Engineered Cas9 protein and its preparation method and application

Abstract

The present invention discloses an engineered Cas9 protein and a preparation method and application thereof. The present invention finds that the Cas9 protein can be degraded by the autophagy-lysosomal pathway mediated by a molecular chaperone, and amino acid sequence analysis finds that the Cas9 protein contains a motif that can bind to the molecular chaperone heat shock homologous protein 70. On this basis, the present invention constructs Cas9 mutant proteins respectively, and then obtains a highly stable Cas9 protein with combined mutations, which provides a new tool and new strategy for the CRISPR / Cas9 system in targeted elimination of viral infections. In addition, the highly stable Cas9 protein constructed by the present invention will help expand the application of gene editing systems and effectively reduce the cost of gene editing.

Description

Technical Field

[0001] The present invention relates to the field of gene editing technology, and specifically to engineered Cas9 protein and a preparation method and application thereof. Background Art

[0002] Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) is a widely existing prokaryotic defense system in nature, used to resist invading bacteriophages and foreign genetic materials. This defense system recognizes specific DNA sequences through a single-stranded guide RNA (gRNA) and guides CRISPR-associated (Cas) proteins with endonuclease activity to cut DNA double strands. The CRISPR / Cas system exists in a variety of bacteria and archaea, including three main types (type I, type II and type III) and 12 subtypes. Compared with type I and type III, the type II CRISPR / Cas system can rely on a single Cas protein to accurately target specific DNA sequences, so it is currently a widely used gene editing system. The CRISPR / Cas9 system is a member of the type II CRISPR / Cas system. Due to its simple operation and high editing efficiency, the system is currently the most widely used gene editing system in the world, and has brought many new possibilities to scientific research, especially providing strong technical support for disease treatment and crop improvement.

[0003] The CRISPR / Cas9 system consists of a Cas9 protein with DNA endonuclease activity and a guide RNA (gRNA) fused with a CRISPR RNA (crRNA) and a trans-activating crRNA (tracrRNA). During gene editing, the gRNA guides the Cas9 protein to the complementary DNA sequence next to the adjacent protospacer-adjacent motif (PAM), and then the endonuclease activity of the Cas9 protein mediates specific double strand breaking (DSB). Insertion or deletion mutations caused by non-homologous end joining (NHEJ) repair triggered by DSB can lead to frameshifting of the target gene. Currently, plasmid DNA, mRNA or Cas9 / gRNA ribonucleoprotein complex (RNP) of the CRISPR / Cas9 system can be delivered to target cells through delivery systems such as viral vectors, nanoparticles or extracellular vesicles, and have been widely used in clinical / preclinical trials for the treatment of various genetic diseases. It is worth mentioning that on November 16, 2023, the Medicines and Healthcare products Regulatory Agency (MHRA) of the United Kingdom announced the approval of CASGEVY, a CRISPR / Cas9 gene editing therapy product jointly developed by Vertex Pharmaceuticals Incorporated and CRISPR Therapeutics. TM (exagamglogene autotemcel, Exa-cel) conditional marketing authorization. On December 8, 2023, the U.S. Food and Drug Administration (FDA) also approved the product for marketing. This is the world's first gene editing therapy approved for the treatment of sickle cell disease (SCD) and β-thalassemia (TDT), and it is also the first therapy approved for the use of CRISPR / Cas9 "gene scissors". The world's first approval of CRISPR / Cas9 gene editing therapy will bring major changes to the medical field, and indicates that CRISPR / Cas9 technology has a very broad application prospect.

[0004] As an adaptive immune system for prokaryotes to resist phages and foreign genetic material, the CRISPR / Cas9 system is also widely used to target and eliminate various viral infections, including human immunodeficiency virus (HIV), herpes simplex virus (HSV), Epstein-Barr virus (EBV), human cytomegalovirus (HCMV), human papillomavirus (HPV) and hepatitis B virus (HBV). Unlike the human genome, the viral genome can be continuously amplified in human cells. Taking HBV as an example, the complete HBV virus particle contains a partially double-stranded relaxed circular DNA (rcDNA) with a length of about 3.2 kb. After infecting hepatocytes, part of the rcDNA enters the cell nucleus and is converted into a template for the replication of the daughter rcDNA - covalently closed circular DNA (cccDNA). In turn, the newly generated progeny rcDNA can also enter the nucleus to replenish the cccDNA pool, so that cccDNA is continuously updated and amplified in hepatocytes and maintained at a certain level. HBV infection has imposed a heavy burden on the global economy and health systems, and seriously endangers people's health. At present, the main antiviral drugs for HBV in clinical practice are long-acting interferon and nucleoside (acid) drugs. Although both drugs can effectively inhibit HBV replication and delay the progression of the disease, the clinical cure rate is low. The reason is mainly because current drugs cannot directly act on HBV cccDNA. Although the inventors and other research teams have reported that the CRISPR / Cas9 system can efficiently inhibit HBV replication by destroying the HBV genome, in order to eliminate the continuously amplified cccDNA, a more stable and efficient CRISPR / Cas9 system is still needed.

[0005] Since the Cas9 / gRNA ribonucleoprotein (RNP) complex can achieve gene editing quickly and efficiently with high safety, its application is becoming more and more widespread. In the Cas9 / gRNARNP complex, although the stability of gRNA can be improved by a variety of chemical modifications, a more stable Cas9 protein is still needed to more efficiently and persistently destroy the continuously expanding viral genome. However, the degradation mechanism of Cas9 protein in cells has not yet been elucidated. Therefore, revealing the degradation mechanism of Cas9 protein in cells and constructing a highly stable Cas9 protein on this basis will help to target and eliminate viral infections and effectively reduce the cost of gene editing by reducing the amount of Cas9 protein in the Cas9 / gRNA RNP complex. Summary of the invention

[0006] In order to solve at least some of the problems in the prior art, the present invention constructs a highly stable engineered Cas9 protein, thereby providing a new tool and strategy for the CRISPR / Cas9 system in targeted elimination of viral infections, and can reduce the amount of Cas9 protein used and effectively reduce the cost of gene editing, thereby contributing to the further promotion and application of the CRISPR / Cas9 system. Specifically, the present invention includes the following contents.

[0007] In a first aspect of the present invention, there is provided the use of an engineered Cas9 protein in the preparation of a drug for treating or ameliorating viral infection, wherein the engineered Cas9 protein contains at least one amino acid mutation in the pentapeptide motif at positions 669-673 and / or 892-896.

[0008] In certain embodiments, according to the use of the present invention, the mutation includes at least one of a non-K amino acid at position 672, a non-Q amino acid at position 673, a non-Q amino acid at position 892, and a non-R amino acid at position 893.

[0009] In certain embodiments, according to the use of the present invention, the non-K amino acid is selected from at least one of A, N, V, G, L, Q, F, W, Y, D, S, E, M, T, C, P, H and I.

[0010] In certain embodiments, according to the use of the present invention, the non-Q amino acid is selected from at least one of A, N, V, G, L, F, W, Y, D, S, E, M, T, C, P, H, R, I and K.

[0011] In certain embodiments, according to the use of the present invention, the non-R amino acid is selected from at least one of A, N, V, G, L, Q, F, W, Y, D, S, E, M, T, C, P, H and I.

[0012] The second aspect of the present invention provides the use of a combination of an engineered Cas9 protein and at least one guide RNA in the preparation of a drug for treating or ameliorating viral infection, wherein the engineered Cas9 protein is the engineered Cas9 protein described in the present invention, and the guide RNA is used to guide the engineered Cas9 protein to the target gene.

[0013] In certain embodiments, according to the use of the present invention, the virus comprises hepatitis B virus.

[0014] In certain embodiments, according to the use of the present invention, the treatment or improvement comprises at least one of the following:

[0015] (1) Reducing the amount or expression of HBc protein;

[0016] (2) Inhibit HBV replication.

[0017] The third aspect of the present invention provides a method for preparing an engineered Cas9 protein or a gene editing tool comprising the same, which comprises the step of introducing at least one amino acid mutation in the pentapeptide motif at positions 669-673 and / or 892-896 of the wild-type Cas9 protein.

[0018] In certain embodiments, according to the preparation method of the present invention, the method further comprises the step of constructing a complex of the engineered Cas9 protein and gRNA.

[0019] The fourth aspect of the present invention provides the use of an engineered Cas9 protein or a gene editing tool comprising the same in combination with other drugs in the preparation of a combined drug for administration, wherein the engineered Cas9 protein is the engineered Cas9 protein described in the present invention.

[0020] In certain embodiments, according to the use of the present invention, the gene editing tool is a CRIPR / Cas9 system.

[0021] The present invention discovered for the first time that Cas9 protein can be degraded by the autophagy-lysosomal pathway mediated by molecular chaperones, and amino acid sequence analysis revealed that Cas9 protein contains a "KFERQ"-like pentapeptide motif that can bind to the molecular chaperone heat shock homologous protein 70 (HSC70). On this basis, the present invention respectively constructed Cas9 proteins with mutations in the "KFERQ"-like pentapeptide motif, and then obtained a highly stable Cas9 protein (HSCas9) with combined mutations. In addition, the present invention further discovered that the highly stable mutant Cas9 protein can significantly enhance the inhibitory ability of the CRIPR / Cas9 system on the replication of hepatitis B virus (HBV). BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1The figure shows the detection and analysis of the degradation of Cas9 protein by the autophagy-lysosomal pathway mediated by molecular chaperones.

[0023] Figure 2 The construction and screening of highly stable Cas9 proteins are shown.

[0024] Figure 3 The inhibitory effect of HSCas9 on HBV replication is shown.

[0025] Figure 4 The effect of HSCas9 protein on the inhibition of HBV replication by CRISPR / Cas9 system in HBV-infected HepG2-NTCP cells is shown.

[0026] Figure 5 The effect of HSCas9 protein on the inhibition of HBV replication by CRISPR / Cas9 system in mice is shown. DETAILED DESCRIPTION

[0027] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0028] It should be understood that the terms described in the present invention are only for describing special embodiments and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that the upper and lower limits of the scope and each intermediate value therebetween are specifically disclosed. Each smaller range between the intermediate value in any stated value or stated range and any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0029] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as commonly understood by those skilled in the art to which the invention belongs. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0030] Engineered Cas9 protein

[0031] In one aspect of the present invention, an engineered Cas9 protein with improved stability is provided (sometimes also referred to herein as a "Cas9 mutant protein" or a "mutated Cas9 protein"). The term "improved stability" refers to the property that the conformation of the Cas9 protein can be kept stable without degradation under degradation conditions, particularly in the presence of the molecular chaperone heat shock homologous protein 70 (HSC70). Preferably, the amount of Cas9 mutant protein degraded is less than 20%, preferably less than 10%, further preferably less than 5%, further preferably less than 1%, or even substantially no degradation occurs, compared to the amount of Cas9 protein or wild-type Cas9 protein present before mutation.

[0032] In the present invention, amino acid residues can be represented by single letters or three letters, for example: alanine (Ala, A), valine (Val, V), glycine (Gly, G), leucine (Leu, L), glutamine (Gln, Q), phenylalanine (Phe, F), tryptophan (Trp, W), tyrosine (Tyr, Y), aspartic acid (Asp, D), asparagine (Asn, N), glutamic acid (Glu, E), lysine (Lys, K), methionine (Met, M), serine (Ser, S), threonine (Thr, T), cysteine ​​(Cys, C), proline (Pro, P), isoleucine (Ile, I), histidine (His, H), arginine (Arg, R).

[0033] In a preferred embodiment, the Cas9 mutant protein of the present invention has at least one (e.g., any 2 or more than 2) amino acid mutation in the pentapeptide motif at positions 669-673 and / or 892-896 compared to the amino acid sequence of the wild-type Cas9 protein, wherein the pentapeptide motif at positions 669-673 and / or 892-896 is a molecular chaperone heat shock homologous protein 70 binding domain. Further preferably, the mutation includes at least one of a non-K amino acid at position 672, a non-Q amino acid at position 673, a non-Q amino acid at position 892, and a non-R amino acid at position 893.

[0034] In a preferred embodiment, non-K amino acids include but are not limited to at least one of the following: A, N, V, G, L, Q, F, W, Y, D, S, E, M, T, C, P, H and I, preferably amino acids carrying a positive charge such as A or H, and also preferably A.

[0035] In a preferred embodiment, non-Q amino acids include, but are not limited to, at least one of the following: A, N, V, G, L, F, W, Y, D, S, E, M, T, C, P, H, R, I and K, preferably amino acids carrying a positive charge such as A, R, H or K, and also preferably A.

[0036] In a preferred embodiment, non-R amino acids include but are not limited to at least one of the following: A, N, V, G, L, Q, F, W, Y, D, S, E, M, T, C, P, H and I, preferably amino acids carrying a positive charge such as A or H, and A is also preferred.

[0037] In a most preferred embodiment, the mutation includes at least one of K672A, Q673A, Q892A, and R893A.

[0038] The term "AxxxB" means that the amino acid A at position xxx is changed to amino acid B. Unless otherwise specified, the amino acid A at position xxx from the N-terminus is changed to amino acid B. For example, K672A means that K at position 672 is mutated to A. When multiple amino acid sites are mutated at the same time, K672A-Q673A or K672A / Q673A and the like can be used to express them. For example, K672A / Q673A means that K at position 672 is mutated to A and Q at position 673 is mutated to A at the same time.

[0039] In addition, fusion proteins comprising Cas9 mutant proteins are within the scope of protection of the present invention, for example, fusion proteins may contain additional proteins or polypeptides, detectable markers, tags or any combination thereof. Tags include but are not limited to HA tags, FLAG tags, SnoopTag, BCCP, green fluorescent protein tags, etc. Any other components suitable for detection, separation, expression, and transport can form fusion proteins with the Cas9 mutant proteins of the present invention. In addition, those skilled in the art will understand these various tag fusion technologies, as well as how to prepare and use fusion proteins containing them.

[0040] The Cas9 mutant protein of the present invention, its derivative or fusion protein comprising the same is not limited by its preparation method. For example, it can be prepared by genetic engineering method (recombinant technology) or by chemical synthesis method.

[0041] Based on this, the present invention also provides a gene editing tool, which is an engineered non-naturally occurring vector system, or a CRISPRCas9 system, which includes an engineered Cas9 protein or a nucleic acid molecule encoding the Cas mutant protein and a nucleic acid molecule encoding one or more guide RNAs (also called guide RNAs).

[0042] In certain embodiments, the nucleic acid sequence encoding the Cas9 mutant protein and the nucleic acid encoding one or more guide RNAs do not co-exist naturally. In certain embodiments, the nucleic acid molecule encoding the Cas9 mutant protein and the nucleic acid molecule encoding one or more guide RNAs are artificially synthesized.

[0043] Those skilled in the art will appreciate that the one or more guide RNAs can target one or more target sequences (genes of interest, genes of interest, or target genes) in a cell. The guide RNA is used to guide the Cas9 mutant protein to modify, edit, or cut the target sequence after reaching the target sequence position, thereby changing or modifying the expression of the one or more gene products. The cells described herein include one or more derived from animals, plants, or microbial cells.

[0044] In certain embodiments, the Cas9 mutant protein directs cleavage of one or both strands at the location of the target sequence.

[0045] In a preferred embodiment, the engineered CRISPR system of the present invention comprises the above-mentioned engineered Cas9 protein and one or more guide RNAs, wherein the guide RNA includes a discontinuous repeat sequence (Direct repeat, DR) and a spacer sequence inserted therein capable of hybridizing with a target nucleic acid, and the Cas variant protein is capable of binding to the guide RNA and targeting a target nucleic acid sequence complementary to the spacer sequence.

[0046] Preparation method

[0047] In one aspect of the present invention, there is provided a method for preparing an engineered Cas9 protein or a gene editing tool comprising the same, the method comprising introducing a mutation of at least one amino acid in a pentapeptide motif at positions 669-673 and / or 892-896 of a wild-type Cas9 protein. Those skilled in the art are familiar with how to introduce the desired mutation to obtain a Cas9 mutant protein, for example, it can be prepared by a direct chemical synthesis method, or it can be prepared by a genetic engineering method. A non-limiting example is, for example, the production of a Cas9 mutant protein by site-directed mutagenesis based on PCR. In certain embodiments, the step of introducing a mutation includes dividing the DNA sequence design of the Cas9 protein into two parts with the site of the mutation as the center, designing two pairs of primers to amplify the two parts of the DNA sequence respectively, and introducing the sequence to be mutated on the primer at the same time, and finally loading the two fragments onto a plasmid vector by cloning. The combination of mutations is constructed by splitting the DNA of the Cas9 protein into multiple segments and using PCR and cloning.

[0048] In certain embodiments, the method of the present invention further includes the step of constructing a complex of an engineered Cas9 protein and a gRNA, for example, a polynucleotide and / or a gRNA vector comprising a Cas9 mutant protein encoding can be constructed. The vector should be understood as a broad term, which refers to an expression vector, a delivery vector or a vector system. The vector system for delivering genes in animals includes viral vectors (such as retroviruses, adeno-associated viruses and integrating phage viruses) and non-viral vectors (such as transposons and nanoparticles). The vector generally contains one or more expression cassettes (comprising one or more expression control sequences), wherein the expression control sequence is a DNA sequence that controls and regulates the transcription and / or translation of another DNA sequence or mRNA, respectively.

[0049] Many different types of vectors are known. For example, phage, plasmid and viral vectors (e.g., retroviral vectors, lentiviral vectors, adenoviral vectors, adeno-associated vectors and herpes simplex vectors). The vector also includes a regulatory element operably linked to the nucleic acid molecule or polynucleotide. In certain embodiments, the regulatory element is selected from one or more of the following: an enhancer, a transposon, a promoter, a terminator, a leader sequence, a polyadenylation sequence, a marker gene.

[0050] The vector can be introduced into the desired cell by many conventional techniques. For example, the vector can be directly introduced into the cell using methods such as electroporation and microinjection, or the vector can be directly introduced into the cell using gene gun methods such as DNA particle bombardment.

[0051] In a preferred embodiment, the vector of the present invention comprises a combination of one or more vectors, the one or more vectors comprising:

[0052] (1) a first regulatory element, which is operably linked to a nucleotide sequence encoding a gRNA;

[0053] (2) a second regulatory element, which is operably linked to a polynucleotide sequence encoding the Cas mutant protein;

[0054] Components (1) and (2) are located on the same or different carriers of the combination.

[0055] The first and second regulatory elements include a promoter (eg, a constitutive promoter or an inducible promoter), an enhancer, an internal ribosome entry site (IRES), and other expression control elements (eg, transcription termination signals, such as polyadenylation signals and poly-U sequences).

[0056] application

[0057] In one aspect of the present invention, there is provided the use of the engineered Cas9 protein of the present invention or a gene editing tool (system) comprising the same in the preparation of a drug.

[0058] Those skilled in the art will understand that, depending on the target gene targeted by the gRNA, the engineered Cas9 protein of the present invention or the gene editing tool (system) comprising it can potentially be used to treat various types of diseases. In a preferred embodiment, the engineered Cas9 protein of the present invention or the gene editing tool (system) comprising it can be used to prepare a drug for treating or improving viral infection in a subject in need, wherein a therapeutically effective amount of the drug is administered to a subject in need to achieve the treatment or improvement. In a preferred embodiment, the engineered Cas9 protein of the present invention or the gene editing tool (system) comprising it can be used to prepare a drug for treating or improving hepatitis B virus infection in a subject in need.

[0059] In the present invention, the gRNA sequence targeting the genomic DNA of hepatitis B virus is not particularly limited. Those skilled in the art can design and synthesize it according to the reported HBV genomic sequence or the published genomic data, and can also use the gRNA sequence targeting the HBV genomic DNA known in the art, such as the gRNA sequence disclosed in Chinese patent applications CN104711257A, CN109528653A, and CN116355858A, which are incorporated herein by reference in their entirety. As a non-limiting example, the gRNA sequence of the present invention has the sequence shown in SEQ ID No.1 (GGTTGCGTCAGCAAACACT) and / or SEQ ID No.2 (CAAGCCTCCAAGCTGTGCCT).

[0060] The present invention also provides the use of the Cas9 protein described in the present invention or the gene editing tool (system) comprising the same in combination with other drugs in the preparation of a jointly administered drug, wherein the drug is used for viral infection. It is understandable that the other drugs administered in combination may or may not be drugs for viral infection, such as hepatitis B virus infection. Examples of other drugs include but are not limited to: entecavir, telbivudine, interferon, adefovir dipivoxil and lamivudine, etc.

[0061] Example 1

[0062] The following shows that Cas9 protein can be degraded through the autophagy-lysosomal pathway mediated by molecular chaperones.

[0063] In order to explore the degradation mechanism of Cas9 protein in cells, the amino acid sequence of Cas9 protein was first analyzed. The results showed that the amino acid sequence of Cas9 protein contained four "KFERQ"-like pentapeptide motifs that may bind to HSC70 protein, namely 669QUR 673 , 793 QILKE 797 , 892 QRKD 896 and 965 RdQ 969 ( Figure 1 A).

[0064] Then, protein co-immunoprecipitation (Co-IP) experiments confirmed that HSC70 and Cas9 proteins could bind to each other in cells ( Figure 1 B and 1C). At the same time, cell immunofluorescence experiments combined with confocal microscopy confirmed that HSC70 and Cas9 proteins can co-localize in cells ( Figure 1 D).

[0065] Further studies found that knocking down the expression of the HSC70 gene in HuH7 cells significantly increased the level of Cas9 protein in the cells ( Figure 1 E), while the level of Cas9 protein in cells was significantly reduced after overexpression of HSC70 ( Figure 1 F). Similarly, consistent results were obtained in HeLa-gHPV1 / Cas9 stably transfected cells ( Figure 1 G and 1H). The above results suggest that Cas9 protein may be degraded through the autophagy-lysosome pathway mediated by molecular chaperones.

[0066] To further confirm that Cas9 protein can be degraded by the chaperone-mediated autophagy-lysosome pathway, HeLa-gHPV1 / Cas9 stably transfected cells were treated with commercial chaperone-mediated autophagy-lysosome pathway agonist AR7. Since AR7 can activate the chaperone-mediated autophagy-lysosome pathway by specifically activating the transcriptional activity of the lysosomal associated protein 2A (LAMP2A) gene, the activation degree of AR7 was reflected by detecting the mRNA level of the LAMP2A gene in the cell.

[0067] The results showed that AR7 treatment activated the chaperone-mediated autophagy-lysosome pathway and significantly reduced the level of Cas9 protein ( Figure 1 H and 1I). In addition, since the target protein degraded by the molecular chaperone-mediated autophagy-lysosomal pathway needs to rely on LAMP2A when passing through the lysosomal membrane, the distribution of Cas9 and LAMP2A proteins in cells was further detected by confocal microscopy. The results showed that Cas9 and LAMP2A proteins can be co-localized in cells ( Figure 1 J). The above results indicate that Cas9 protein can be degraded via the autophagy-lysosome pathway mediated by molecular chaperones.

[0068] Figure 1 (A) The "KFERQ"-like pentapeptide motif in Cas9 protein that potentially binds to HSC70 protein is shown. Co-IP experiments were performed using HSC70 antibody (B) and Flag antibody, the tag protein of Cas9-Flag fusion protein (C), and the mutual binding of Cas9 protein and HSC70 protein in HeLa-gHPV1 / Cas9 cells was analyzed. (D) Cell immunofluorescence experiment combined with confocal microscopy observed the distribution of Cas9 protein (green fluorescence) and HSC70 protein (red fluorescence) in HeLa-gHPV1 / Cas9 cells. (E) After co-transfection of PX458 plasmid and HSC70 siRNA or control siRNA (siNC) in HuH7 cells, the levels of HSC70 and Cas9 proteins in cells were detected by Western Blot, and α-tubulin was used as the intracellular reference protein. (F) PX458 plasmid and PCDH-HSC70-HA plasmid or vector control plasmid were co-transfected in HuH7 cells, and the levels of HSC70-HA and Cas9 proteins in cells were detected by Western Blot, with α-tubulin as the internal reference protein. (G) After HSC70 siRNA or control siRNA (siNC) was transfected in HeLa-gHPV1 / Cas9 cells, the levels of HSC70 and Cas9 proteins in cells were detected by Western Blot, with α-tubulin as the internal reference protein. (H) After PCDH-HSC70-HA plasmid or vector control plasmid was transfected in HeLa-gHPV1 / Cas9 cells, the levels of HSC70-HA and Cas9 proteins in cells were detected by Western Blot, with α-tubulin as the internal reference protein. (I) After HeLa-gHPV1 / Cas9 cells were treated with 20μmol / L AR7 for 24 hours, the level of intracellular Cas9 protein was detected by Western Blot, and α-tubulin was used as the intracellular reference protein. (J) The mRNA level of the LAMP2A gene in cells after the above AR7 drug treatment was detected by RT-qPCR. (K) Cell immunofluorescence experiment detected the distribution of Cas9 protein (green fluorescence) and LAMP2A protein (red fluorescence) in HeLa-gHPV1 / Cas9 cells. *** indicates P < 0.001, two-sided t test.

[0069] Example 2

[0070] This example demonstrates the construction and screening of highly stable Cas9 proteins.

[0071] In order to construct and screen highly stable Cas9 proteins, the four KFERQ-like motifs of Cas9 proteins were first mutated separately. Figure 2 As shown in A, 669 QUR 673 , 793 QILKE 797 , 892 QRKD 896 and 965 RdQ 969 Mutated to 669 IRDAA 673 (Cas9M1), 793 AALKE 797 (Cas9M2), 892 AAKFD 896 (Cas9M3) and 965 RKD 969 (Cas9M4). Then, the expression plasmids of the Cas9 protein mutants and the wild-type Cas9 protein expression plasmids were transfected into HeLa cells, and the cell pellets were collected 48 hours after transfection and the total protein was extracted. The results showed that compared with the wild-type Cas9 protein, 669 QUR 673 and 892 QRKD 896 After the two pentapeptide motifs were mutated, the level of Cas9 protein in the cell was significantly higher than that of wild-type Cas9 protein ( Figure 2 B).

[0072] Subsequently, the two motifs were mutated together. The results showed that the level of Cas9 protein with two motifs mutated together in HeLa and HuH7 cells was significantly higher than that of Cas9 protein with single site mutation ( Figure 2 C), and the stability of the Cas9 protein with two combined mutations in HeLa and HuH7 cells was significantly higher than that of the wild-type Cas9 protein ( Figure 2 D-2G). It can be seen that 669 QUR 673 and 892 QRKD 896The mutation of the two pentapeptide motifs can increase the intracellular level of Cas9 protein by enhancing its stability. Therefore, the Cas9 protein with two combined mutations is called highly stable Cas9 (HSCas9) protein. Then, the PX458-HSCas9 plasmid and the HSC70 expression plasmid PCDH-HSC70-HA were co-transfected into HeLa and HuH7 cells. Three days after transfection, the effect of HSC70 on the HSCas9 protein level was detected by Western Blot experiment. The results showed that HSC70 had no significant effect on the level of HSCas9 protein ( Figure 2 H). This result indicates that HSC70 cannot promote 669 QUR 673 and 892 QRKD 896 HSCas9 proteins with two pentapeptide motif mutations were degraded via the chaperone-mediated autophagy-lysosomal pathway.

[0073] Furthermore, the binding ability of Cas9 and HSCas9 to HSC70 was compared by Co-IP experiments. The results showed that the binding of HSCas9 protein to HSC70 protein was significantly weakened compared with that of Cas9 protein ( Figure 2 I). The above results show that 669 QUR 673 and 892 QRKD 896 The two pentapeptide motifs mainly mediate the binding of HSC70 to Cas9 protein, which in turn causes the degradation of Cas9 protein via the molecular chaperone-mediated autophagy-lysosome pathway. 669 QUR 673 and 892 QRKD 896 HSCas9 proteins with two pentapeptide motif mutations can increase the stability of the protein by antagonizing molecular chaperone-mediated autophagy-lysosomal degradation.

[0074] Figure 2(A) Schematic diagram of the mutation site of the KFERQ-like motif of Cas9 protein. (B) PX458 plasmid and expression plasmids with different KFERQ-like motif site mutations (Cas9M1, Cas9M2, Cas9M3 and Cas9M4) were transfected into HeLa cell lines, and cell pellets were collected 48 hours after transfection. The levels of different Cas9 proteins were detected by Western Blot experiments, and α-tubulin was used as the internal reference protein of the cells. Based on the T2A sequence between the coding sequence of Cas9 and EGFP protein in the PX458 plasmid, the EGFP protein can be used to indicate the transfection efficiency of different plasmids. (C) HeLa and HuH7 cell lines were transfected with PX458 plasmid and expression plasmids with different KFERQ-like motif site mutations (Cas9M1, Cas9M3 and HSCas9), and cell pellets were collected 48 hours after transfection. The levels of different Cas9 proteins were detected by Western Blot experiment. α-tubulin was used as the internal reference protein of the cells, and EGFP was used to indicate the transfection efficiency of the plasmids in each group of cells. (D) HeLa cells were transfected with PX458 plasmid and PX458-HSCas9 plasmid, and 48 hours after transfection, cycloheximide (CHX) was added for treatment for 0, 3, 6, 9, 12 and 15 hours, respectively. After collecting cell pellets, the levels of Cas9 and HSCas9 proteins were detected by Western Blot experiment. α-tubulin was used as the internal reference protein of the cells. (E) The stability of Cas9 and HSCas9 proteins was compared by gray value analysis of the protein bands in (D). (F) PX458 plasmid and PX458-HSCas9 plasmid were transfected into HuH7 cells, and CHX was added 48 hours after transfection for 0, 3, 6, 9, 12 and 15 hours, respectively. After collecting the cell pellet, the levels of Cas9 and HSCas9 proteins were detected by Western Blot experiment, and α-tubulin was used as the internal reference protein of the cells. (G) The stability of Cas9 and HSCas9 proteins was compared by gray value analysis of the protein bands in (F). (H) PX458-HSCas9 plasmid and HSC70 expression plasmid PCDH-HSC70-HA were co-transfected into Hela and HuH7 cells, and the level of HSCas9 protein was detected by Western Blot experiment 3 days after transfection, and α-tubulin was used as the internal reference protein of the cells. (I) HeLa cells were transfected with PX458 plasmid and PX458-HSCas9 plasmid respectively. After 48 hours of transfection, the cell pellet was collected and Co-IP experiment was performed with HSC70 antibody to compare and analyze the binding ability between HSCas9 and HSC70 protein. α-tubulin was used as the internal reference protein of the cell, and EGFP was used to indicate the transfection efficiency of the plasmid in each group of cells. *** indicates P < 0.001, two-sided t test.

[0075] Example 3

[0076] The following shows that HSCas9 can enhance the inhibitory effect of the CRISPR / Cas9 system on HBV replication in HuH7 cells.

[0077] In order to explore whether HSCas9 can enhance the inhibitory ability of CRISPR / Cas9 system on HBV replication, we firstly expressed tRNA (tRNA carrying glycine) in the Gly ) and gRNA tandem expression frame to construct an expression plasmid (pU6-tRNA Gly -gHBV1-tRNA Gly -gHBV2-tRNA Gly , abbreviated as pU6-t-g1-t-g2-t)( Figure 3 A). Then, pBB4.5-HBV1.3 plasmid, pU6-t-g1-t-g2-t plasmid and PX458 / PX458-HSCas9 plasmid were co-transfected into HuH7 cells, and the cell culture supernatant and cell pellet were collected 4 days after transfection. The results showed that compared with Cas9 protein, the ability of HSCas9 protein-mediated CRISPR / Cas9 system to reduce HBsAg and HBeAg levels in cell culture supernatant was significantly enhanced ( Figure 3 B and 3C), and the ability of the CRISPR / Cas9 system mediated by HSCas9 protein to reduce the level of HBc protein in cells was also significantly enhanced ( Figure 3 D and 3E). At the same time, HSCas9 can significantly enhance the cleavage and destruction of the HBV genome by the CRISPR / Cas9 system ( Figure 3 F-3I). In addition, CCK-8 experiments confirmed that the HSCas9-mediated CRISPR / Cas9 system had no significant effect on cell viability ( Figure 3 J). The above results indicate that HSCas9 can specifically enhance the inhibitory effect of CRISPR / Cas9 system on HBV replication in HuH7 cell line.

[0078] Figure 3(A) is a schematic diagram of the pU6-t-g1-t-g2-t plasmid. The pBB4.5-HBV1.3 plasmid, pU6-t-g1-t-g2-t plasmid, and PX458 or PX458-HSCas9 plasmid were transfected simultaneously in the HuH7 cell line, and the cell supernatant and cell pellet were collected 4 days after transfection. Then, the levels of (B) HBsAg and (C) HBeAg in the cell culture supernatant were detected by ELISA, and the levels of intracellular Cas9 and HBc proteins were detected by Western Blot (D). EGFP was used to indicate the transfection efficiency of the plasmid in each group of cells, and α-tubulin was used as the internal reference protein of the cell. (E) The gray value analysis of the HBc protein band in (D) was performed to compare and analyze the levels of HBc protein in different groups. (F) HuH7 cell lines were transfected with pBB4.5-HBV1.3 plasmid, pU6-t-g1-t-g2-t plasmid and PX458 or PX458-HSCas9 plasmid at the same time. Cell pellets were collected 4 days after transfection and DNA was extracted. PCR amplification was performed using HBV-specific primers on both sides of the dual gRNA, and the PCR products were detected by 1.5% agarose gel electrophoresis. The blue arrow indicates the complete HBV genome, and the red arrow indicates the truncated HBV genome formed after dual-site cutting by the CRISPR / Cas9 system mediated by the dual gRNA. (G) The grayscale value of the amplified complete HBV genome band (the long band indicated by the blue arrow) in Figure (F) was analyzed by ImageJ software, and the degree of HBV genome cutting damage in different groups was compared and analyzed. (H) Grayscale analysis of the complete (long band indicated by the blue arrow) and truncated HBV genome bands (short band indicated by the red arrow) amplified in (F) was performed using ImageJ software, and the HBV genome destruction efficiency was evaluated by calculating the percentage of truncated HBV genome in the total HBV genome (complete HBV genome + truncated genome). (I) The sequence of the truncated HBV genome (short band indicated by the red arrow) was analyzed by cloning sequencing. (J) Cell viability was detected by CCK-8 assay. ns indicates no statistical difference, *** indicates P < 0.001, two-sided t test.

[0079] Example 4

[0080] The following shows that HSCas9 does not increase off-target effects of the CRISPR / Cas9 system.

[0081] For the CRISPR / Cas9 system, off-target effects have always been a very important and concerning issue. Therefore, this example further explored whether HSCas9 would increase the off-target effects of the system while enhancing the inhibitory effect of the CRISPR / Cas9 system on HBV replication. First, the Cas-OFFinder prediction tool was used to predict the potential off-target sites of gHBV1 (5'-AGTGTTTGCTGACGCAACC-3') in the human genome sequence, and the three most likely off-target sites were selected for subsequent analysis and research (Table 1).

[0082] Table 1. The three sites with the highest probability of off-target effects of gHBV1 in the human genome

[0083]

[0084] Then, PX458-gHBV1 and PX458-gHBV1-HSCas9 plasmids were transfected into HuH7 cells, and cell pellets were collected and DNA was extracted 3 days after transfection. The three off-target sites were PCR amplified by high-fidelity enzymes, and the PCR products were deeply sequenced. The sequencing results were compared and analyzed by CRISPResso2 software. It was found that the off-target effects caused by the CRISPR / Cas9 system mediated by Cas9 / gHBV1 and HSCas9 / gHBV1 were both very low, and there was no significant difference in the off-target effects caused by the two (Table 2). This result further confirms that the highly stable HSCas9 can specifically enhance the inhibitory effect of the CRISPR / Cas9 system on HBV replication and has good application prospects.

[0085] Table 2. Comparative analysis of off-target effects of Cas9 / gHBV1 and HSCas9 / gHBV1-mediated CRISPR / Cas9 systems in the human genome

[0086]

[0087] Off-target efficiency: The off-target efficiency is the number of reads containing chimeras divided by the total number of reads.

[0088] Example 5

[0089] The following shows that HSCas9 can enhance the inhibitory effect of the CRISPR / Cas9 system on HBV replication in HBV-infected HepG2-NTCP cells.

[0090] To further confirm that HSCas9 can promote the CRISPR / Cas9 system to eliminate HBV infection, HepG2-NTCP-Cas9 and HepG2-NTCP-HSCas9 cells that can stably express Cas9 and HSCas9 proteins were first constructed. Figure 4 A). Then, it was confirmed that the level of HSCas9 protein in HepG2-NTCP-HSCas9 cells was significantly higher than that of Cas9 protein in HepG2-NTCP-Cas9 cells ( Figure 4 B), but there was no significant difference between the HSCas9 mRNA level in HepG2-NTCP-HSCas9 cells and the Cas9 mRNA level in HepG2-NTCP-Cas9 cells ( Figure 4 C). This result further confirmed that the stability of HSCas9 protein is higher than that of Cas9 protein.

[0091] Next, the pU6-t-g1-t-g2-t plasmid was transfected into the above two stable cells, and HBV infection (500 geq / cell) was performed 24 h after transfection. The replication level of HBV in the two stable cells was detected 5 days after infection ( Figure 4 D). The results showed that compared with Cas9, the ability of the HSCas9-mediated CRISPR / Cas9 system to reduce HBsAg and HBeAg levels in cell culture supernatants was significantly enhanced ( Figure 4 E and 4F), and HSCas9 can also significantly enhance the effect of CRISPR / Cas9 system on reducing intracellular HBc levels ( Figure 4 G and 4H). Further analysis revealed that HSCas9 can significantly promote the cleavage and destruction of HBV cccDNA by the CRISPR / Cas9 system ( Figure 4 I-4L). In addition, CCK8 experiments confirmed that the HSCas9-mediated CRISPR / Cas9 system had no significant effect on cell viability ( Figure 4 M). The above results indicate that HSCas9 can enhance the inhibitory effect on HBV replication by promoting the cleavage and destruction of HBV cccDNA by the CRISPR / Cas9 system, thereby promoting the clearance of HBV infection.

[0092] Figure 4(A) Flow chart of the construction of HepG2-NTCP-Cas9 and HepG2-NTCP-HSCas9 stably transfected cells. (B) Western Blot was used to detect the levels of Cas9 protein in HepG2-NTCP-Cas9 and HSCas9 protein in HepG2-NTCP-HSCas9 cells, with α-tubulin as the internal reference protein of the cells. (C) RT-qPCR was used to detect the levels of Cas9 mRNA in HepG2-NTCP-Cas9 and HSCas9 mRNA in HepG2-NTCP-HSCas9 cells. (D) Flow chart of HBV infection of HepG2-NTCP-Cas9 and HepG2-NTCP-HSCas9 stably transfected cells. Specifically, the pU6-t-g1-t-g2-t plasmid was transfected into HepG2-NTCP-Cas9 and HepG2-NTCP-HSCas9 stably transfected cells, and HBV virus infection (500geq / cell) was performed 24 hours after transfection. Cell culture supernatant and cell pellet were collected 5 days after HBV infection. Geq, genome equivalent, means "genome equivalent". The levels of (E) HBsAg and (F) HBeAg in the cell culture supernatant were detected by ELISA. (G) Western Blot was used to detect the levels of Cas9 and HBc proteins in cells, and α-tubulin was used as the internal reference protein of the cells. (H) The gray value analysis of the HBc protein band in Figure (G) was performed to compare and analyze the levels of HBc protein in different groups. (I) PCR amplification was performed using primers on both sides of the dual gRNA to detect the levels of intact HBV cccDNA and truncated HBV cccDNA formed by the two gHBVs-mediated CRISPR / Cas9 system, and PCR products were detected by 1.5% agarose gel electrophoresis. The blue arrow indicates the intact cccDNA, and the red arrow indicates the truncated cccDNA. (J) The grayscale value of the intact cccDNA band (the long band indicated by the blue arrow) amplified in (I) was analyzed by ImageJ software, and the degree of cccDNA cleavage and destruction in different groups was compared and analyzed. (K) The grayscale value of the intact (the long band indicated by the blue arrow) and truncated cccDNA band (the short band indicated by the red arrow) amplified in (I) was analyzed by ImageJ software, and the destruction efficiency of cccDNA was evaluated by calculating the percentage of truncated cccDNA in the total cccDNA (intact HBV genome + truncated genome). (L) The level of intact HBV cccDNA was detected by qPCR. (M) Cell viability was detected by CCK-8 assay. ns indicates no statistical difference, ** indicates p < 0.01, *** indicates p < 0.001, two-sided t test.

[0093] Example 6

[0094] The following shows that HSCas9 can enhance the inhibitory effect of the CRISPR / Cas9 system on HBV replication in mice.

[0095] The effect of HSCas9 on the inhibition of HBV replication by the CRISPR / Cas9 system in mice was further investigated using a hydrodynamic injection model. Figure 5 As shown in A, 24 5-week-old male C57BL / 6J mice were randomly divided into three groups, with 8 mice in each group. In the first group, 2 ml of PBS containing pBB4.5-HBV1.3 (16 μg), PX458 (4 μg) and pU6 (12 μg) plasmids was injected into the tail vein of the mice within 5 seconds; in the second group, 2 ml of PBS containing pBB4.5-HBV1.3 (16 μg), PX458 (4 μg) and pU6-tRNA was injected into the tail vein of the mice within 5 seconds. Gly -gHBV1-tRNA Gly -gHBV2-tRNA Gly (pU6-t-g1-t-g2-t) (12μg) plasmid in PBS was injected into the tail vein of mice within 5 seconds; in the third group, 2ml of PBS containing pBB4.5-HBV1.3 (16μg), PX458-HSCas9 (4μg) and pU6-t-g1-t-g2-t (12μg) plasmid was injected into the tail vein of mice within 5 seconds. Two mice were randomly killed 3 days after the injection, and the liver tissues were obtained and frozen in liquid nitrogen. Blood was collected through the inner canthus of the eye 5 and 7 days after the injection, and all the remaining mice were killed on the 7th day, and the liver tissues were obtained and frozen in liquid nitrogen. The results showed that HSCas9 can significantly promote the CRISPR / Cas9 system to reduce the levels of HBsAg in mouse serum and HBc in liver tissue ( Figure 5 B and 5C), and can significantly enhance the cleavage and destruction of the HBV genome by the CRISPR / Cas9 system ( Figure 5 D). The above results indicate that HSCas9 can enhance the inhibitory effect of CRISPR / Cas9 system on HBV replication in mice, thereby promoting the clearance of HBV infection.

[0096] Figure 5(A) Schematic diagram of the process of hydrodynamic tail vein injection of mice. (B) HBsAg levels in mouse serum were detected by ELISA 5 and 7 days after injection. (C) Western Blot was used to detect HBc protein levels in the liver of mice 7 days after injection, in which α-tubulin was used as an internal reference protein. (D) Genomic DNA from the liver tissue of mice 7 days after injection was extracted and PCR amplified using specific primers on both sides of the dual gRNA. Subsequently, the complete HBV genome (indicated by the blue arrow) and the truncated HBV genome (indicated by the red arrow) were detected by 1.5% agarose gel electrophoresis analysis. * indicates P < 0.05, *** indicates P < 0.001, two-sided t test.

[0097] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit them; although the present invention has been described in detail with reference to the above embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the above embodiments, or replace some of the technical features therein by equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. Use of engineered Cas9 protein in the preparation of a drug for treating or ameliorating hepatitis B virus infection, characterized in that: The engineered Cas9 protein contains an amino acid mutation in which the pentapeptide motif IRDKQ in the wild-type Cas9 protein sequence is mutated to IRDAA and / or the pentapeptide motif QRKFD is mutated to AAKFD, and the wild-type Cas9 protein is expressed by the PX458 plasmid.

2. Use of a combination of an engineered Cas9 protein and at least one guide RNA in the preparation of a drug for treating or ameliorating hepatitis B virus infection, characterized in that: The engineered Cas9 protein is the engineered Cas9 protein in claim 1, and the guide RNA is used to guide the Cas9 protein to the target gene.

3. The use according to claim 1 or 2, characterized in that: The treatment or improvement includes at least one of the following: (1) reducing the amount or expression of HBc protein; (2) Inhibit HBV replication.

4. A method for preparing an engineered Cas9 protein or a gene editing tool comprising the same, characterized in that: The method comprises the step of introducing at least one amino acid mutation into the IRDKQ and / or QRKFD pentapeptide motif of the wild-type Cas9 protein, wherein the mutation is an amino acid mutation of IRDKQ to IRDAA and / or QRKFD to AAKFD, and the wild-type Cas9 protein is expressed by the PX458 plasmid.

5. The method for preparing the engineered Cas9 protein or a gene editing tool comprising the engineered Cas9 protein according to claim 4, characterized in that: Further comprising the step of constructing a complex of the engineered Cas9 protein and gRNA.

6. The method for preparing the engineered Cas9 protein or a gene editing tool comprising the engineered Cas9 protein according to claim 4, characterized in that: The gene editing tool is the CRISPR / Cas9 system.

7. Use of engineered Cas9 protein or gene editing tools containing the same in combination with other drugs in the preparation of a drug for combined administration to treat or improve hepatitis B virus infection, characterized in that: The engineered Cas9 protein is the engineered Cas9 protein in claim 1.

8. The use according to claim 7, characterized in that: The gene editing tool is the CRISPR / Cas9 system.

Images