Application of Rice Circadian Regulatory Protein ELF3-1 and Its Encoding Gene in Disease Resistance Breeding

By knocking out the encoding gene ELF3-1 of the rice rhythm regulatory protein ELF3-1, CRISPR technology is used to reduce its expression, which solves the problem of insufficient resistance to rice blast, and significantly enhances rice disease resistance and provides new breeding genes.

CN118638849BActive Publication Date: 2025-08-19SICHUAN AGRI UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202410807894.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-06-21
Publication Date
2025-08-19
Estimated Expiration
2044-06-21

AI Technical Summary

Technical Problem

The lack of effective genes in the prior art is used to improve rice resistance to rice blast, resulting in the impact of rice yield and quality.

Method used

Knock out the encoding gene ELF3-1 of the rice rhythm regulatory protein ELF3-1, and use CRISPR gene editing technology to reduce or inhibit the expression of ELF3-1, thereby enhancing the resistance of rice to rice blast.

Benefits of technology

The ELF3-1 functional deletion plants significantly enhance their resistance to rice blast, providing new genes for improving the resistance to rice, and have important breeding value.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118638849B_ABST
    Figure CN118638849B_ABST
Patent Text Reader

Abstract

The present invention discloses the application of rice rhythm control protein ELF3-1 and its encoding gene in disease resistance breeding, which belongs to the field of biotechnology. The present invention identifies a rice rhythm control protein ELF3-1 whose expression is induced by rice blast fungus. The amino acid sequence of the rice rhythm control protein ELF3-1 is shown in SEQ ID NO.4, and the encoding gene ELF3-1 is located at LOC_Os06g05060 of chromosome 6, and the nucleotide sequence is shown in SEQ ID NO.3. The present invention's research shows that compared with wild-type rice plants (ZH11), the rice blast resistance of ELF3-1 functional deletion plants (ELF3-1-KOs) is significantly enhanced. These results show that ELF3-1 negatively regulates rice resistance to rice blast and can be used as a target gene for molecular breeding to improve plant disease resistance.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to application of rice rhythmic regulatory protein ELF3-1 and its encoding gene in disease-resistant breeding. Background Art

[0002] Fungal diseases can cause significant crop yield losses and, to a certain extent, impact food safety. Therefore, breeding disease-resistant crops is a major goal of the agricultural industry. Numerous genes associated with plant disease resistance have been reported, including both effector and regulatory genes, from crops such as rice, wheat, maize, and soybean, as well as from the model plant Arabidopsis thaliana. Several of these have been used as target genes in genetic engineering for crop disease resistance, resulting in the successful development of disease-resistant rice, wheat, maize, and soybean varieties. However, due to differences in genetic background, the application of some genes remains limited, necessitating the continued need for new relevant genes to meet breeding needs.

[0003] In plants, the ELF3 protein is generally considered a photoperiod-sensitive protein, playing a key role in regulating circadian rhythms, flowering time, leaf morphology, and photosynthesis. In rice, OsELF3 is also involved in the photoperiod signaling pathway, interacting with other photoperiod-related genes to determine flowering time. For example, the cloning and functional validation of the OsELF3 gene have shown that its normal function is crucial for rice to head at the appropriate time. Mutations or abnormal expression of the OsELF3 gene can cause premature or delayed heading in rice, directly affecting yield and quality. However, whether the rice ELF3 protein is associated with disease resistance has not been reported. Summary of the Invention

[0004] The present invention aims to provide the application of the rice circadian regulatory protein ELF3-1 and its encoding gene in disease resistance breeding to address the problems of the prior art. The present invention identifies a rice circadian regulatory protein, ELF3-1, whose expression is induced by the blast fungus. Studies have shown that ELF3-1-deficient plants (ELF3-1-KOs) exhibit significantly enhanced resistance to rice blast compared to wild-type rice plants (ZH11). This suggests that ELF3-1 negatively regulates rice resistance to rice blast and can be used as a target gene in molecular breeding to improve plant disease resistance.

[0005] To achieve the above object, the present invention provides the following solutions:

[0006] The present invention provides a rice rhythm regulatory protein ELF3-1 and an application of its encoding gene ELF3-1 in regulating rice disease resistance. Knocking out the encoding gene ELF3-1 of the rice rhythm regulatory protein ELF3-1 can improve rice resistance to rice blast.

[0007] The rice rhythmic regulatory protein ELF3-1 includes a protein with an amino acid sequence as shown in SEQ ID NO. 4, or a protein obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID NO. 4, which has more than 80% identity with the protein shown in SEQ ID NO. 4 and has the function of negatively regulating plant disease resistance;

[0008] In the above-mentioned proteins, identity refers to amino acid sequence identity. Amino acid sequence identity can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, using Advanced BLAST 2.1, blastp can be used as the program, with the Expect value set to 10, all filters set to OFF, BLOSUM62 as the matrix, and the Gap existence cost, Per residue gap cost, and Lambda ratio set to 11, 1, and 0.85 (default values), respectively. The identity of a pair of amino acid sequences can be calculated and the identity value (%) can be obtained.

[0009] In the above proteins, the above 80% or greater identity may be at least 81%, 82%, 85%, 86%, 88%, 90%, 91%, 92%, 95%, 96%, 98%, 99% or 100% identity.

[0010] The nucleotide sequence encoding the gene ELF3-1 is shown in SEQ ID NO.3.

[0011] The present invention also provides a method for regulating rice disease resistance, comprising knocking out the gene ELF3-1 encoding the rice rhythm regulatory protein ELF3-1, inhibiting or reducing or downregulating the expression level of the rice rhythm regulatory protein ELF3-1, and improving the rice's resistance to rice blast;

[0012] The material for knocking out the gene ELF3-1 encoding the rice rhythm regulatory protein ELF3-1 includes a recombinant vector or recombinant microorganism for knocking out the gene ELF3-1 encoding the gene, and the recombinant vector contains a gRNA targeting the gene ELF3-1 encoding the gene, and the target sequence of the gRNA is shown in SEQ ID NO.5.

[0013] The material for knocking out the gene ELF3-1 encoding the rice rhythm regulatory protein ELF3-1 also includes a nucleic acid molecule encoding the rice rhythm regulatory protein ELF3-1 or an expression cassette containing the nucleic acid molecule. The expression cassette containing the nucleic acid molecule refers to a DNA capable of expressing the protein in the above application in a host cell. The DNA may include not only a promoter for initiating transcription of the protein-coding gene, but also a terminator for terminating transcription of the protein-coding gene.

[0014] Furthermore, the expression cassette also includes an enhancer sequence. Promoters that can be used in the present invention include, but are not limited to, constitutive promoters, tissue-, organ- and development-specific promoters, and inducible promoters.

[0015] Available existing plant expression vector construction knocks out the recombinant vector of described coding gene ELF3-1.Described plant expression vector comprises binary agrobacterium vector and the carrier etc. that can be used for plant microprojectile bombardment.Such as pAHC25, pWMB123, pBin438, pCAMBIA1302, pCAMBIA2301, pCAMBIA2300, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa or pCAMBIA1391-Xb (CAMBIA company) etc.Described plant expression vector can also comprise the 3 ' end non-translated region of foreign gene, promptly comprise polyadenylic acid signal and any other DNA fragment that participates in mRNA processing or gene expression. The polyadenylation signal can guide the addition of polyadenylic acid to the 3' end of the mRNA precursor. For example, the 3' transcribed untranslated region of Agrobacterium crown gall-inducing (Ti) plasmid genes (such as the nopaline synthase gene Nos) and plant genes (such as the rice starch synthase gene) all have similar functions. When constructing a recombinant vector for knocking out the coding gene ELF3-1, enhancers, including translation enhancers or transcription enhancers, can also be used. These enhancer regions can be ATG start codons or adjacent start codons, but must be in the same reading frame as the coding sequence to ensure correct translation of the entire sequence.

[0016] The present invention also provides the use of rice rhythm regulatory protein ELF3-1 and its encoding gene ELF3-1 in cultivating highly disease-resistant rice. By knocking out the encoding gene ELF3-1 of the rice rhythm regulatory protein ELF3-1, the obtained rice plants have enhanced disease resistance to rice blast.

[0017] The present invention also provides the application of rice rhythm regulatory protein ELF3-1 and its encoding gene ELF3-1 in gene editing-assisted breeding of rice.

[0018] Furthermore, the gene editing is to use CRISPR gene editing technology to knock out the gene ELF3-1 encoding the rice rhythm regulatory protein ELF3-1.

[0019] Furthermore, knocking out the gene ELF3-1 encoding the rice rhythm regulatory protein ELF3-1 specifically includes constructing a recombinant vector for knocking out the coding gene ELF3-1, and using the recombinant vector to knock out the coding gene ELF3-1, the recombinant vector contains a gRNA targeting the coding gene ELF3-1, and the target sequence of the gRNA is shown in SEQ ID NO.5.

[0020] The present invention discloses the following technical effects:

[0021] This study identified a rice circadian rhythmic regulator protein, ELF3-1, whose expression is induced by the rice blast fungus. The gene encoding this protein is located at LOC_Os06g05060 (ELF3-1) on chromosome 6. Previous functional studies of this gene have focused on regulating rice circadian rhythms and flowering time. The present study demonstrated that ELF3-1-deficient plants (ELF3-1-KOs) exhibit significantly enhanced resistance to rice blast compared to wild-type rice plants (ZH11). These results suggest that ELF3-1 negatively regulates rice resistance to rice blast and could be used as a target gene in molecular breeding to improve plant disease resistance.

[0022] The invention provides a new gene for breeding highly disease-resistant rice varieties and has important value for improving rice disease resistance. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0024] Figure 1 The expression changes of ELF3-1 before and after rice blast infection are shown in the figure. The asterisk above the bar graph indicates significant difference (P<0.01);

[0025] Figure 2 Comparison of disease resistance phenotypes between ELF3-1 knockout plants (oself3-1-KO) and wild-type plants (ZH11), scale bar is 1 cm;

[0026] Figure 3Figure 3 shows the length of leaves damaged by pathogens (A) and the relative growth of fungi (B) in ELF3-1 knockout plants (oself3-1-KO) and wild-type plants (ZH11) after inoculation. DETAILED DESCRIPTION

[0027] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0028] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. The intermediate value within any stated value or stated range, and each smaller range between any other stated value or intermediate value within the stated range, is also encompassed within the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0029] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0030] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be illustrative only.

[0031] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0032] The rice variety Zhonghua 11 (O. Sativa L. spp. japonica, var. Zhonghua 11, AA genome, ZH11) involved in the examples of this invention belongs to the japonica subspecies and is described in the following literature: Ni Yuchong, "A New Rice Variety—Zhonghua 11," Agricultural Science and Technology Communications, July 35, 1989; provided by Professor Chen Xuewei of the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences. The plant binary expression vector pTCRISPR was provided by Associate Professor Tang Yongyan of the State Key Laboratory of Sichuan Agricultural University. The inventors commit to distributing the above materials to the public within 20 years from the filing date.

[0033] The EFL3-1 gene knockout plants were produced by Boyuan Biotechnology Company.

[0034] Total RNA extraction kit: TRIzol purchased from Invitrogen, USA, catalog number 15596026.

[0035] Reverse transcription kit: HiScript III RT SuperMix for qPCR (+gDNA wiper) purchased from Vanzyme, China, catalog number R323-01.

[0036] Example 1 Rice protein ELF3-1 and its cloning

[0037] The inventors screened a protein EFL3-1 in rice, whose expression was induced by rice blast fungus. Specifically, the protein EFL3-1 was induced by rice blast fungus spore suspension (5×10 5 The rice varieties Zhonghua 11 were sprayed with 0.1% Tween 20 (0.1% / mL) and recorded as the sprayed group Zhong10-8-14. The control group Mock was sprayed with 0.1% Tween 20. The expression levels of the gene EFL3-1 were detected at 0 h and 12 h after the blast infection. The results are shown in Figure 2. Figure 1 As shown in Figure 1, 12 hours after infection with rice blast fungus, the expression level of the EFL3-1 gene in rice increased significantly.

[0038] According to the reference gene sequence of rice Nip genome, primers EFL3-1F and EFL3-1R were designed to clone the EFL3-1 gene.

[0039] EFL3-1F: ATGGCGACGAGGGGAGGAGG, SEQ ID NO.1;

[0040] EFL3-1R: TCAATCATCTCGTTGCCGTT, SEQ ID NO. 2.

[0041] Using total cDNA from the rice variety Zhonghua 11 (ZH11) as a template, the aforementioned primers amplified a 2283bp DNA band. Sequencing confirmed this to be the ELF3-1 gene, which belongs to the rhythmic protein family. Alignment of the LOC_Os06g05060 (ELF3-1) sequence in the rice genome reference sequence with the cloned sequence amplified from the ZH11 total cDNA revealed that the cloned sequence obtained from ZH11 was identical to the LOC_Os06g05060 (ELF3-1) sequence. The amino acid sequence of the ELF3-1 protein is shown in SEQ ID NO. 4. The CDS sequence of the ELF3-1 gene encoding the ELF3-1 protein is shown in SEQ ID NO. 3.

[0042] The CDS sequence of gene ELF3-1 (SEQ ID NO.3) is as follows:

[0043]

[0044] The amino acid sequence of the ELF3-1 protein (SEQ ID NO. 4) is as follows:

[0045] .

[0046] Example 2 Construction of ELF3-1 knockout vector

[0047] The plant binary expression vector pTCRISPR was used as the entry vector to construct the ELF3-1 knockout vector pTCRISPR-sgRNAELF3-1.

[0048] Using the rice Nip genome as a template, we designed the knockout target sequence:

[0049] CCCTCGCATCGGCTTCAGCGG, SEQ ID NO. 5.

[0050] The following primers were designed and synthesized:

[0051] F: TGTGCCCTCGCATCGCTTCAGCGGG, SEQ ID NO.6;

[0052] R:AAAACCCGCTGAAGCGATGCGAGGG, SEQ ID NO.7.

[0053] After denaturing the primers at 95°C, anneal them to form double-stranded copies. The pTCRISPR vector was digested with BsaI to recover the linearized vector. The double-stranded DNA and the linearized vector were mixed using the ligation system in Table 1. The reaction was ligated with T4 DNA ligase and incubated at room temperature for 30 minutes to obtain the pTCRISPR-sgRNAELF3-1 knockout vector.

[0054] Table 1 Connection system

[0055] Double-stranded DNA fragments 0.5-4 μL Linearized vector 0.5-4 μL T4 DNA ligase 2μL <![CDATA[ddH2O]]> Make up to 20 μL

[0056] The pTCRISPR-sgRNAELF3-1 knockout vector was transformed into DH5α competent cells. After kanamycin selection, single clones were picked for colony PCR identification. The plasmids of positive colonies were extracted and sequenced to confirm that the pTCRISPR-sgRNA was correct. ELF3-1 The ELF3-1 knockout transgenic rice was produced by Boyuan Biotechnology Company.

[0057] Example 3 ELF3-1 is involved in regulating plant disease resistance

[0058] The inventors tested the effect of ELF3-1 on rice disease resistance. Treatment of seedling-stage wound inoculation: The test materials were Zhonghua11 (ZH11) and the genetically stable ZH11 knockout strain ELF3-1-KO with ZH11 as the background. Select seeds with full grains, put them in a conical flask filled with tap water, and place them in a dark incubator at 37°C for germination, and change the water every day. After 2 days, select white seeds and put them in a 96-well seedling plate, put the 96-well seedling plate on a float, and grow them in Hoagland nutrient solution. After 21 days, select the second-to-last rice leaf from top to bottom with the same growth and size, and inoculate 5μL of a concentration of 5×10 5The blast fungus spore suspension was inoculated with 1000 spores / mL of rice blast fungus, and the length of the lesions was observed and counted after 5 days. The statistics showed that after the puncture inoculation, the number and length of lesions of ELF3-1-KO plants in the ZH11 background were significantly reduced compared with ZH11, and the disease resistance was enhanced ( Figure 2 and Figure 3 This indicates that ELF3-1 negatively regulates plant disease resistance and its encoding gene ELF3-1 can be used as a target gene in molecular breeding to improve plant disease resistance.

[0059] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.

Claims

1. Application of a gene encoding rice rhythmic regulatory protein ELF3-1 in improving rice resistance to rice blast, characterized in that: Knocking out the gene encoding the rice circadian regulatory protein ELF3-1; The amino acid sequence of the rice rhythm regulatory protein ELF3-1 is shown in SEQ ID NO.4, and the nucleotide sequence of the gene is shown in SEQ ID NO.

3.

2. A method for improving rice resistance to rice blast, characterized in that: The method comprises knocking out the coding gene of the rice rhythm regulatory protein ELF3-1, thereby reducing the expression level of the rice rhythm regulatory protein ELF3-1 and improving the resistance of rice to rice blast; The amino acid sequence of the rice rhythm regulatory protein ELF3-1 is shown in SEQ ID NO.4, and the nucleotide sequence of the encoding gene is shown in SEQ ID NO.

3.

3. The use of a gene encoding a rice rhythmic regulatory protein ELF3-1 in cultivating rice with high resistance to rice blast, characterized in that: Knocking out the gene encoding the rice rhythm regulatory protein ELF3-1, the resulting rice plants have enhanced resistance to rice blast; The amino acid sequence of the rice rhythm regulatory protein ELF3-1 is shown in SEQ ID NO.4, and the nucleotide sequence of the encoding gene is shown in SEQ ID NO.3.

Citation Information

Patent Citations

  • Method for prolonging rice heading period by targeting OsELF3 gene by gene editing technology

    CN108823236A