Application of Orphan Gene DUD1 in Rice to Control Plant Drought Resistance

Abstract

The present invention relates to the field of rice genetic engineering and discloses the application of the rice orphan gene DUD1 in controlling plant drought resistance. The applicant isolated, cloned and functionally verified a rice orphan gene that can enhance rice drought resistance. DUD1 (

Description

Technical Field

[0001] The present invention relates to the field of rice genetic engineering. Specifically, it relates to isolating, cloning and functionally verifying an orphan rice gene DUD1 ( D Novo Gene U seful for D The present invention obtains genetic transformation materials of DUD1 for multiple species by means of transgenic means. Drought experiments show that DUD1 can enhance the tolerance of these species to drought, confirming the function of the gene and its great application value. Background Art

[0002] In the long-term evolution of crops, in order to adapt to changes in extreme external environments, crops have undergone significant changes in the genome level and plant morphology. So, this difference leads to two important biological questions: What are new genes? How are these new genes generated? First of all, the concept of new genes is relative to ancient genes. One type is rapidly evolved from ancient genes, with the characteristics of recent generation time and short evolutionary history, but retains gene structure or sequence information. The other type is orphan genes, which lack homologous genes in other species. They may be generated by drastic changes in the coding sequence of ancient genes, or they may be generated from scratch from the non-coding segments of ancestors, also known as de novo genes. In recent years, more and more studies have shown that new genes are one of the main driving forces of evolutionary innovation. Almost all species will have a certain number of orphan genes (new genes unique to species) in the long-term evolution. Zhang et al. conducted a systematic study using high-quality genomes of 13 closely related rice varieties and found that rice has about 8,000 orphan genes. Clear evidence from evolutionary patterns, transcription and translation showed the existence of de novo genes. The study detected 175 de novo ORFs, and through mass spectrometry targeted proteomics and ribosome mapping technology, more than 50% of de novo genes were detected with translation signals (Zhang et al 2019). However, are there orphan genes related to drought resistance in this type of gene? Do they promote phenotypic innovation? These questions need further study to guide us in discovering new drought-resistant genes and exploring new strategies for genetic improvement of crop drought resistance.

[0003] More importantly, although the rice genome predicts the existence of many new genes specific to the genus Oryza, there are almost no reports on the evolution and specific functions of single orphan genes in rice; at the same time, there are also no reports that an orphan gene can enhance the adaptability of multiple species to the environment (drought). Therefore, the present invention relates to the function of the orphan gene DUD1 in rice to enhance the drought resistance of multiple species, which is of great value for the exploration of orphan genes related to drought resistance and the improvement of drought resistance of multiple species. Summary of the invention

[0004] The purpose of the present invention is to provide an application of the rice orphan gene DUD1 in controlling plant drought resistance. The protein encoded by the DUD1 gene is shown in SEQ ID NO.2, and the corresponding polynucleotide is shown in SEQ ID NO.1.

[0005] In order to achieve the above object, the present invention adopts the following technical measures:

[0006] The applicant isolated, cloned and functionally verified an orphan rice gene DUD1 ( D Novo Gene U seful for D Through transgenic methods, DUD1-transformed rice, corn, rapeseed and Arabidopsis were obtained. Drought experiments showed that DUD1 can enhance the drought tolerance of these species. The protein encoded by the DUD1 gene is shown in SEQ ID NO.2. The corresponding polynucleotide is shown in SEQ ID NO.1.

[0007] The protection scope of the present invention includes:

[0008] Application of DUD1 protein or a gene encoding DUD1 protein in regulating plant drought resistance, wherein the DUD1 protein is shown in SEQ ID NO.2;

[0009] The above-mentioned applications are specifically:

[0010] Increasing the expression of DUD1 protein or a gene encoding DUD1 protein in a plant to improve the drought resistance of the plant, the application specifically comprising: introducing a substance that increases the expression of DUD1 protein or a gene encoding DUD1 protein into the plant;

[0011] Inhibit or reduce the expression of DUD1 protein in rice to weaken the drought resistance of rice;

[0012] Knock out, inhibit or silence the expression of the gene encoding DUD1 protein in rice to weaken the drought resistance of rice;

[0013] In the above-mentioned applications, preferably, when applied in rice, the knockout adopts the CRISPR / Cas9 system, and the target site of the gRNA in the system is GAACAGAAGAGAAGGAAGCATCGG.

[0014] In the above application, the rice with reduced drought resistance after editing by the CRISPR / Cas9 system has the polynucleotide shown in SEQ ID NO.3 or SEQ ID NO.4.

[0015] Use of DUD1 protein or a gene encoding DUD1 protein in preparing drought-resistant transgenic plants, wherein the use specifically comprises: introducing a substance that increases the expression of DUD1 protein or the expression of a gene encoding DUD1 protein into the plant;

[0016] In the above application, preferably, the substance is a nucleic acid molecule encoding DUD1 protein, or its expression frame, recombinant vector, or recombinant microorganism;

[0017] The above-mentioned applications, preferably, when it is necessary to increase the expression level of DUD1 protein in plants or to increase the expression level of the gene encoding DUD1 protein in plants, are to introduce the expression vector carrying the DUD1 gene of the present invention into plant cells by using Ti plasmid, plant virus vector, direct DNA transformation, microinjection, electroporation and other conventional biotechnology methods (Weissbach, 1998, Method for Plant Molecular Biology VIII, Academy Press, New York, pp. 411-463; Geiserson and Corey, 1998, Plant Molecular Biology (2nd Edition)).

[0018] The nucleic acid molecule encoding the DUD1 protein is shown in SEQ ID NO.1.

[0019] In the above application, preferably, the plant is rice, corn, rapeseed, poplar or Arabidopsis thaliana.

[0020] Compared with the prior art, the present invention has the following characteristics:

[0021] Through the association analysis of rice drought resistance, the rice orphan gene DUD1 was identified, and transgenic methods were used to prove that DUD1 can enhance the drought resistance of rice and multiple foreign species. For example, expressing DUD1 in corn, Arabidopsis, rapeseed and poplar can improve the material's tolerance to drought. This invention provides valuable experience and genetic resources for improving drought resistance of multiple species using a single gene. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 This is the gene editing status of rice DUD1CRISPR mutant;

[0023] CRI#6 and CRI#27 are two homozygous families for DUD1 CRISPR mutants.

[0024] Figure 2 This is the drought stress phenotype of the rice DUD1CRISPR mutant at the booting stage;

[0025] C6 and C27 are two homozygous families of DUD1 CRISPR mutants (CRI#6 and CRI#27), and the wild-type Kongyu 131 (KY131) is used as a control;

[0026] (a) The phenotypes of wild-type KY131 and mutant DUD1CRISPR (C6) materials before and after drought stress in potted plants; scale bar = 12 cm;

[0027] (b) Comparison of TBR_R (TBR: total area / boundary rectangle area (reflecting the degree of leaf curling), suffix "_R": indicates drought value / value before drought stress) of wild-type KY131 and mutant DUD1CRISPR (C6, C27) after potted drought stress;

[0028] (c) Comparison of GPAR_R (GPAR: green leaf area / total leaf area, suffix “_R”: indicates drought value / value before drought stress) of wild-type KY131 and mutant DUD1CRISPR (C6, C27) after potted drought stress.

[0029] Figure 3 The drought stress phenotype of rice DUD1OE overexpressing materials in potted plants at the booting stage;

[0030] OE-1 and OE-4 are two DUD1 single-copy homozygous overexpression families, and the wild-type Kongyu 131 (KY131) was used as a control;

[0031] (a) Phenotypes of wild-type KY131 and overexpression DUD1OE (OE-1) materials before and after drought stress in potted plants; scale bar = 12 cm;

[0032] (b) Comparison of TBR_R between wild-type KY131 and overexpressed DUD1OE (OE-1, OE-4) after drought stress in potted plants;

[0033] (c) Comparison of GPAR_R between wild-type KY131 and overexpressing DUD1OE (OE-1, OE-4) after drought stress in potted plants;

[0034] (d) Comparison of the relative expression levels of DUD1 in wild-type KY131 and DUD1 overexpressing OE (OE-1, OE-4) materials.

[0035] Figure 4 The phenotype of DUD1OE overexpressing maize material after drought stress in potted seedling stage;

[0036] Among them: OE#53, OE#55 and #OE#57 are three independent transgenic maize lines, and OE-CK is an isolated wild-type line (i.e., wild-type KN5585) as a control;

[0037] (a) The phenotypes of wild-type maize OE-CK and overexpressing DUD1OE (OE#53, OE#55, OE#57) materials before potted drought stress;

[0038] (b) The phenotypes of wild-type maize OE-CK and overexpressing DUD1OE (OE#53, OE#55, OE#57) materials after potted drought stress;

[0039] (c) Relative expression levels of DUD1 gene in wild-type maize OE-CK and overexpressing DUD1OE (OE#53, OE#55, OE#57);

[0040] (d) Comparison of GPAR_R between wild-type corn OE-CK and DUD1OE overexpressing (OE#53, OE#55, OE#57) materials after potted drought stress.

[0041] Figure 5 The conditions of DUD1OE overexpressing Arabidopsis seedlings in potted plants before, after and after drought stress and rehydration.

[0042] OE23 and OE27 are two independent overexpression transgenic Arabidopsis lines, and Col is Columbia wild-type Arabidopsis as a control;

[0043] (a) Relative expression levels of DUD1 gene in Arabidopsis wild-type Col and overexpression DUD1OE (OE23, OE27) materials;

[0044] (b) The phenotypes of Arabidopsis wild-type Col and overexpressed DUD1OE (OE23, OE27) materials before, after and after rehydration in potted plants under drought stress;

[0045] (c) Survival rate of Arabidopsis wild-type Col and DUD1OE overexpressing (OE23, OE27) materials after drought stress in potted plants.

[0046] Figure 6 This is the situation of DUD1OE overexpressing rapeseed material in potted seedling stage after drought stress;

[0047] OE#11, OE#17 and OE#27 are three independent overexpression transgenic rapeseed lines, and Col is Westar wild-type rapeseed as a control;

[0048] Wherein: (a) is the relative expression level of DUD1 gene in wild-type rapeseed Westar and overexpression DUD1OE (OE#11, OE#17 and OE#27);

[0049] (b) The phenotypes of wild-type rapeseed Westar and DUD1OE overexpressing (OE#11, OE#17 and OE#27) materials after rehydration from drought stress.

[0050] Figure 7 The conditions of DUD1OE overexpressing poplar material potted plants before drought stress and after drought stress rehydration;

[0051] OE-3 and OE-19 are two independent overexpression transgenic poplar lines, and 717 is a wild-type poplar used as a control;

[0052] Among them: (A) shows the phenotypes of wild-type poplar 717 and DUD1OE overexpressing materials (OE-3 and OE-19) before and after drought stress and rehydration;

[0053] (B) Relative expression levels of DUD1 gene in wild-type poplar 717 and overexpressing DUD1OE (OE-3 and OE-19);

[0054] (C) Comparison of leaf survival rates of wild-type poplar and DUD1OE overexpressing (OE-3 and OE-19) materials after rehydration under drought stress. DETAILED DESCRIPTION

[0055] The following examples define the present invention and describe the methods of the present invention in constructing DUD1 CRISPR mutants, cloning DNA fragments containing the complete coding region of the DUD1 gene, and verifying the function of the DUD1 gene. Based on the following description and these examples, those skilled in the art can determine the basic characteristics of the present invention, and can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention to make it suitable for different uses and conditions.

[0056] Example 1: Isolation and cloning of DUD1 gene

[0057] Using cDNA of rice variety Nipponbare leaves as a template, primers CDS-F: ATGGGAACAGAAGAGAAGAA and CDS-R: TTATCGCCGCTCATCAGCGG were used to PCR amplify the CDS sequence encoded by the DUD1 gene. The amplified sequence contained the CDS sequence shown in SEQ ID NO.1.

[0058] The PCR reaction conditions were: 95°C pre-denaturation for 3 min; 94°C for 30 sec, 55°C for 30 sec, 72°C for 1 min, 33 cycles; 72°C extension for 5 min. The amplified PCR product was connected to the pGEM-T Easy vector (purchased from Promega), positive clones were screened and sequenced to obtain the DUD1 sequence.

[0059] The applicant named the clone as pGEM-DUD1 plasmid.

[0060] Example 2: Construction of overexpression vectors of DUD1 gene in rice, corn, Brassica napus, Arabidopsis thaliana and poplar

[0061] 1. Construction of rice overexpression vector The specific steps are as follows: First, the positive clone pGEM-DUD1 plasmid obtained in Example 1 was amplified using primers DUD1-OEF (TACGAACGATAGCCGGTACCATGGGAACAGAAGAGAAGAA) and DUD1-OER (TTGCGGACTCTAGAGGATCCTCAATTCCACCTTGGAGCAC) to amplify a cDNA fragment containing the full length of DUD1. The reaction conditions are: pre-denaturation at 94°C for 3 min; 94°C for 30 sec, 55°C for 30 sec, 72°C for 1 min, 30 cycles; and extension at 72°C for 5 min.

[0062] The fragment was ligated to the pCAMBIA1301U vector digested with restriction endonucleases KpnI and BamHI using Gibson Assembly, and the vector was sequenced and confirmed to be used for genetic transformation.

[0063] 2. The construction of corn overexpression vector was completed by Weimi Biotechnology (Jiangsu) Co., Ltd.

[0064] 3. The steps of constructing rapeseed overexpression vector are as follows: design infusion primer pGWC-F1 / R1, and amplify the fragment containing the full-length CDS of DUD1 with pGEM-DUD1. PCR amplification program using pGWC-F1-5'AGCAGGCTTTGACTTTAGGTCATGGGAACAGAAGAGAAGAA-3' and pGWC-R1-5'-TGGGTCTAGAGACTTTAGGTCAATTCCACCTTGGAGCAC-3': 98℃ denaturation for 2min; 98℃ denaturation for 10s, 60℃ annealing for 15s, 72℃ extension for 30s, 35 circles; 72℃ total extension for 5min. The amplified product was cloned with rapid seamless cloning reagent (Trelief TM SoSoo Cloning Kit Ver.2, catalog number TSV-S2, purchased from Beijing Qingke Xinye Biotechnology Co., Ltd.) was used to connect the amplified product with the entry vector pGWC-T after restriction digestion. Then, three positive clones were selected for transformation and sent for sequencing. After sequencing, the plasmid was extracted and constructed into the binary vector 35S: gene-C-terminal fusion GFP tag, and the vector was sequenced to confirm that it could be used for genetic transformation.

[0065] 4. The steps for constructing the Arabidopsis overexpression vector are as follows: The vector was constructed using the Gateway method: rice cDNA was used as a template, and DUD1-ATTB-FP (GGGGACAAGTTTGTACAAAAAAGCAGGCTTC ATGGGAACAGAAGAGAAGAA) / DUD1-ATTB-RP (GGGGACCACTTTGTACAAGAAAGCTGGGTCTCAATTCCACCTTGGAGCAC) were used as primers, and the target fragment was amplified using a high-fidelity enzyme (Phusion). The PCR product was purified using NaAc. The purified target fragments were connected to the entry vector pDONR223 by BP reaction, and then connected to the final vector pGreen0179-35S-GWB-YFP by LR reaction to obtain the positive plasmid pGreen0179-35S-DUD1-YFP, and the vector was sequenced to confirm that it can be used for genetic transformation.

[0066] 5. The steps for constructing the poplar overexpression vector are as follows: The vector was constructed using the Gateway method: rice cDNA was used as a template, and DUD1-3*FLAG(C)-BP-F (acaagtttgtacaaaaaagcaggctTA atgggaacagaagagaa) and DUD1-3*FLAG(C)-BP-R (accactttgtacaagaaagctgggtA TCATTTATCATCATCATC) were used as primers, and the target fragment was amplified using a high-fidelity enzyme (KOD). The PCR product was purified using the Tiangen Gum Recovery Kit (DP214). The purified target fragments were connected to the entry vector pDONR 207 by BP reaction, and then connected to the final vector PK2GW7 by LR reaction to obtain the positive plasmid PK2GW7-35S-DUD1-3*FLAG. The vector was sequenced to confirm that it could be used for genetic transformation.

[0067] Example 3: Construction of dud1 rice CRISPR vector

[0068] The gene sequence of DUD1 gene was obtained from Rice Data (http: / / www.ricedata.cn / gene / ). The target site was selected according to CRISPR-P v2.0 (http: / / crispr.hzau.edu.cn / CRISPR2 / ), and the target site sequence was: Target site sequence: GAACAGAAGAGAAGAAGCATCGG.

[0069] The vector construction of CRISPR mutant strains can refer to relevant literature (Xie Kabin et al. Boosting CRISPR / Cas9 multiplex editing capability with the endogenous tRNA-processing system. PNAS. 2015, 112: 3570-3575.), which will not be described in detail in this manual due to space limitations.

[0070] Embodiment 4:

[0071] Genetic transformation of plasmid vector and positive detection of transgenic plants

[0072] 1. Rice genetic transformation:

[0073] Rice genetic transformation is carried out by Agrobacterium-mediated transformation method (the specific steps are described below), and the constructed overexpression and CRISPR are transferred into the rice variety "KY131", and transgenic plants are obtained after pre-culture, infection, co-cultivation, screening of callus with hygromycin resistance, differentiation, rooting, seedling training, and transplanting. The above Agrobacterium-mediated rice genetic transformation method (system) is improved on the basis of the method reported by Hiei et al. (Hiei et al., Efficient transformation of rice, Oryza sativa L., mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA, Plant J, 6: 271-282, 1994).

[0074] (1) Electrotransformation: The final genetic transformation vector was electrotransformed into the Agrobacterium EHA105 strain using a voltage of 1800 V, and then spread on LA medium with corresponding resistance selection to screen out positive clones for the following transformation callus.

[0075] (2) Callus induction: The mature rice Kongyu 131 was hulled and then treated with 70% ethanol for 1 minute and 0.15% mercuric chloride (HgCl2) for 15 minutes to sterilize the seed surface; the seeds were washed with sterile water for 4-5 times; the sterilized seeds were placed on an induction medium; the inoculated callus induction medium was cultured in the dark for 4 weeks at a temperature of 25±1°C.

[0076] (3) Callus subculture: Select bright yellow, compact and relatively dry embryonic calli and culture them on subculture medium in the dark at 25±1℃ for 2 weeks.

[0077] (4) Preculture: Select compact and relatively dry embryonic calli and culture them on preculture medium in the dark at 25±1°C for 2 weeks.

[0078] (5) Agrobacterium culture: Agrobacterium EHA105 (derived from CAMBIA, a commercial strain carrying the vector of the present invention) was pre-cultured on LA medium with corresponding resistance selection for two days at a culture temperature of 28° C. The Agrobacterium was transferred to a suspension culture medium and cultured on a shaker at 28° C. for 2-3 hours.

[0079] (6) Agrobacterium infection: transfer the pre-cultured callus into a sterilized bottle; adjust the Agrobacterium suspension to an OD of 600 0.8-1.0; soak the callus in the Agrobacterium suspension for 30 minutes; transfer the callus to the sterilized filter paper and dry it; then place it on the co-culture medium and culture it for 3 days at a culture temperature of 19-20°C.

[0080] (7) Callus washing and selective culture: Wash callus with sterile water until Agrobacterium is no longer visible; soak in sterile water containing 400 ppm carbenicillin (CN) for 30 minutes; transfer callus to sterilized filter paper and blot dry; transfer callus to selective medium for selection 2-3 times, each time for 2 weeks (the first screening carbenicillin concentration is 400 ppm, the second and subsequent screenings are 250 ppm, and the hygromycin concentration is 250 ppm).

[0081] (8) Differentiation: Transfer the resistant calli to the pre-differentiation medium and culture in the dark for 5-7 weeks; transfer the pre-differentiation culture calli to the differentiation medium and culture under light at 26°C.

[0082] (9) Rooting: Cut off the roots produced during differentiation; then transfer them to rooting medium and culture them under light at 26°C for 2-3 weeks.

[0083] (10) Transplantation: Wash off the residual culture medium on the roots and transfer the seedlings with good root system into the greenhouse while keeping them moist for the first few days.

[0084] 2. The genetic transformation of corn overexpression materials was completed by Weimi Biotechnology (Jiangsu) Co., Ltd.

[0085] 3. Genetic transformation of rapeseed:

[0086] Genetic transformation of rapeseed was carried out using Agrobacterium-mediated genetic transformation (De Block et al 1989). In this experiment, the recipient used for rapeseed transformation was Brassica napus Westar. The transformation process was as follows:

[0087] De Block M,De Brouwer D,Tenning P.Transformation of Brassica napusand Brassica oleracea Using Agrobacterium tumefaciens and the Expression of the bar and neo Genes in the Transgenic Plants.Plant Physiol,1989,91:694-701

[0088] (1) Seed disinfection and sowing: First, soak mature and plump Brassica napus seeds 'Westar' in 75% alcohol for 1 min, disinfect with 0.15% mercuric chloride solution for 12 min, and wash with sterile ddH2O for 4-5 times; sow the sterilized seeds in medium numbered M0 and culture in a dark room at 22°C for 6-7 days.

[0089] (2) Agrobacterium activation: Pick the target Agrobacterium and inoculate it into 50 mL of liquid LB, culture it at 28°C and 180 rpm to OD600 = 0.3-0.5 (about 12-14 h), collect the cells by centrifugation at 4000 rpm / min, suspend them in suspension DM (containing acetosyringone, with a final concentration of 0.05 mM), culture them at 28°C and 200 rpm / min for 1 h, and pour them into a culture dish for later use.

[0090] (3) Infection and co-cultivation: Use sterile forceps and a scalpel to cut the hypocotyls of the seedlings, each with a length of 0.8-1.0 cm (try to cut the explants vertically with one knife); place the cut explants in a dish containing bacterial solution and immerse them for 10 minutes, shaking them every once in a while; dry the infected explants with sterile filter paper, transfer them to medium numbered M1, and culture them at 22°C for 36-48 hours until cloud-like bacterial colonies appear around the explants.

[0091] (4) Selective culture for callus induction: The hypocotyl explants after co-culture are transferred to M2 medium for callus induction. The medium contains timentin (TMT) to inhibit the growth of Agrobacterium and hygromycin (Hyg), a selection antibiotic, and cultured under light for 18-21 days.

[0092] (5) Differentiation and bud regeneration: Eliminate brown explants and transfer explants with normal growth and swelling at both ends to differentiation medium M3 for light culture. Subculture every 2-3 weeks until green buds appear.

[0093] (6) Bud growth and rooting: The differentiated green buds are transferred to M4 medium and grown for 4 weeks. They will then grow roots and are then transferred to small pots and transplanted to the field.

[0094] 4. Arabidopsis genetic transformation:

[0095] The genetic transformation method for Arabidopsis thaliana is called the floral dip method, and the specific steps are as follows:

[0096] (1) The correctly sequenced vector was electroporated into the corresponding Agrobacterium competent cells GV3101-pMP90G, and the positive clones were detected and preserved.

[0097] (2) Take 1 ml of activated bacterial solution and add it to 250 mL of LB medium. Incubate in a shaking incubator at 28°C overnight until OD 600 0.8-1.2;

[0098] (3) Collect the cells at room temperature and centrifuge at 5000 rpm for 8 min;

[0099] (4) Discard the supernatant and resuspend in 250 mL of 5% sucrose solution;

[0100] (5) Add 100 μL of surfactant Silwet L-77 (GE Healthcare) to complete the preparation of the infection solution;

[0101] (6) Transform Arabidopsis thaliana at the peak flowering stage;

[0102] (7) Carefully immerse the Arabidopsis inflorescence in the infection solution for 40 seconds;

[0103] (8) Place the transformed Arabidopsis thaliana flat on a tray covered with plastic wrap, keep it moist and away from light overnight, and take it out and culture it normally under light the next day;

[0104] (9) After the plant seeds mature, harvest the seeds and screen for plant resistance based on the vector for subsequent experiments.

[0105] 5. Poplar genetic transformation:

[0106] This operation process takes the transformation of poplar 717 variety with hyg resistance vector as an example. Other varieties and screening systems can be fine-tuned according to this operation experimental process:

[0107] (1) Shaking bacteria

[0108] Liquid LB plus kanamycin (final concentration 50 mg / L) and rifampicin (final concentration 25 mg / L) were shaken (28°C) until the OD600 value was about 0.6. 50 mL of bacterial solution was transferred to a 50 mL centrifuge tube and centrifuged at 18°C, 3500 rpm, and 15 min. The supernatant was discarded and the resuspension solution was added to resuspend the suspension. The resuspension solution was finally added to a volume of about 100 mL (OD600 was about 0.3), and then the infection could be carried out.

[0109] (2) Infection

[0110] Remove the leaves of sterile seedlings (sterile seedlings that have grown in tissue culture bottles for 2-3 months) (select the 3rd to 8th leaves from the top of the seedling, and do not select yellow or dying leaves), use a scalpel to cut wounds on the leaves on filter paper, and infect the leaves in the infection solution for 10-15 minutes, shaking them from time to time.

[0111] (3) Co-culture

[0112] Use filter paper to absorb the bacterial solution on the infected leaves, but do not let the leaves get too dry. Place them upside down on the co-culture medium (WPMC) and keep them away from light for about 2 days (the length of time depends on the situation, as long as bacteria appear on the edge of the leaves but there are no large areas of bacterial plaques).

[0113] (4) Screening culture medium

[0114] Tear the leaves apart and transfer them to the screening medium (WPMS①) (hyg is 1.5 mg / L), continue to culture in the dark for about two weeks, and after the callus grows out, subculture them to the new screening medium (WPMS②) (hyg is 2 mg / L), subculture every two weeks, and later subculture them to WPMS②. Callus with a diameter of about 0.5 cm will grow in about one and a half months.

[0115] (5) Differentiation culture

[0116] After the callus grows to about 0.5 cm, transfer the callus to differentiation medium (hyg is 1.5 mg / L) and subculture once every three weeks. During this period, the callus will turn green (or red) and harden. This stage lasts about two months.

[0117] (6) Rooting culture

[0118] When the seedlings grow to about 1 cm, cut them and place them on rooting medium (hyg is 1.5 mg / L). They will take root in about a week.

[0119] Transgenic plants positive detection

[0120] (1) In order to detect the expression level of the target gene in the overexpressed transgenic plants, the applicant used the Real-time PCR method to perform expression analysis on the transgenic T0 generation plants. The total RNA used in the experiment was seedling RNA, and the product was reverse transcribed and the DUD1 transcription level was detected by real-time fluorescence quantitative PCR.

[0121] The PCR parameters were pre-denaturation at 95°C for 10 seconds, denaturation at 95°C for 5 seconds, annealing and extension at 60°C for 30 seconds, and 40 cycles. The primer sequences used for real-time PCR were:

[0122] DUD1-QF:TACGCTTCTGCCGGATTTGT

[0123] DUD1-QR: CCATCGATACCCCTCCCGTA

[0124] The expression of the target gene was detected in the T0 and T1 generations of transgenic plants, and the expression results of DUD1 in the T1 generation of overexpressed transgenic rice were finally obtained. Figure 3 Middle (d). Real-time PCR results showed that among the transgenic rice materials, the expression level of DUD1 in the OE1 and OE4 lines was significantly increased compared with the wild-type KY131, indicating that the overexpression effect was very good.

[0125] In transgenic maize, Arabidopsis, rapeseed and poplar materials, the expression level of positive plants was also detected. The real-time PCR results showed that in the transgenic maize materials, the expression level of DUD1 in the individual plants of families OE#53, OE#55 and OE#57 increased significantly compared with the wild type KN5585, which was an over-expression material ( Figure 4 (c).

[0126] Among the transgenic Arabidopsis thaliana materials, the expression level of DUD1 in the lines OE23 and OE27 was significantly increased compared with the wild type KN5585, and they were overexpression materials ( Figure 5 a).

[0127] Among the transgenic rapeseed materials, the expression levels of DUD1 in the individual plants of families OE#11, OE#17 and OE#27 were significantly increased compared with the wild-type Westar, and they were overexpression materials ( Figure 6 a).

[0128] Among the transgenic poplar materials, the expression level of DUD1 in the individual plants of families OE-3 and OE-19 increased significantly compared with the wild type 717, and they were overexpression materials ( Figure 7 Middle B)

[0129] (2) In order to detect the gene editing of CRISPR mutant plants, the leaves of rice T0 and T1 generation transformed plants were used to extract total DNA. The DNA extraction method was CTAB method (Zhang et al., genetic diversity and differentiation of indica an japonica rice detected by RFLP analysis, 1992, Theor Appl Genet, 83, 495-499). Using the total leaf DNA as a template, the T0 and T1 generation CRISPR transformed plants were tested by PCR using the following primers for positive detection.

[0130] The sequences of the primers are as follows:

[0131] DUD1-CRI-F:AGCAAATGATTATTGTAGCACCAC;

[0132] DUD1-CRI-R:TGACCAACTCCGCCGAAACC;

[0133] All the above primers were synthesized by Qingke Biotechnology Co., Ltd.

[0134] The total volume of the PCR reaction was 20 μl, and the specific preparation was: template 100 ng, 10xPCR buffer 2 μl, 10 mM dNTP 1.6 μl, 2.5 mM Mg 2+ 1.5μl, forward primer, reverse primer (DUD1-CRI-F and DUD1-CRI-R) 0.4μl each, r-Taq enzyme 0.2μl, add deionized water to 20μl (the PCR buffer, dNTP, Mg used 2+ , r-Taq enzyme, etc. were purchased from Bao Biotechnology Dalian Co., Ltd.). The PCR reaction conditions are as follows: ① 94℃ for 4 minutes, ② 94℃ for 30 seconds, ③ 57℃ for 30 seconds, ④ 72℃ for 1 minute, ⑤ 32 cycles from ② to ④, ⑥ 72℃ for 7 minutes, ⑦ 4℃ storage. The PCR products were detected by electrophoresis on 1% (mass / volume) TBE agarose gel, and the amplified fragments were sent to a sequencing company for sequencing. The sequencing results were then compared with the reference sequence to determine the genotype. In the transgenic T1 generation plants, homozygous mutants CRI#6 and CRI#27 families were obtained. The sequencing results are shown in Figure 1 shown.

[0135] Among them, CRI#6 contains a mutated gene, and its polynucleotide sequence is shown in SEQ ID NO.3.

[0136] CRI#27 contains a mutated gene, and its polynucleotide sequence is shown in SEQ ID NO.4.

[0137] Embodiment 5:

[0138] Method for Identifying Drought Resistance of Rice Genetic Materials in Pots at Booting Stage

[0139] The potted drought resistance identification of relevant materials was completed on the rice phenotyping platform.

[0140] The tested materials were sown in bread pots for seedling raising and transplanted into medium blue buckets after 25 days. Each bucket was filled with 4.5 kg of air-dried soil (bucket weight 0.2 kg), and the soil was soaked two days before transplanting the seedlings. During transplanting, one rice seedling was planted in each medium blue bucket, and 12 seedlings were planted in each family, of which 6 were subjected to drought stress as the treatment group and 6 were grown normally as the normal group. During the tillering period of rice, 150 ml of liquid fertilizer was added to each bucket. The liquid fertilizer formula was 371 g urea, 331 g KH2PO4, and 94 g KCl, and then water was added to 60 L. When the rice enters panicle differentiation, pour out the clear water in the treatment group bucket. In the early stage of drought treatment, use a platform scale to make each bucket of material enter drought stress at 5.8kg (including the bucket weight), and then slowly reduce the weight to 5.4kg (including the bucket weight). Drought stress lasts for 10 days, and 50ml of water is poured into each bucket every evening. After the drought treatment, rewatering is carried out to ensure that there is clear water on the soil surface for normal growth of rice. In this experimental process, the materials were transported to the rice phenotyping platform to obtain I-traits before stress, during stress, and on the third day after rewatering.

[0141] Embodiment 6:

[0142] Identification of drought stress phenotypes of rice dud1 CRISPR mutants at the booting stage

[0143] The homozygous mutants (dud1-Cri, i.e., C6 and C27) with identified genotypes and the transgenic recipient wild-type rice KY131 material were subjected to drought resistance identification according to the method of Example 5. The phenotypic results are shown in Figure 2 As shown in a, under normal conditions, there was no difference in the growth of the control KY131 and the dud1 CRI SPR homozygous mutant plants. After drought stress, the dead leaves of the mutant material were significantly more than those of the control KY131. The relative greenness of the two mutant families was 0.51 and 0.48, respectively, which was significantly lower than the control of 0.93 ( Figure 2 These data indicate that knocking out DUD1 in rice reduces rice's tolerance to drought ( Figure 2 ).

[0144] Embodiment 7:

[0145] Identification of drought stress phenotypes of rice DUD1 overexpressing materials in potted plants at the booting stage

[0146] The overexpression material with identified genotype and the transgenic receptor wild-type KY131 material were subjected to drought resistance identification according to the operation method of Example 5. The phenotypic results are shown in Figure 3As shown in a, under normal conditions, there was no difference in the growth of the control KY131 and the DUD1 overexpression family. After drought stress, the dead leaves of the overexpression material were significantly less than those of the control KY131. The relative green retention of the two families of the overexpression material was 0.95 and 0.93, respectively, which was significantly higher than 0.62 ( Figure 3 These data indicate that overexpression of the DUD1 gene can significantly enhance rice's tolerance to drought ( Figure 3 ).

[0147] Embodiment 8:

[0148] Identification of Drought Stress Phenotypes of DUD1 Transgenic Maize Materials in Pots at Seedling Stage

[0149] The overexpression materials with identified genotypes and the transgenic and wild-type corn materials were germinated and sown directly into small round barrels. The seedlings with the same growth were transplanted into medium-sized blue barrels. The soil used in the experiment was a mixture of paddy soil from southern China and coarse sand in a volume ratio of 2:3. Each round barrel was filled with an equal amount of uniform sand and water. The water leaked by itself to ensure the consistency of soil compaction. The experiment was repeated 5 times. The healthy plants at the 4-leaf stage were photographed and recorded as before drought, and the crop phenotyping platform was used to take photos and extract i-traits. Then, water was cut off and drought stress was carried out for 20 days. When the degree of leaf wilting between the wild-type material and the transgenic material was significantly different, photos were taken and recorded as the post-drought phenotype, and the crop phenotyping platform was used to extract i-traits.

[0150] Phenotypic results Figure 4 As shown in Figure 2, under normal growth conditions, there was no significant difference in growth between the transgenic material and the isolated wild-type material ( Figure 4 (a). After drought treatment, the green retention of transgenic materials was significantly higher than that of wild type ( Figure 4 In b), the GPAR_R indexes of the three families of transgenic materials were 0.59, 0.69 and 0.70, which were significantly higher than 0.02 of the wild-type material ( Figure 4 These data indicate that overexpression of the rice DUD1 gene in maize can significantly enhance maize's tolerance to drought ( Figure 4 ).

[0151] Embodiment 9:

[0152] Identification of Drought Stress Phenotypes of DUD1 Transgenic Arabidopsis Seedlings in Pots

[0153] The overexpression materials with identified genotypes and the transgenic recipient Columbia wild-type materials were sown in seedling trays. When leaves grew out, they were transplanted into small pots, with 24 seedlings in each pot and 4 replicates for each family. They were grown under normal conditions for three weeks and photographed as before drought. Then the water was cut off for 7-9 days. When a significant difference in the degree of leaf wilting between the control group and the experimental group was observed, photographs were taken and recorded as the phenotype after drought. Then, rehydration treatment was carried out, that is, water was added to the tray under the pot to ensure that there was clear water in the tray for normal growth of Arabidopsis. After 3 days, photographs were taken again and recorded as the phenotype after rehydration. Then, the number of surviving seedlings in each pot was counted, and the survival rate was calculated. Compared with the Columbia wild-type material, after rehydration, the survival rates of Arabidopsis plants overexpressing DUD1 were 58% and 98%, respectively, which were significantly higher than the 8% of the wild type. This shows that expressing rice DUD1 in Arabidopsis can significantly enhance the drought resistance of Arabidopsis. ( Figure 5 b and c).

[0154] Embodiment 10:

[0155] Identification of Drought Stress Phenotypes of DUD1 Transgenic Rapeseed in Pots at Seedling Stage

[0156] The overexpression materials with identified genotypes and the wild-type Westar materials of transgenic receptors were sown in seedling trays. When leaves grew out, they were transplanted into small pots, with one seedling in each small pot. Each family was planted 5 times, of which 2 replicates were cut off from water after 10 days of growth, and the other 3 replicates were cut off from water after 30 days of growth. After the two treatment groups observed significant differences in the degree of leaf wilting between the control group and the experimental group, they were rehydrated after further stress for 3 days. That is, water was added to the seedling tray to ensure that there was clear water in the tray under the pot for the rapeseed to recover normal growth.

[0157] Compared with wild-type Westar, after rewatering, DUD1-overexpressing rapeseed showed a more drought-resistant phenotype ( Figure 6 (b)

[0158] Embodiment 11:

[0159] Identification of Drought Stress Phenotypes of DUD1 Transgenic Poplar Materials in Pots

[0160] The overexpression material of identified genotype and the wild-type material of transgenic receptor 717 were planted in rooting medium (25 days), and transplanted into potted small red buckets after rooting. Each small red bucket was planted with 1 seedling, and each family was planted with 4 repetitions. In the growth room, it was grown for 3 months under normal conditions, with a growth temperature of 23 degrees, 16 hours of light, and 50% indoor humidity. The growth state of the material was recorded the day before the water-cut treatment, and the number of leaves of each poplar was recorded. After 5 days of water-cutting, the rehydration treatment was carried out, that is, water was added to the large basin below the small red bucket to ensure that there was 3-5cm of clear water in the basin for normal growth of poplar. After 7 days of rehydration, the phenotype after rehydration was recorded again, and then the number of leaves still surviving for each poplar seedling was counted. Compared with the wild-type 717 material, after rehydration, the average leaf survival rates of DUD1-overexpressing poplar plants were 35% and 42%, respectively, which were significantly higher than the 0% of the wild-type 717. This indicates that expressing rice DUD1 in poplar can significantly enhance the drought resistance of poplar ( Figure 7 ).

Claims

1. Application of DUD1 protein or a gene encoding DUD1 protein in regulating plant drought resistance, wherein the DUD1 protein is shown in SEQ ID NO.

2.

2. The use according to claim 1, characterized in that: The drought resistance of plants is improved by increasing the expression of DUD1 protein or a gene encoding DUD1 protein in the plants. The method comprises: introducing a substance that increases the expression of DUD1 protein or a gene encoding DUD1 protein into the plants, wherein the substance is a nucleic acid molecule containing a DUD1 protein encoding nucleic acid, or an expression frame thereof, a recombinant vector, or a recombinant microorganism.

3. The use according to claim 1, characterized in that: Inhibiting or reducing the expression of DUD1 protein in rice can weaken the drought resistance of rice.

4. The use according to claim 1, characterized in that: Knocking out, inhibiting or silencing the expression of the gene encoding the DUD1 protein in rice can weaken the drought resistance of rice.

5. The use according to claim 4, characterized in that: When applied in rice, the knockout adopts the CRISPR / Cas9 system, and the target site of the gRNA in the system is GAACAGAAGAGAAGGAAGCATCGG.

6. The use according to claim 5, characterized in that: The rice with reduced drought resistance after editing by the CRISPR / Cas9 system contains the polynucleotide shown in SEQ ID NO.3 or SEQ ID NO.

4.

7. Use of DUD1 protein or a gene encoding DUD1 protein in preparing drought-resistant transgenic plants, wherein the DUD1 protein is represented by SEQ ID NO.2, and the method comprises: A substance that increases the expression of DUD1 protein or the expression of a gene encoding DUD1 protein is introduced into the plant. The substance is a nucleic acid molecule containing the DUD1 protein, or an expression frame thereof, a recombinant vector, or a recombinant microorganism.

8. The use according to claim 7, characterized in that: The introduction method is direct DNA transformation, microinjection or electroporation.

9. The use according to claim 1 or 7, wherein the plant is rice, corn, rapeseed, Arabidopsis or poplar.

Images