicum has a natural advantage in producing ectoine.

[0004] Of course, there are some reports about using Corynebacterium glutamicum to produce ectoine. As pointed out in CN115851659A, Corynebacterium glutamicum is used as the starting strain, the RNA polymerase gene T7RNAP of T7 bacteriophage controlled by lactose promoter Ptac is integrated in the hom gene position of genome encoding homoserine dehydrogenase and the dapA gene position encoding dihydropyrimidine dicarboxylic acid synthetase, and the T7RNA polymerase gene of inducible expression is introduced at the same time; the aspartate kinase lysC gene derived from Corynebacterium glutamicum controlled by T7 strong promoter is integrated in the gene position of genome encoding phosphoenolpyruvate carboxylation kinase pck; the recombinant vector pXMJ19-T7-ectABC is introduced, and the synthetic pathway of L-aspartate-β-semialdehyde to tetrahydropyrimidine controlled by T7 strong promoter is constructed, and 10L fermentation tank fermentation production obtains up to 70g / L tetrahydropyrimidine. But its yield is low, and directly knocking out Hom will affect cell growth, so it is still necessary to develop a method that can improve the production efficiency of ectoine. Summary of the invention

[0005] To solve the above problems, the present invention provides a method and application of constructing an engineered bacterium of Corynebacterium glutamicum capable of high production of ectoine by means of gene modification and overexpression of related key enzymes.

[0006] The first object of the present invention is to provide a recombinant Corynebacterium glutamicum with high ectoin production, wherein the recombinant Corynebacterium glutamicum replaces the coding genes of aspartate kinase, homoserine dehydrogenase and isocitrate dehydrogenase on the genome with the coding genes of aspartate kinase mutant, homoserine dehydrogenase mutant and isocitrate dehydrogenase mutant, respectively, knocks out the lysine exosome coding gene LysE, the phosphoenolpyruvate carboxylation kinase coding gene PCK and the oxaloacetate decarboxylase coding gene ODX, enhances the expression of the fructose-1,6-bisphosphatase coding gene FBP, the transketolase coding gene TKT, the pyruvate carboxylase coding gene PYC and the phosphoenolpyruvate carboxylase coding gene PPC, and over-expresses the L-2,4-diaminobutyrate acetyltransferase coding gene ectA, the L-2,4-diaminobutyrate:2-oxoglutarate transaminase coding gene ectB and the ectoin hydrolase coding gene ectC;

[0007] The aspartate kinase mutant is a mutant in which the serine at position 301 of the protein encoded by the sequence shown in SEQ ID NO.1 is replaced by tyrosine;

[0008] The homoserine dehydrogenase mutant is obtained by replacing the 59th valine of the protein encoded by the sequence shown in SEQ ID NO.2 with alanine;

[0009] The isocitrate dehydrogenase mutant is obtained by replacing the start codon ATG of the sequence shown in SEQ ID NO.3 with GTG.

[0010] Furthermore, the nucleotide sequences of the lysine exosome encoding gene LysE, the phosphoenolpyruvate carboxylation kinase encoding gene PCK, and the oxaloacetate decarboxylase encoding gene ODX are shown in SEQ ID NO.4-6.

[0011] Furthermore, the enhanced expression is to replace the promoter of the endogenous fructose-1,6-bisphosphatase encoding gene FBP of Corynebacterium glutamicum on the genome with the Peftu promoter, replace the promoter of the transketolase encoding gene TKT on the genome with the Psod promoter, and replace the promoters of the pyruvate carboxylase encoding gene PYC and the phosphoenolpyruvate carboxylase encoding gene PPC on the genome with the Ptac promoter.

[0012] Furthermore, the nucleotide sequence of gene FBP is shown as SEQ ID NO.8, the nucleotide sequence of gene TKT is shown as SEQ ID NO.10, the nucleotide sequence of gene PYC is shown as SEQ ID NO.12, and the nucleotide sequence of gene PPC is shown as SEQ ID NO.13.

[0013] Furthermore, the nucleotide sequence of the Peftu promoter is shown in SEQ ID NO.7, the nucleotide sequence of the Psod promoter is shown in SEQ ID NO.9, and the nucleotide sequence of the Ptac promoter is shown in SEQ ID NO.11.

[0014] Furthermore, the overexpression is to increase at least one copy of the L-2,4-diaminobutyrate acetyltransferase encoding gene ectA, the L-2,4-diaminobutyrate:2-oxoglutarate transaminase encoding gene ectB and the ectoin hydrolase encoding gene ectC.

[0015] Furthermore, promoter H5 was used to initiate the expression of the ectABC gene cluster.

[0016] Furthermore, cistron BCD21 or BCD2 is used to regulate the expression of genes ectA, ectB, and ectC.

[0017] Furthermore, the amino acid sequences of genes ectA, ectB, and ectC are shown in SEQ ID NOs. 17-19, respectively, the nucleotide sequence of promoter H5 is shown in SEQ ID NO. 20, and the nucleotide sequences of cistrons BCD21 and BCD2 are shown in SEQ ID NOs. 21-22, respectively.

[0018] Furthermore, the starting strain of the recombinant Corynebacterium glutamicum can be any strain, including but not limited to model strains commonly used in the art.

[0019] A second object of the present invention is to provide a method for constructing the recombinant Corynebacterium glutamicum, comprising the following steps:

[0020] S1. Using homologous recombination method, the coding genes of aspartate kinase, homoserine dehydrogenase and isocitrate dehydrogenase on the genome of Corynebacterium glutamicum host bacteria are replaced with aspartate kinase mutant, homoserine dehydrogenase mutant and isocitrate dehydrogenase mutant respectively;

[0021] S2, using the recombinant bacteria obtained in S1 as the starting strain, the lysine exosome encoding gene LysE, the phosphoenolpyruvate carboxylase encoding gene PCK and the oxaloacetate decarboxylase encoding gene ODX were knocked out by homologous recombination;

[0022] S3, using the recombinant bacteria obtained in S2 as the starting strain, using homologous recombination to replace the promoter of the fructose-1,6-bisphosphatase encoding gene FBP on the genome with the Peftu promoter, the promoter of the transketolase encoding gene TKT on the genome with the Psod promoter, and the promoters of the pyruvate carboxylase encoding gene PYC and the phosphoenolpyruvate carboxylase encoding gene PPC on the genome with the Ptac promoter;

[0023] S4, constructing a recombinant plasmid containing genes ectA, ectB and ectC separately or simultaneously;

[0024] S5. Introduce the recombinant plasmid of S4 into the competent cells of the recombinant cells obtained in S3 to obtain the recombinant Corynebacterium glutamicum.

[0025] The third object of the present invention is to provide a composition (such as a microbial agent) containing the recombinant Corynebacterium glutamicum.

[0026] The fourth object of the present invention is to provide a method for producing ectoine, comprising the following steps: using the recombinant Corynebacterium glutamicum or the composition for fermentation production.

[0027] Furthermore, the fermentation production is shake flask fermentation or fermentation tank fermentation.

[0028] Furthermore, the fermentation process includes the following steps: inoculating the seed liquid into the fermentation medium in a certain proportion, fermenting under the conditions of ventilation of 1-10vvm and temperature of 28-32°C, controlling the pH between 6.9-7.1 during the fermentation, adding feed medium when the dissolved oxygen is greater than 45%, and maintaining the dissolved oxygen between 28-32%.

[0029] Furthermore, the seed solution step includes the following steps: inoculating the engineered bacteria into the primary culture medium, culturing to the logarithmic phase, then transferring to the secondary culture medium, and culturing until OD 600 When the temperature reaches 9-10, the seed liquid is obtained.

[0030] Furthermore, the seed culture medium includes: 3-7 g / L yeast extract, 8-12 g / L peptone, 8-12 g / L sodium chloride, and 3-7 g / L glucose.

[0031] Further, the fermentation medium comprises: 12-16 g / L of glucose, 0.01-0.1 g / L of calcium chloride dihydrate, 0.1-0.3 g / L of magnesium sulfate heptahydrate, 0.5-1.5 g / L of sodium chloride, 14-18 g / L of dipotassium hydrogen phosphate, 1-3 g / L of potassium dihydrogen phosphate, 3-7 g / L of ammonium sulfate, 0.1-1 mg / L of biotin, 0.5-1.5 mg / L of thiamine hydrochloride, 18-22 mg / L of ferrous sulfate heptahydrate, 195-205 mg / L of ferrous chloride hexahydrate, 195-205 mg / L of manganese sulfate monohydrate, 48-52 mg / L of zinc sulfate heptahydrate, 18-22 mg / L of cupric chloride dihydrate, 18-22 mg / L of sodium borate decahydrate, 8-12 mg / L of sodium molybdate dihydrate, and 28-32 mg / L of 1,4-dihydroxybenzoic acid.

[0032] Furthermore, the feed culture medium comprises: glucose 600-800 g / L, MgSO4 5-15 g / L.

[0033] The fifth object of the present invention is to provide the use of the recombinant Corynebacterium glutamicum or the composition in the preparation of biological products, chemical products or medicines.

[0034] Furthermore, the above-mentioned products are all products containing ectoine, or products with ectoine as intermediates, such as cosmetics.

[0035] Beneficial effects of the present invention:

[0036] The invention firstly transforms Corynebacterium glutamicum by replacing and knocking out the genome of mutants. Specifically, LysC mutation can produce more aspartyl phosphate than the wild type by improving the activity of the catalytic site of LysC. For Hom, direct knocking out will affect cell growth. After the mutation, the enzyme activity of Hom is inhibited and the synthesis amount of threonine is reduced. The excess precursor can be converted to the ectoine pathway. The promoter of ICD is mutated to a promoter with lower starting efficiency, and the expression of the gene is reduced to inhibit the tricarboxylic acid cycle. Secondly, LysE, PCK and ODX are knocked out to promote the intracellular accumulation of lysine and the accumulation of oxaloacetate. Subsequently, the original promoters of FBP, TKT, PYC and PPC on the genome are replaced with different promoters, and the accumulation of acetyl-CoA and the conversion of oxaloacetate to ectoine precursor are promoted by selecting promoters of appropriate strength. Finally, the ectABC gene cluster is overexpressed to promote the conversion of the product ectoine. Therefore, the present invention specifically enhances the accumulation of ectoine precursors, fully weakens or inhibits other pathways except the ectoine synthesis pathway, and simultaneously introduces heterologous ectoine synthesis key enzymes, thereby greatly promoting the conversion of ectoine precursors to ectoine, thereby constructing a recombinant Corynebacterium glutamicum that synthesizes ectoine. The yield of this strain in a 5-L fermentation tank reaches 64 g / L, achieving efficient synthesis of ectoine, and laying the foundation for further metabolic engineering transformation of Corynebacterium glutamicum to produce ectoine and its industrialization. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 This is a diagram of the metabolic pathway of ectoin in Corynebacterium glutamicum.

[0038] Figure 2 This is the plasmid map for heterologous expression of the ectABC gene cluster of the present invention. DETAILED DESCRIPTION

[0039] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it, but the embodiments are not intended to limit the present invention.

[0040] The scheme involved in the present invention is as follows:

[0041] A method for modifying a Corynebacterium glutamicum strain that produces high levels of ectoine, wherein the engineered bacteria mutate the LysC gene, the Hom gene, and the ICD gene, knock out the LysE gene, the PCK gene, and the ODX gene, replace the promoters of the FBP gene, the TKT gene, the PPC gene, and the PYC gene, and overexpress three key enzymes for synthesizing ectoine, ectA, ectB, and ectC.

[0042] Among them, the serine at position 301 of the LysC gene mutates to tyrosine, and the protein encoded by the LysC gene is aspartase, which makes the engineered bacteria have the effect of promoting the synthesis of ectoine precursors. The valine at position 59 of the Hom gene mutates to alanine, and the protein encoded by the Hom gene is homoserine dehydrogenase, which makes the metabolic pathway of the conversion of ectoine precursors into threonine weakened in the engineered bacteria. The start codon ATG of the ICD gene mutates to GTG, and the protein encoded by the ICD gene isocitrate dehydrogenase, which can inhibit the occurrence of the tricarboxylic acid cycle.

[0043] The protein encoded by the LysE gene is a lysine transporter. Knocking out LysE enables the engineered bacteria to inhibit the transport of lysine to the extracellular space, thereby accumulating lysine in the cell. The protein encoded by the PCK gene is phosphoenolpyruvate carboxylase, and the protein encoded by the ODX gene is oxaloacetate decarboxylase. Knocking out PCK and ODX can promote the accumulation of oxaloacetate.

[0044] The promoter of the FBP gene was replaced with the promoter of eftu, the promoter of the TKT gene was replaced with the promoter of sod, and the promoters of the PPC gene and PYC gene were replaced with the promoter of Ptac. The protein encoded by the FBP gene is fructose-1,6-bisphosphatase, the protein encoded by the TKT gene is transketolase, the protein encoded by the PYC gene is pyruvate carboxylase, and the protein encoded by the PPC gene is phosphoenolpyruvate carboxylase. Replacing the promoters of the FBP gene and the TKT gene can promote the accumulation of acetyl-CoA. Replacing the promoters of the PPC and PYC genes can promote the conversion of oxaloacetate to ectoin precursors.

[0045] Three key enzymes ectA, ectB, and ectC can convert aspartate semialdehyde into ectoine. The sources of the three key enzymes include but are not limited to Pseudomonas, halophilic bacteria, etc.

[0046] The materials and detection methods involved in the following embodiments are as follows:

[0047] (I) Culture medium

[0048] Seed culture medium LBG: yeast extract 5 g / L, peptone 10 g / L, sodium chloride 10 g / L, glucose 5 g / L.

[0049] Fermentation medium: glucose 14.4g / L, calcium chloride dihydrate 0.055g / L, magnesium sulfate heptahydrate 0.2g / L, sodium chloride 1g / L, dipotassium hydrogen phosphate 16g / L, potassium dihydrogen phosphate 2g / L, ammonium sulfate 5g / L, biotin 0.5mg / L, thiamine hydrochloride 1mg / L, ferrous sulfate heptahydrate 20mg / L, ferric chloride hexahydrate 200mg / L, manganese sulfate monohydrate 200mg / L, zinc sulfate heptahydrate 50mg / L, cupric chloride dihydrate 20mg / L, sodium borate decahydrate 20mg / L, sodium molybdate dihydrate 10mg / L, 1,4-dihydroxybenzoic acid 30mg / L.

[0050] Feed medium: glucose 700g / L, MgSO4 10g / L.

[0051] (II) The detection and analysis method of Ecdoin is as follows:

[0052] A1. Use high performance liquid chromatography HPLC to detect the content of ectoine. Preparation of standard curve: Accurately weigh 1.0000g of ectoine standard substance, dilute to 1000mL with distilled water, prepare a 1.0g / L standard solution, dilute to different concentrations: 0.1, 0.2, 0.4, 0.6, 0.8g / L, mix well for use. Dilute the concentration of the sample to be tested to about 0.5g / L at the middle point of the curve, mix well and pass through the membrane.

[0053] A2. The liquid chromatography column used was a Yuexu XB-NH2 high-efficiency chromatography column (4.6×250 mm, 5 μm), the mobile phase was acetonitrile-water solution (volume ratio 70:30), the flow rate was 0.8 mL / min, the column temperature was 30°C, the detection wavelength was 210 nm, and the injection volume was 20 μL.

[0054] Example 1 Construction of genetically modified bacteria

[0055] 1. Preparation of competent strains

[0056] 1. Prepare 25 mL of 2×LB liquid culture medium and 25 mL of 5% glycine solution (filter sterilized), mix well before inoculation, and add Tween 80 (filter sterilized) at a final concentration of 0.1%.

[0057] 2. Pick up ATCC 13032-LysC on the plate culture medium S301Y The strain was transferred into 10 mL of LBG medium and cultured overnight at 30°C and 200 rpm.

[0058] 3. Transfer the Corynebacterium glutamicum from the LBG medium to the medium prepared in (1) above, so that the initial OD600 of the seed liquid medium is 0.3, and culture at 30°C and 200 rpm until OD600=1.

[0059] 4. Place in an ice bath for 30 minutes, then centrifuge at 4°C, 8000 rpm for 10 minutes to collect the cells. Wash the cells three times with 20 mL of 10% glycerol (sterilized at high temperature), and finally resuspend the cells with 1 mL of 10% glycerol and dispense into 1.5 mL centrifuge tubes, 0.1 mL per tube, to obtain competent cells.

[0060] 2. Construction of LysC mutant strain

[0061] 1. LysC-UF, LysC-UR, LysC-DF and LysC-DR were used to amplify LysC (aspartate kinase, the wild-type nucleotide sequence is shown in SEQ ID NO.1, and the mutated LysC S301Y ) upstream and downstream gene fragments, and the amplified fragments were connected by fusion PCR to obtain fragment JJL-23-1.

[0062] 2. Use EcoRI and XbaI to double-digest pK18mobsacB, purify it, and seamlessly connect it with fragment JJL-23-1 using a kit, transform it into E.coli DH5α competent cells, screen the positive clones using LB solid plates containing 25ug / mL kanamycin, and further identify the correctness of gene cloning by sequencing. The correct plasmid obtained was named pJJL-23-1.

[0063] 3. The plasmid pJJL-23-1 was electrotransformed into the competent cells of Corynebacterium glutamicum ATCC 13032, and the positive clones were screened using LBHIS solid plates containing 25ug / mL kanamycin. The positive clones were selected and transferred to the LBS plate, and the correctness of the single colonies grown was identified by sequencing. The correct strain obtained was named G-JJL-23-1, and G-JJL-23-1 competent cells were prepared by the method of step 1.

[0064] 3. Construction of Hom mutant strain

[0065] 1. Hom-UF, Hom-UR, Hom-DF and Hom-DR were used to amplify Hom (homoserine dehydrogenase, wild-type sequence is shown in SEQ ID NO.2, and the mutated sequence is Hom V59A ) upstream and downstream gene fragments, and the amplified fragments were connected by fusion PCR to obtain fragment JJL-23-2.

[0066] 2. Use EcoRI and XbaI to double-digest pK18mobsacB, purify it, and seamlessly connect it with fragment JJL-23-2 using a kit, transform it into E.coli DH5α competent cells, screen the positive clones using LB solid plates containing 25ug / mL kanamycin, and further identify the correctness of gene cloning by sequencing. The correct plasmid obtained was named pJJL-23-2.

[0067] 3. The plasmid pJJL-23-2 was transferred into the G-JJL-23-1 competent cells by electroporation, and the positive clones were screened using LBHIS solid plates containing 25ug / mL kanamycin. The positive clones were selected and transferred to the LBS plate, and the correctness of the single colonies grown was identified by sequencing. The correct strain obtained was named G-JJL-23-2, and G-JJL-23-2 competent cells were prepared by the method of step 1.

[0068] 4. Construction of ICD mutant strains

[0069] 1. Use ICD-UF and ICD-UR, ICD-DF and ICD-DR to amplify the upstream and downstream gene fragments of ICD (isocitrate dehydrogenase, the nucleotide sequence of the wild type is shown in SEQ ID NO.3, and the mutant is the start codon ATG mutated to GTG), and the amplified fragments are connected by fusion PCR to obtain fragment JJL-23-3.

[0070] 2. Use EcoRI and XbaI to double-digest pK18mobsacB, purify it, and seamlessly connect it with fragment JJL-23-3 using a kit, transform it into E.coli DH5α competent cells, screen the positive clones using LB solid plates containing 25ug / mL kanamycin, and further identify the correctness of gene cloning by sequencing. The correct plasmid obtained was named pJJL-23-3.

[0071] 3. The plasmid pJJL-23-3 was transferred into G-JJL-23-2 competent cells by electroporation, and positive clones were screened using LBHIS solid plates containing 25ug / mL kanamycin. Positive clones were selected and transferred to LBS plates, and the correctness of the single colonies grown was identified by sequencing. The correct strain obtained was named G-JJL-23-3, and G-JJL-23-3 competent cells were prepared by the method of step 1.

[0072] 5. Construction of LysE (SEQ ID NO.4) knockout strain

[0073] 1. LysE-UF, LysE-UR, LysE-DF and LysE-DR were used to amplify the upstream and downstream gene fragments of LysE (lysine exporter), respectively. The amplified fragments were connected by fusion PCR to obtain fragment JJL-23-4.

[0074] 2. Use EcoRI and XbaI to double-digest pK18mobsacB, purify it, and seamlessly connect it with fragment JJL-23-4 using a kit, transform it into E.coli DH5α competent cells, screen the positive clones using LB solid plates containing 25ug / mL kanamycin, and further identify the correctness of gene cloning by sequencing. The correct plasmid obtained was named pJJL-23-4.

[0075] 3. The plasmid pJJL-23-4 was electroporated into G-JJL-23-3 competent cells, and positive clones were screened using LBHIS solid plates containing 25ug / mL kanamycin. Positive clones were selected and transferred to LBS plates, and the correctness of the single colonies grown was identified by sequencing. The correct strain obtained was named G-JJL-23-4, and G-JJL-23-4 competent cells were prepared by the method of step 1.

[0076] VI. Construction of PCK (SEQ ID NO.5) knockout strain

[0077] 1. PCK-UF and PCK-UR, PCK-DF and PCK-DR were used to amplify the upstream and downstream gene fragments of PCK (phosphoenolpyruvate carboxykinase) respectively. The amplified fragments were connected by fusion PCR to obtain fragment JJL-23-5.

[0078] 2. Use EcoRI and XbaI to double-digest pK18mobsacB, purify it, and use the kit to seamlessly connect it with the fragment JJL-23-5, transform it into E.coli DH5α competent cells, screen the positive clones using LB solid plates containing 25ug / mL kanamycin, and further identify the correctness of gene cloning by sequencing. The correct plasmid obtained was named pJJL-23-5.

[0079] 3. The plasmid pJJL-23-5 was electrotransformed into G-JJL-23-4 competent cells, and positive clones were screened using LBHIS solid plates containing 25ug / mL kanamycin. Positive clones were selected and transferred to LBS plates, and the correctness of the grown single colonies was identified by sequencing. The correct strain obtained was named G-JJL-23-5, and G-JJL-23-5 competent cells were prepared by the method of step 1.

[0080] VII. Construction of ODX (SEQ ID NO.6) knockout strain

[0081] 1. Use ODX-UF and ODX-UR, ODX-DF and ODX-DR to amplify the upstream and downstream gene fragments of ODX (oxaloacetate decarboxylase) respectively, and the amplified fragments are connected by fusion PCR to obtain fragment JJL-23-6.

[0082] 2. Use EcoRI and XbaI to double-digest pK18mobsacB, purify it, and seamlessly connect it with fragment JJL-23-6 using a kit, transform it into E.coli DH5α competent cells, screen the positive clones using LB solid plates containing 25ug / mL kanamycin, and further identify the correctness of gene cloning by sequencing. The correct plasmid obtained was named pJJL-23-6.

[0083] 3. The plasmid pJJL-23-6 was electroporated into G-JJL-23-5 competent cells, and positive clones were screened using LBHIS solid plates containing 25ug / mL kanamycin. Positive clones were selected and transferred to LBS plates, and the correctness of the single colonies grown was identified by sequencing. The correct strain obtained was named G-JJL-23-6, and G-JJL-23-6 competent cells were prepared by the method of step 1.

[0084] 8. Construction of FBP Enhanced Expression Strain

[0085] 1. Use FBP-UF and FBP-UR, FBP-DF and FBP-DR to amplify the upstream and downstream gene fragments of FBP (fructose-1,6-bisphosphatase, SEQ ID NO.8), respectively, use primers Eftu-F and Eftu-R to amplify the promoter Eftu fragment (see SEQ ID NO.7), and the three amplified fragments are connected by fusion PCR to obtain fragment JJL-23-7.

[0086] 2. Use EcoRI and XbaI to double-digest pK18mobsacB, purify it, and seamlessly connect it with fragment JJL-23-7 using a kit, transform it into E.coli DH5α competent cells, screen the positive clones using LB solid plates containing 25ug / mL kanamycin, and further identify the correctness of gene cloning by sequencing. The correct plasmid obtained was named pJJL-23-7.

[0087] 3. The plasmid pJJL-23-7 was transferred into G-JJL-23-6 competent cells by electroporation, and positive clones were screened using LBHIS solid plates containing 25ug / mL kanamycin. Positive clones were selected and transferred to LBS plates, and the correctness of the grown single colonies was identified by sequencing. The correct strain obtained was named G-JJL-23-7, and G-JJL-23-7 competent cells were prepared by the method of step 1.

[0088] IX. Construction of TKT enhanced expression strain

[0089] 1. Use TKT-UF and TKT-UR, TKT-DF and TKT-DR to amplify the upstream and downstream gene fragments of TKT (transketolase, SEQ ID NO.10), respectively, use primers PSOD-F and PSOD-R to amplify the promoter PSOD fragment (see SEQ ID NO.9), and the three amplified fragments are connected by fusion PCR to obtain fragment JJL-23-8.

[0090] 2. Use EcoRI and XbaI to double-digest pK18mobsacB, purify it, and seamlessly connect it with fragment JJL-23-8 using a kit, transform it into E.coli DH5α competent cells, screen the positive clones using LB solid plates containing 25ug / mL kanamycin, and further identify the correctness of gene cloning by sequencing. The correct plasmid obtained was named pJJL-23-8.

[0091] 3. The plasmid pJJL-23-8 was transferred into G-JJL-23-7 competent cells by electroporation, and positive clones were screened using LBHIS solid plates containing 25ug / mL kanamycin. Positive clones were selected and transferred to LBS plates, and the correctness of the single colonies grown was identified by sequencing. The correct strain obtained was named G-JJL-23-8, and G-JJL-23-8 competent cells were prepared by the method of step 1.

[0092] 10. Construction of PYC enhanced expression strain

[0093] 1. Use PYC-UF and PYC-UR, PYC-DF-1 and PYC-DR to amplify the upstream and downstream gene fragments of PYC (pyruvate carboxylase, SEQ ID NO.12) respectively. Use primers PYC-DF-2, PYC-DF-3, PYC-DF-4 and PYC-DR to amplify the promoter Ptac fragment (see SEQ ID NO.11) by reverse PCR, and the amplified upstream fragment and downstream fragment are connected by fusion PCR to obtain fragment JJL-23-9.

[0094] 2. Use EcoRI and XbaI to double-digest pK18mobsacB, purify it, and seamlessly connect it with fragment JJL-23-9 using a kit, transform it into E.coli DH5α competent cells, screen the positive clones using LB solid plates containing 25ug / mL kanamycin, and further identify the correctness of gene cloning by sequencing. The correct plasmid obtained was named pJJL-23-9.

[0095] 3. The plasmid pJJL-23-9 was transferred into G-JJL-23-8 competent cells by electroporation, and positive clones were screened using LBHIS solid plates containing 25ug / mL kanamycin. Positive clones were selected and transferred to LBS plates, and the correctness of the grown single colonies was identified by sequencing. The correct strain obtained was named G-JJL-23-9, and G-JJL-23-9 competent cells were prepared by the method of step 1.

[0096] XI. Construction of PPC enhanced expression strain

[0097] 1. Use PPC-UF and PPC-UR, PPC-DF-1 and PPC-DR to amplify the upstream and downstream gene fragments of PPC (phosphoenolpyruvate carboxylase, SEQ ID NO.13) respectively. Use primers PPC-DF-2, PPC-DF-3, PPC-DF-4 and PPC-DR to amplify the promoter Ptac fragment by reverse PCR, and the amplified upstream fragment and downstream fragment are connected by fusion PCR to obtain fragment JJL-23-10.

[0098] 2. Use EcoRI and XbaI to double-digest pK18mobsacB, purify it, and seamlessly connect it with fragment JJL-23-10 using a kit, transform it into E.coli DH5α competent cells, screen the positive clones using LB solid plates containing 25ug / mL kanamycin, and further identify the correctness of gene cloning by sequencing. The correct plasmid obtained was named pJJL-23-10.

[0099] 3. The plasmid pJJL-23-10 was electrotransformed into G-JJL-23-9 competent cells, and positive clones were screened using LBHIS solid plates containing 25ug / mL kanamycin. Positive clones were selected and transferred to LBS plates, and the correctness of the grown single colonies was identified by sequencing. The correct strain obtained was named G-JJL-23-10, and G-JJL-23-10 competent cells were prepared by the method of step 1.

[0100] The primers required for the transformation are shown in Table 1 below.

[0101] Table 1 Primer sequences used

[0102]

[0103]

[0104] Example 2 Construction of engineered bacteria overexpressing Ecdoin

[0105] A1. Use primer 1 (sequence: CTCTGAATTCCACTGCATAATTCGTGTCGC) and primer 2 (sequence: CACCGGTACCCGAATTGATCTGCTGCCTCG) to amplify plasmid pEC-XK99E, and obtain the fragment vector JJL-23-11 after gel recovery.

[0106] A2. Select three key genes from Pseudomonas stutzeri: ectA (L-2,4-diaminobutyrate acetyltransferase), ectB (L-2,4-diaminobutyrate:2-oxoglutarate transaminase), and ectC (ectoin hydrolase), and select the terminator (T) from pEC-XK99E.

[0107] A3, the coding genes of several enzymes in A2 and the promoter H5, cistron BCD21, BCD2 were synthesized by Shanghai Sangon Biotechnology Co., Ltd. after codon optimization based on the codon preference of Corynebacterium glutamicum, and the sequences of ectA, ectB and ectC after synthesis are shown in SEQ ID NO.14-SEQ ID NO.16, respectively, and the corresponding protein sequences are shown in SEQ ID NO.17-SEQ ID NO.19. The sequences of H5, BCD21, and BCD2 are shown in SEQ ID NO.20-SEQ ID NO.22, respectively.

[0108] A4, using primer 3 (sequence: GTTTCTAATGATGCCAACCTTGAAGCGC) and primer 4 (sequence: CAAAACAGCCTTATGCGTGTTCTTTCAGTTCTTC) to amplify gene ectA, using primer 5 (sequence: ACACGCATAAGGCTGTTTTGGCGGATGAG) and primer 6 (sequence: TTATGCAGTGGAATTCAGAGTTTGTAGAAACGCAAAAAGG) to amplify the terminator (T) of pEC-XK99E, using primer 7 (sequence: GATCAATT The promoter H5 was amplified using primer 9 (sequence: AGTTGGATCCGGGCCCAAGTTCACTTAAAAAG) and primer 10 (sequence: AGGTTGGCATCATTAGAAACCATCCCTCGC), and the cistron BCD21 was amplified using primer 10 (sequence: AGGTTGGCATCATTAGAAACCATCCCTCGC). H5, BCD21, ectA and terminator (T) were connected by fusion PCR to obtain the final fragment H5-BCD21-ectA-T.

[0109] A5, after the fragments were recovered from gel running, they were seamlessly connected with the vector JJL-23-11 through the kit, and then transformed into E. coli DH5α competent cells. The positive clones were screened using LB solid plates containing 25ug / mL kanamycin, and the correctness of the gene cloning was further identified by sequencing. The correct plasmid obtained was named pJJL-23-11.

[0110] A6. Primer 11 (sequence: TTTCTAATGAAAACCTTCGAACTGAACG) and primer 12 (sequence: CAAAACAGCCTTAGGATGCCTGGTTTTCGG) were used to amplify gene ectB, primer 13 (sequence: GGCATCCTAAGGCTGTTTTGGCGGATGAG) and primer 14 (sequence: TACCGAGCTCAGAGTTTGTAGAAACGCAAAAAGG) were used to amplify the terminator (T) of pEC-XK99E, and primer 15 (sequence: TACAAACTCTGAA Promoter H5 was amplified using primer 14 (sequence: ACTTGGGCCCGGATCCAACTCTACTCCTTTATC), and cistron BCD2 was amplified using primer 15 (sequence: AGTTGGATCCGGGCCCAAGTTCACTTAAAAAGG) and primer 16 (sequence: ACTTGGGCCCGGATCCAACTCTACTCCTTTATC). Cistron BCD2 was amplified using primer 17 (sequence: AGTTGGATCCGGGCCCAAGTTCACTTAAAAAGG) and primer 18 (sequence: AGGTTTTCATCATTAGAAAACCTCCTTAGCATG). H5, BCD2, ectB, and terminator (T) were connected by fusion PCR to obtain the final fragment H5-BCD2-ectB-T.

[0111] A7, pJJL-23-11 and fragment H5-BCD2-ectB-T were double-digested with EcoRI and SacI, the obtained products were purified and ligated with T4 ligase, and then transformed into E. coli DH5α competent cells, and the positive clones were screened using LB solid plates containing 25ug / mL kanamycin, and the correctness of gene cloning was further identified by sequencing. The correct plasmid obtained was named pJJL-23-12.

[0112] A8, using primer 19 (sequence: TTTTCTAATGATGATCGTCAGAACCCTCG) and primer 20 (sequence: CAAAACAGCCTCAGACGGTTTCGGCCTC) to amplify gene ectC, using primer 21 (sequence: AACCGTCTGAGGCTGTTTTGGCGGATGAG) and primer 22 (sequence: GCAGGTCGACTCTAGAAGAGTTTGTAGAAACGCAAAAAGG) to amplify the terminator (T) of pEC-XK99E, using primer 23 (sequence: TACAAACTCTGA Promoter H5 was amplified using primer 24 (sequence: ACTTGGGCCCGGATCCAACTCTACTCCTTTATC), and cistron BCD2 was amplified using primer 25 (sequence: AGTTGGATCCGGGCCCAAGTTCACTTAAAAAGG) and primer 26 (sequence: TGACGATCATCATTAGAAAACCTCCTTAGCATG), and H5, BCD2, ectC, and terminator (T) were connected by fusion PCR to obtain the final fragment H5-BCD2-ectC-T.

[0113] A9, pJJL-23-12 and fragment H5-BCD2-ectC-T were double-digested with SacI and XbaI, the obtained products were purified and ligated with T4 ligase, and then transformed into E. coli DH5α competent cells, and the positive clones were screened using LB solid plates containing 25ug / mL kanamycin, and the correctness of gene cloning was further identified by sequencing. The correct plasmid finally obtained was named pJJL-23-13.

[0114] A10, the plasmid pJJL-23-13 was transferred into the competent cells of G-JJL-23-10 by electroporation, and the positive clones were screened by LBHIS solid plate containing 25ug / mL kanamycin, and the correctness of gene cloning was further verified by sequencing. The correct strain finally obtained was named G-JJL-23-11.

[0115] Example 3 Fermentation culture of Corynebacterium glutamicum

[0116] A1. Inoculate a single colony of the engineered bacteria G-JJL-23-11 into 10 mL of LBG medium (add kanamycin at a final concentration of 25 μg / mL), and culture at 30° C. and 200 rpm for 16-24 h until mid-logarithmic phase to obtain seed solution.

[0117] A2. Transfer 2 mL of seed solution to a 500 mL shake flask containing 100 mL of LBG medium (with kanamycin added at a final concentration of 25 μg / mL) and culture at 37°C and 200 rpm for about 14-18 h until the OD reaches 600 Reach 9-10.

[0118] A3. Inoculate the secondary seeds into a 5L fermenter at a 5% inoculation rate, and ferment with the initial conditions of 1vvm ventilation, 30°C, 300rpm and pH7.0. During the fermentation, 50% ammonia water was used to control the pH to 7.0±0.1. Feeding was controlled by dissolved oxygen. When the dissolved oxygen was greater than 45%, 5mL of feed medium was automatically added. The dissolved oxygen was kept at about 30% by associating dissolved oxygen with the rotation speed. After 48 hours of fermentation, the sample was centrifuged at 10000rpm for 1min to obtain the supernatant. The results of high performance liquid chromatography showed that the amount of ectoine was 64g / L.

[0119] Comparative Example

[0120] The following transformation was performed using Corynebacterium glutamicum ATCC 13032 as the starting strain, and the transformed strain was fermented to detect the ectoine production. The transformation method and fermentation conditions were the same as those in the above embodiment. Specifically:

[0121] (1) The strain was directly fermented without any modification, and the ectoine production was detected to be 0 g / L after 48 h of fermentation.

[0122] (2) The ectABC gene cluster was heterologously expressed for fermentation. After 48 h of fermentation, the ectoine production was detected to be 23.1 g / L.

[0123] (3) The genome of Corynebacterium glutamicum was subjected to the aspartate kinase LysC S301Y The ectABC gene cluster was mutated and heterologously expressed for fermentation. The ectoine production was detected to be 33.1 g / L after 48 h of fermentation.

[0124] (4) The genome of Corynebacterium glutamicum was subjected to homoserine dehydrogenase Hom V59A The ectABC gene cluster was mutated and heterologously expressed for fermentation. The ectoine production was detected to be 28.3 g / L after 48 h of fermentation.

[0125] (5) The genome of Corynebacterium glutamicum was knocked out for homoserine dehydrogenase Hom, and the ectABC gene cluster was heterologously expressed for fermentation. After 48 hours of fermentation, the ectoine production was detected to be 10.3 g / L.

[0126] (6) The isocitrate dehydrogenase ICD start codon of the genome of Corynebacterium glutamicum was mutated, and the ectABC gene cluster was heterologously expressed for fermentation. After 48 hours of fermentation, the ectoine production was detected to be 27.8 g / L.

[0127] (7) LysE was knocked out in the genome of Corynebacterium glutamicum, and the ectABC gene cluster was heterologously expressed for fermentation. After 48 hours of fermentation, the ectoine production was detected to be 29.3 g / L.

[0128] (8) The PCK was knocked out in the genome of Corynebacterium glutamicum, and the ectABC gene cluster was heterologously expressed for fermentation. After 48 h of fermentation, the ectoine production was detected to be 27.6 g / L.

[0129] (9) The ODX was knocked out in the genome of Corynebacterium glutamicum, and the ectABC gene cluster was heterologously expressed for fermentation. After 48 h of fermentation, the ectoine production was detected to be 27.9 g / L.

[0130] (10) The gene FBP was enhanced and expressed in the genome of Corynebacterium glutamicum, and the ectABC gene cluster was heterologously expressed for fermentation. After 48 h of fermentation, the ectoine production was detected to be 28.7 g / L.

[0131] (11) The genome of Corynebacterium glutamicum was enhanced to express the gene TKT, and the ectABC gene cluster was heterologously expressed for fermentation. After 48 h of fermentation, the ectoine production was detected to be 28.0 g / L.

[0132] (12) The PPC gene was enhanced and expressed in the genome of Corynebacterium glutamicum, and the ectABC gene cluster was heterologously expressed for fermentation. After 48 h of fermentation, the ectoine production was detected to be 29.6 g / L.

[0133] (13) The PYC gene was enhanced and expressed in the genome of Corynebacterium glutamicum, and the ectABC gene cluster was heterologously expressed for fermentation. After 48 h of fermentation, the ectoine production was detected to be 29.3 g / L.

[0134] Obviously, the above embodiments are merely examples for clear explanation and are not intended to limit the implementation methods. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. The obvious changes or modifications derived from these are still within the protection scope of the invention.

Claims

1. A recombinant Corynebacterium glutamicum producing ectoine, characterized in that: The recombinant Corynebacterium glutamicum replaces the coding genes of aspartate kinase, homoserine dehydrogenase and isocitrate dehydrogenase on the genome with the coding genes of aspartate kinase mutant, homoserine dehydrogenase mutant and isocitrate dehydrogenase mutant, respectively, knocks out the lysine exosome coding gene LysE, the phosphoenolpyruvate carboxylation kinase coding gene PCK and the oxaloacetate decarboxylase coding gene ODX, enhances the expression of the fructose-1,6-bisphosphatase coding gene FBP, the transketolase coding gene TKT, the pyruvate carboxylase coding gene PYC and the phosphoenolpyruvate carboxylase coding gene PPC, and over-expresses the L-2,4-diaminobutyrate acetyltransferase coding gene ectA, the L-2,4-diaminobutyrate:2-oxoglutarate transaminase coding gene ectB and the ectoin hydrolase coding gene ectC; The aspartate kinase mutant is a mutant in which the serine at position 301 of the protein encoded by the sequence shown in SEQ ID NO.1 is replaced by tyrosine; The homoserine dehydrogenase mutant is obtained by replacing the 59th valine of the protein encoded by the sequence shown in SEQ ID NO.2 with alanine; The isocitrate dehydrogenase mutant is obtained by replacing the start codon ATG with GTG based on the nucleotide sequence shown in SEQ ID NO.3; The promoter of the endogenous fructose-1,6-bisphosphatase encoding gene FBP of Corynebacterium glutamicum on the genome was replaced with the Peftu promoter, the promoter of the transketolase encoding gene TKT on the genome was replaced with the Psod promoter, and the promoters of the pyruvate carboxylase encoding gene PYC and the phosphoenolpyruvate carboxylase encoding gene PPC on the genome were replaced with the Ptac promoter; Promoter H5 was used to drive the expression of genes ectA, ectB and ectC; The nucleotide sequence of the Peftu promoter is shown in SEQ ID NO.7, the nucleotide sequence of the Psod promoter is shown in SEQ ID NO.9, and the nucleotide sequence of the Ptac promoter is shown in SEQ ID NO.11; The amino acid sequences of the genes ectA, ectB and ectC are shown in SEQ ID NOs. 17-19 respectively, and the nucleotide sequence of the promoter H5 is shown in SEQ ID NO.

20.

2. The recombinant Corynebacterium glutamicum according to claim 1, characterized in that The overexpression is to increase at least one copy of the L-2,4-diaminobutyrate acetyltransferase encoding gene ectA, the L-2,4-diaminobutyrate:2-oxoglutarate transaminase encoding gene ectB and the ectoine hydrolase encoding gene ectC.

3. The recombinant Corynebacterium glutamicum according to claim 2, characterized in that The cistron BCD21 or BCD2 is used to regulate the expression of genes ectA, ectB and ectC; the nucleotide sequences of the cistrons BCD21 and BCD2 are shown in SEQ ID NO.21-22 respectively.

4. The method for constructing a recombinant Corynebacterium glutamicum according to any one of claims 1 to 3, characterized in that: The following steps are involved: S1. Using homologous recombination method, the coding genes of aspartate kinase, homoserine dehydrogenase and isocitrate dehydrogenase on the genome of Corynebacterium glutamicum host bacteria are replaced with aspartate kinase mutant, homoserine dehydrogenase mutant and isocitrate dehydrogenase mutant respectively; S2, using the recombinant bacteria obtained in S1 as the starting strain, the lysine exosome encoding gene LysE, the phosphoenolpyruvate carboxylase encoding gene PCK and the oxaloacetate decarboxylase encoding gene ODX were knocked out by homologous recombination; S3, using the recombinant bacteria obtained in S2 as the starting strain, using homologous recombination to replace the promoter of the fructose-1,6-bisphosphatase encoding gene FBP on the genome with the Peftu promoter, the promoter of the transketolase encoding gene TKT on the genome with the Psod promoter, and the promoters of the pyruvate carboxylase encoding gene PYC and the phosphoenolpyruvate carboxylase encoding gene PPC on the genome with the Ptac promoter; S4, constructing a recombinant plasmid containing genes ectA, ectB and ectC at the same time; S5. Introduce the recombinant plasmid of S4 into the competent cells of the recombinant cells obtained in S3 to obtain the recombinant Corynebacterium glutamicum.

5. A composition comprising the recombinant Corynebacterium glutamicum according to any one of claims 1 to 3.

6. A method for producing ectoine, characterized in that, The method comprises the following steps: using the recombinant Corynebacterium glutamicum described in any one of claims 1 to 3 or the composition described in claim 5 for fermentation production.

7. The method according to claim 6, characterized in that The fermentation process includes the following steps: inoculating seed liquid into fermentation medium, fermenting under the conditions of ventilation volume 1-10vvm and temperature 28-32°C, controlling pH between 6.9-7.1 during fermentation, adding feed medium when dissolved oxygen is greater than 45%, and maintaining dissolved oxygen between 28-32%.

Images