Primer set, kit and detection device for detecting hemophilia A

Abstract

The present application discloses a primer set, a kit and a detection device for detecting hemophilia A, wherein the primer set comprises: a first primer, the sequence of which is shown in SEQ ID NO.1; a second primer, the sequence of which is shown in SEQ ID NO.2; a third primer, the sequence of which is shown in SEQ ID NO.3; a fourth primer, the sequence of which is shown in SEQ ID NO.4; a fifth primer, the sequence of which is shown in SEQ ID NO.5; a sixth primer, the sequence of which is shown in SEQ ID NO.6; and a seventh primer, the sequence of which is shown in SEQ ID NO.7; wherein the first primer, the second primer and the third primer are used for the first amplification, and the fourth primer, the fifth primer, the sixth primer and the seventh primer are used for the second amplification of the product of the first amplification, and the second amplification comprises a melting curve analysis. The primer set and the kit of the present application are simple and fast to operate, and the results are easy to interpret, and are suitable for large-scale detection or screening of hemophilia A.

Description

Technical Field

[0001] The present application relates to the field of biotechnology, and in particular to a primer set, a kit and a detection device for detecting hemophilia A. Background Art

[0002] Chromosome structural abnormality, also known as chromosome rearrangement, refers to the fact that under the influence of multiple factors such as physics, chemistry, biology and genetics, chromosomes break and the broken fragments do not reconnect in situ, but move to other fragments or lose them, that is, abnormal reconnection, causing changes in the number, position or order of genes. Chromosome inversion is a common chromosome structural rearrangement, which means that after a chromosome breaks twice, the fragments between the two breakpoints are reversed 180° and then reconnected. Inversion may lead to abnormal gene function. Hemophilia A (HA) is a hereditary bleeding disease caused by chromosome inversion, which is X-linked recessive inheritance. Clinically, it is mainly manifested as abnormalities in the quality or quantity of coagulation factor VIII (F8), characterized by spontaneous or minor bleeding in joints, muscles, internal organs and deep tissues that is difficult to stop, and often onset in childhood. In the male population, the incidence of HA is about 1 / 5000, while female hemophilia patients are extremely rare. HA originates from abnormalities in the F8 gene, and 45% to 50% of severe HA types are caused by inversion of intron 22 of the F8 gene (Inv22). F8-Inv22 is produced by recombination between three highly homologous copies (Int22h): one located in intron 22 of the F8 gene (Int22-h1), and two exogenous copies located outside the gene near the telomere (Int22-h2 and Int22-h3). Intron 22 inversion mainly includes two types: homologous recombination between the Int22-h1 region and the Int22-h2 region (type II) or homologous recombination between the Int22-h1 region and the Int22-h3 region (type I).

[0003] At present, the main detection methods for the inversion of intron 22 of the F8 gene include Southern blot hybridization, long distance PCR (LD-PCR), inverse shifting-PCR (IS-PCR), etc. The Southern blot hybridization method requires a large amount of DNA, dangerous radioactive chemicals, cumbersome experimental process, and high reagent costs. In 1998, Liu et al. designed LD-PCR to detect the inversion of intron 22 of the F8 gene. Four primers P, Q, A, and B were designed to amplify in the same reaction tube. The two primers P and Q were located at 1212bp and 1224bp of the Int22-h1 flanking sequence in the FVIII gene, respectively, and the two primers A and B were located at 162bp and 118bp of the Int22-h2&3 flanking sequence, respectively. The normal genotype product size is a 12kb PQ fragment and a 10kb AB fragment. The patient's genotype product size is an 11kb PB+AQ fragment and a 10kb AB fragment. Female carriers produce the above three fragments of 12kb, 11kb and 10kb. The amplification phase of this method takes 8-10 hours, and the amplification product needs to be analyzed by agarose gel electrophoresis to judge the results of inversion of intron 22. Aerosol contamination is easily caused during gel electrophoresis, which in turn affects the accuracy of laboratory sample detection. It generally takes up to 5-6 hours of electrophoresis time, and 11kb and 12kb are not easy to distinguish during agarose gel electrophoresis analysis. Therefore, this method has the problems of long time consumption, easy contamination, and difficult results to interpret, and is not suitable for large-scale screening. IS-PCR is based on the inverse PCR technology to detect restriction enzyme fragments, but this method requires the use of BclI restriction endonuclease to cut genomic DNA, and DNA ligase to connect the enzyme products into a ring, and then use four primers 1U, 2U, 3U, ID to perform a standard multiplex inverse PCR reaction, and finally analyze the amplified products by gel electrophoresis. Therefore, this method has the problems of cumbersome and time-consuming detection process, high cost, and easy to cause the risk of aerosol contamination, and is not suitable for large-scale screening.

[0004] Therefore, it is necessary to develop a simple, rapid, and accurate detection system suitable for screening the F8 gene Inv22 mutation in hemophilia A in the general population. This is of great significance for avoiding the birth of fetuses with severe hemophilia and reducing the incidence of hemophilia A. Summary of the invention

[0005] The purpose of the present application is to provide a primer set, a kit and a detection device for detecting hemophilia A.

[0006] This application adopts the following technical solutions:

[0007] The first aspect of the present application discloses a primer set for detecting hemophilia A, the primer set comprising: a first primer, whose sequence is shown in SEQ ID NO.1; a second primer, whose sequence is shown in SEQ ID NO.2; a third primer, whose sequence is shown in SEQ ID NO.3; a fourth primer, whose sequence is shown in SEQ ID NO.4; a fifth primer, whose sequence is shown in SEQ ID NO.5; a sixth primer, whose sequence is shown in SEQID NO.6; and a seventh primer, whose sequence is shown in SEQ ID NO.7; wherein the first primer, the second primer and the third primer are used for a first amplification, the fourth primer, the fifth primer, the sixth primer and the seventh primer are used for a second amplification of the product of the first amplification, and the second amplification comprises a melting curve analysis. It should be noted that the primer set of the present application can specifically detect F8 Inv22 patients in hemophilia A, and detects through the first amplification and the second amplification, and interprets the test results through the melting curve, without the need for enzyme cleavage and cyclization steps, and without the need for gel electrophoresis, which can effectively avoid the risk of aerosol contamination and solve the problem of difficulty in distinguishing bands of similar size during gel electrophoresis. In summary, the primer set of the present application is used for F8 Inv22 detection, which is simple and convenient to operate, has low detection cost, and is easy to interpret the results, and is suitable for large-scale detection or screening.

[0008] The second aspect of the present application discloses a detection device for hemophilia A, comprising a first amplification module, a melting curve analysis module and a judgment module; wherein: the first amplification module comprises using a first primer, a second primer and a third primer to perform a first amplification; the melting curve analysis module comprises using a fourth primer, a fifth primer, a sixth primer and a seventh primer to perform a second amplification and a melting curve analysis on the product of the first amplification; the judgment module comprises judging the inversion of intron 22 of the F8 gene based on the Tm value of the melting curve; wherein the sequence of the first primer is shown in SEQ ID NO.1, the sequence of the second primer is shown in SEQ ID NO.2, the sequence of the third primer is shown in SEQ ID NO.3, the sequence of the fourth primer is shown in SEQ ID NO.4, the sequence of the fifth primer is shown in SEQ ID NO.5, the sequence of the sixth primer is shown in SEQ ID NO.6, and the sequence of the seventh primer is shown in SEQ ID NO.7.

[0009] In one implementation of the present application, the detection device also includes a nucleic acid extraction module.

[0010] In one implementation of the present application, the reaction system of the first amplification includes a single-stranded DNA binding protein. It should be noted that the GC content of the partial amplification region detected by the Int22 inversion is as high as 79%, which significantly inhibits the amplification of PCR. By adding a single-stranded DNA binding protein (SSB) to the PCR amplification system, the extension ability of the DNA polymerase can be improved, the single-stranded DNA (ssDNA) structure can be stabilized, the DNA is less likely to form a complex secondary structure, and the yield and specificity of the PCR reaction can be increased. SSB can specifically have the following effects: (1) Stabilize single-stranded DNA: SSB can bind to single-stranded DNA to prevent it from re-annealing into a double-stranded structure, which is particularly important for the extension step in the PCR process because DNA polymerase requires a stable single-stranded template when synthesizing a new DNA chain. (2) Protect single-stranded DNA: In the PCR reaction, naked single-stranded DNA is easily degraded by nucleases. The presence of SSB can protect single-stranded DNA from attack by nucleases and ensure the integrity of the template. (3) Improve PCR efficiency and specificity: When dealing with complex or inhibitory samples, the addition of SSB can significantly increase the yield and specificity of PCR products. SSB can reduce the effects of inhibitory factors on PCR reactions. (4) Improve amplification of difficult templates: For templates with high GC content, long fragments, or complex secondary structures, SSB can help stabilize the template and promote more efficient amplification. (5) Optimize polymerase performance: SSB can increase the efficiency of chain synthesis by acting directly or indirectly on DNA polymerase, that is, SSB can improve the performance of DNA polymerase, especially when dealing with difficult-to-amplify templates.

[0011] In one implementation of the present application, the concentration of the single-stranded DNA binding protein in the reaction system of the first amplification is 0.0025-0.02 g / L, thereby further promoting the first amplification.

[0012] In one implementation of the present application, the annealing temperature of the first amplification is 60°C to 65°C. It should be noted that single-stranded DNA binding protein will reduce the binding between the primer and the template, so the conventional 68°C as the annealing temperature in the amplification procedure will reduce the amplification efficiency. Therefore, in the present application, lowering the annealing temperature to 60~65°C can facilitate the binding of the primer and the template, thereby enhancing the amplification efficiency.

[0013] In one implementation of the present application, the program of the first amplification is: 98°C, 1 min; 98°C, 10 s; 65°C, 30 s, 72°C, 3 min, 10-15 cycles; and stored at 4°C.

[0014] In one implementation of the present application, the product of the first amplification is diluted 500 to 1000 times and then used for the second amplification. It should be noted that because the fourth primer, the fifth primer, the sixth primer and the seventh primer are targeted to the product of the first amplification, and the product of the first amplification is amplified from the original DNA template, these primers will also target the original DNA template. In the present application, by diluting the product after the first amplification, the interference of the original DNA template on the detection can be reduced or even eliminated. Among them, the product after the first amplification is diluted 500 to 1000 times, which is sufficient to make the signal of the original DNA template undetectable in the subsequent (the corresponding sample of the original DNA template is diluted 500 to 1000 times, and the melting curve analysis is performed with the fourth primer, the fifth primer, the sixth primer and the seventh primer, and no detection signal is found, indicating that the detection after dilution 500 times will not be affected by the original DNA template).

[0015] In one implementation of the present application, a fluorescent dye is used to perform the melting curve analysis. It should be noted that the present application does not involve fluorescent probes, and the detection cost is low.

[0016] In one implementation of the present application, the fluorescent dye is SYBR Green I, SYTO9, EvaGreen, LCGreen or ResoLight.

[0017] The third aspect of the present application discloses a kit for detecting hemophilia A, wherein the kit comprises the primer set disclosed in the first aspect of the present application, or further comprises reagents required for the detection device disclosed in the second aspect of the present application.

[0018] In one implementation of the present application, the kit includes a first amplification reagent, the first amplification reagent includes a single-stranded DNA binding protein, and the single-stranded DNA binding protein (SSB) is used for the first amplification.

[0019] In one implementation of the present application, the amount of DNA template used in the first amplification is ≥5 ng.

[0020] In one implementation of the present application, the kit includes a second amplification reagent, the second amplification reagent includes a fluorescent dye, and the fluorescent dye is used for the melting curve analysis.

[0021] In one implementation of the present application, the kit further includes a dilution reagent, which is used to dilute the product of the first amplification, wherein the dilution reagent dilutes the first amplification product by 500 to 1000 times and then is used for the second amplification.

[0022] The beneficial effects of this application are:

[0023] The primer set and kit of the present application are simple and rapid to operate and the results are easy to interpret when used for the detection of F8 Inv22 in hemophilia A, and are suitable for large-scale detection or screening. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 This is a partial schematic diagram of the principle of detecting hemophilia A involved in this application.

[0025] Figure 2 The figure schematically shows the DNA gel electrophoresis diagram of a normal sample, a patient sample and a carrier sample.

[0026] Figure 3 The figure schematically shows the melting curves of a normal sample, a patient sample and a carrier sample.

[0027] Figure 4 This is the melting curve of F8 Inv22 patient when the DNA template amount is 10 ng.

[0028] Figure 5 This is the melting curve of F8 Inv22 patient when the DNA template amount is 5 ng. DETAILED DESCRIPTION

[0029] The present invention is further described in detail below by specific embodiments in conjunction with the accompanying drawings. In the following embodiments, many detailed descriptions are intended to enable the present application to be better understood. However, those skilled in the art can effortlessly recognize that some of the features can be omitted in different situations, or can be replaced by other materials and methods. In some cases, some operations related to the present application are not shown or described in the specification, in order to avoid the core part of the present application being overwhelmed by too much description, and for those skilled in the art, it is not necessary to describe these related operations in detail, and they can fully understand the related operations according to the description in the specification and the general technical knowledge in the art.

[0030] In addition, the features, operations or characteristics described in the specification can be combined in any appropriate manner to form various implementations. At the same time, the steps or actions in the method description can also be interchanged or adjusted in a manner that is obvious to those skilled in the art. Therefore, the various sequences in the specification and the drawings are only for the purpose of clearly describing a certain embodiment and are not meant to be a required sequence, unless otherwise specified that a certain sequence must be followed.

[0031] At present, the main detection methods for inversion of intron 22 of F8 gene in hemophilia A include Southern blot hybridization, long distance PCR (LD-PCR), inverse PCR (I-PCR), etc. Among them, Southern blot hybridization has the problems of large amount of DNA required for detection, the use of dangerous radioactive chemicals, cumbersome experimental process, and high reagent costs. LD-PCR amplification time (>8 hours) and electrophoresis time (>5 hours) are very long, and aerosol contamination is easily caused during gel electrophoresis, which in turn affects the accuracy of laboratory sample detection. In addition, the results are interpreted by the position of the bands in gel electrophoresis, and 11kb and 12kb are not easy to distinguish in agarose gel electrophoresis analysis. Inverse PCR and inverse displacement PCR (IS-PCR) use BclI restriction endonuclease to cut genomic DNA, and then connect the BclI digestion products into a ring through ligase, and then use primers for multiple inverse PCR. Finally, the PCR products are analyzed by gel electrophoresis, and the results are judged according to the size of the product fragments. However, this method has the disadvantages of being complex to operate, time-consuming, and relying on gel electrophoresis for result analysis, making it unsuitable for large-scale screening.

[0032] In view of this, the present application creatively provides a primer set, a kit and a detection device for detecting hemophilia A, and the present application has the following advantages and progress:

[0033] (1) This applicant independently designed a primer set to detect the inversion of intron 22. Through a large number of specific primer designs and tests, LD-PCR primers with relatively short amplification product fragments (<10kb) and the ability to specifically distinguish Inv22 from normal people were screened out.

[0034] (2) The detection time is greatly shortened, and the entire detection time is reduced from the original 13~18h to about 2h. Among them, the extension time of the LD-PCR link (first amplification) of the present application is only 3min, the number of cycles can be 10~15 cycles, and the LD-PCR stage takes 1~1.5h; while the extension time of LD-PCR in the prior art mostly requires 10~15min, the number of cycles is 30~35 cycles, and the LD-PCR stage takes 8~10h. The present application analyzes the inversion of intron 22 of the F8 gene by the melting curve method. The melting curve analysis stage takes only about 1h, while the gel electrophoresis method in the prior art requires 5~8h.

[0035] (3) By adding single-stranded DNA binding protein (SSB) to the LD-PCR amplification system, the extension ability of DNA polymerase can be improved, the ssDNA structure can be stabilized, and the yield and specificity of the PCR reaction can be increased. Since the GC content of some amplified regions detected by Int22 inversion is as high as 79%, which significantly inhibits PCR amplification, the addition of SSB protein can make DNA less likely to form complex secondary structures, facilitating PCR amplification. It should be noted that single-stranded DNA binding protein will reduce the binding between primers and templates, so the use of the conventional 68°C as the annealing temperature in the amplification program will reduce the amplification efficiency. In this application, lowering the annealing temperature to 60~65°C can facilitate the binding of primers and templates, and then performing an extension process at 72°C, thereby enhancing the amplification efficiency. In summary, by adding SSB and optimizing the amplification program, the detection time can be significantly shortened.

[0036] (4) This application does not involve fluorescent probes and the detection cost is low.

[0037] (5) The requirement for DNA input is low, and detection can be completed with a very small amount of DNA input. In the present application, the DNA input amount can be 5-100 ng, and the minimum can be 5 ng. The LD-PCR gel electrophoresis method in the prior art has a high requirement for DNA input, usually 100 ng.

[0038] (6) The result interpretation is simpler, faster and more accurate. The present application interprets the result by the number of melting curve peaks and the size of Tm, avoiding the problem of long-term electrophoresis and difficulty in distinguishing bands. The operation is simple, the sensitivity is high, the result is easy to judge, and the detection cost is greatly reduced.

[0039] The present specific embodiment relates to a primer set for detecting hemophilia A (hereinafter sometimes referred to as "primer set"), a detection device for hemophilia A (hereinafter sometimes referred to as "detection device"), and a kit for detecting hemophilia A (hereinafter sometimes referred to as "kit").

[0040] In a specific embodiment, the primer set may include a first primer, a second primer and a third primer.

[0041] Figure 1 This is a schematic diagram of part of the principle of detecting hemophilia A involved in this application. Figure 1 As shown, in a specific embodiment, the first primer and the second primer specifically target the copy in intron 22 of the F8 gene (ie, Int22-h1), and the third primer specifically targets the copy that is highly homologous to Int22-h1 (ie, Int22-h2 and Int22-h3).

[0042] In a specific embodiment, the first primer, the second primer and the third primer are used for the first amplification. If the F8 gene does not have intron 22 inversion, the first primer and the second primer are amplified to obtain the amplification product of the first primer and the second primer, that is, the product of the first amplification is the amplification product of the first primer and the second primer. If the F8 gene has intron 22 inversion ( Figure 1 The break position is schematically drawn in the figure), the first primer and the third primer are amplified and the amplification products of the first primer and the third primer are obtained, that is, the first amplification product is the amplification product of the first primer and the third primer.

[0043] In a specific embodiment, the primer set may include a fourth primer, a fifth primer, a sixth primer and a seventh primer.

[0044] In a specific embodiment, the fourth primer, the fifth primer, the sixth primer and the seventh primer are used for the second amplification.

[0045] In a specific embodiment, the fourth primer and the fifth primer specifically target the amplification product of the first primer and the second primer, and the sixth primer and the seventh primer specifically target the amplification product of the first primer and the third primer.

[0046] In a specific embodiment, the second amplification includes melting curve analysis, so that the amplification result can be detected by the melting curve method.

[0047] In a specific embodiment, the amplification product of the fourth primer and the fifth primer has a different melting temperature (Tm value) from the amplification product of the sixth primer and the seventh primer, so that the detection results can be distinguished according to the difference in Tm values ​​of different amplification products.

[0048] In a specific embodiment, the Tm value of the amplification product of the fourth primer and the fifth primer differs from the Tm value of the amplification product of the sixth primer and the seventh primer by more than 2° C. This can help to more clearly distinguish different detection results.

[0049] In a specific embodiment, the first amplification reaction system may include a single-stranded DNA binding protein (SSB).

[0050] In a specific embodiment, the reaction system of the first amplification may include 0.0025-0.02 g / L of SSB. For example, the reaction system of the first amplification may include 0.0025 g / L, 0.005 g / L, 0.01 g / L, 0.015 g / L or 0.02 g / L of SSB.

[0051] In a specific embodiment, the reaction system of the first amplification may include 0.01 g / L SSB.

[0052] In a specific embodiment, the reaction system of the first amplification can be shown in the following table:

[0053] Element Volume (µL) 2×GC Buffer I 10 TaKaRa LA Taq(5U / µL) 0.12 2.5 mM dNTP (dGTP: 7-deaza-dGTP= 3: 1) 1.6 ET SSB Protein (1 μg / µL) 0.2 First primer (10 μM) 0.4 Second primer (10 μM) 0.4 Third primer (10 μM) 0.4 gDNA (DNA template) (25 ng / µL) 2 Nuclease-free water Up to 20 µL Total Reaction Volume 20

[0054] In a specific embodiment, in the reaction system of the first amplification, the minimum amount of DNA template can be 5ng. It should be noted that in the present application, the detection requirements can be achieved using a lower amount of template, for example, the template amount can be 10ng, and the minimum can be 5ng. Compared with conventional LD-PCR or inverse PCR, reverse displacement PCR has obvious advantages.

[0055] In a specific embodiment, the annealing temperature in the first amplification may be 60° C. to 65° C. For example, the annealing temperature in the first amplification may be 60° C., 61° C., 62° C., 63° C., 64° C., or 65° C.

[0056] In a specific embodiment, in the first amplification process, the extension temperature can be 72°C.

[0057] In a specific embodiment, in the first amplification procedure, the extension time can be 3 minutes to 5 minutes. It should be noted that the present application can achieve an extension time of only 3 minutes by improving the first amplification system (adding an appropriate amount of SSB, etc.), thereby significantly reducing the detection time and improving the detection efficiency.

[0058] In a specific embodiment, in the first amplification procedure, the number of cycles of melting, annealing and extension can be 10 to 15 cycles. It should be noted that the use of the primer set designed in this application, the system of the first amplification, and the melting curve method for result analysis have higher sensitivity, and only 10 to 15 cycles are required in the first amplification to achieve accurate detection of the sample, thereby significantly reducing the detection time and improving the detection efficiency.

[0059] In a specific embodiment, the program of the first amplification can be: 98°C, 1 min; 98°C, 10 s; 65°C, 30 s, 72°C, 3 min, 15 cycles; and stored at 4°C.

[0060] In a specific embodiment, the sequences of the first primer, the second primer and the third primer can be shown in the following table:

[0061] Serial number name Sequence (5'-3') SEQ ID NO.1 First primer AAGAGCTGTTTCTAGTTCATCAATCTCTGTTC SEQ ID NO.2 Second primer GGACAACATTTACCTCCCCTGCCAT SEQ ID NO.3 The third primer CAGCACCTTGAACTTCCCCTCTCATA

[0062] In a specific embodiment, after the first amplification is completed, the first amplification product is diluted and then the second amplification is performed.

[0063] In a specific embodiment, after the first amplification is completed, the first amplification product is diluted 500-1000 times before the second amplification is performed.

[0064] In one embodiment, nuclease-free water or TE (Tris-EDTA buffer, containing 10 mM Tris-HCl and 1 mM EDTA) is used for dilution.

[0065] In one embodiment, the second amplification does not use a fluorescent probe for melting curve analysis.

[0066] In one embodiment, the second amplification is performed using a fluorescent dye to perform melting curve analysis.

[0067] In a specific embodiment, the fluorescent dye may be SYBR Green I, SYTO9, EvaGreen, LC Green or ResoLight.

[0068] In a specific embodiment, the reaction system of the second amplification can be shown in the following table:

[0069] Element Volume (µL) SGExcel Universal SYBR qPCR Mix (Sanggong, B532958) 10 Fourth primer (10 μM) 0.4 Fifth primer (10 μM) 0.4 Sixth primer (10 μM) 0.4 Seventh primer (10 μM) 0.4 LD-PCR amplification product (diluted 500 times) 2 <![CDATA[H2O]]> Up to 20

[0070] In a specific embodiment, the experimental procedure of the second amplification can be: 95°C, 30 s; 95°C, 10 s, 60°C, 30 s, 27 cycles; 95°C, 5 s; 60°C~90°C (gradient heating; 0.1°C / s); the fluorescence channel is SYBR.

[0071] In a specific embodiment, the sequences of the fourth primer, the fifth primer, the sixth primer and the seventh primer can be shown in the following table:

[0072] Serial number name Sequence (5'-3') SEQ ID NO.4 The fourth primer ATCTGGAGGTGAATGCTTAG SEQ ID NO.5 Fifth primer CATAGTAGTTGCTCAGTGAC SEQ ID NO.6 The sixth primer AATATAGATCAGATCCCTGCAT SEQ ID NO.7 The seventh primer TTCCCCTCTCATAGCACTTA

[0073] In a specific embodiment, the Tm value of the amplification product of the fourth primer and the fifth primer is 73° C.-74.5° C.

[0074] In a specific embodiment, the Tm value of the amplification product with the sixth primer and the seventh primer is 76.5°C-77.5°C.

[0075] In a specific embodiment, the present application relates to a detection device for hemophilia A.

[0076] In a specific embodiment, the detection device further includes a nucleic acid extraction module, thereby being able to obtain a nucleic acid sample of the sample to be tested.

[0077] In a specific embodiment, the detection device includes a first amplification module and a melting curve analysis module.

[0078] In a specific embodiment, the first amplification module includes using a first primer, a second primer and a third primer to perform a first amplification. It should be noted that the contents of the first primer, the second primer and the third primer and the first amplification can refer to the above contents.

[0079] In a specific embodiment, the melting curve analysis module includes using the fourth primer, the fifth primer, the sixth primer and the seventh primer to perform a second amplification and a melting curve analysis on the product of the first amplification. It should be noted that the fourth primer, the fifth primer, the sixth primer and the seventh primer, as well as the second amplification and the melting curve analysis can be referred to the above content.

[0080] In a specific embodiment, the present application relates to a kit for detecting hemophilia A.

[0081] In a specific embodiment, the kit may include the aforementioned primer set.

[0082] In a specific embodiment, the kit may include the reagents required for the aforementioned detection device.

[0083] In a specific embodiment, the kit can include a first amplification reagent.

[0084] In a specific embodiment, the first amplification reagent may include a single-stranded DNA binding protein.

[0085] In a specific embodiment, the first amplification reagent may also include DNA polymerase, dNTPs, Mg 2+ , buffer solution.

[0086] In a specific embodiment, the kit can include a second amplification reagent.

[0087] In a specific embodiment, the second amplification reagent may include a fluorescent dye.

[0088] In a specific embodiment, the fluorescent dye may be SYBR Green I, SYTO9, EvaGreen, LC Green or ResoLight.

[0089] In a specific embodiment, the second amplification reagent may also include DNA polymerase, dNTPs, Mg 2+ , buffer solution.

[0090] In one embodiment, the kit may include a diluent.

[0091] In a specific embodiment, the diluent can be nuclease-free water or TE.

[0092] In a specific embodiment, the kit may include a positive quality control product, a negative quality control product, and a nucleic acid extraction reagent.

[0093] The present application is further described in detail below by specific examples. The following examples are only further described for the present application and should not be construed as limiting the present application. In the present example, unless otherwise specified, the reagents and instruments used are all commercially available, and the experimental operations are carried out in accordance with the product instructions and conventional experimental specifications.

[0094] Example:

[0095] Nucleic acid extraction: Blood samples were collected from subjects, and leukocyte DNA (gDNA) was extracted using a nucleic acid extraction kit (manufacturer: Meiji Biotechnology, catalog number: MD5111-02). After extraction, the concentration was determined by Quibit and the integrity of the genome was analyzed by Agilent 4200 Bioanalyzer. The extracted nucleic acid met the concentration ≥15 ng / µL and DIN value ≥6 before proceeding to the next step. Each sample was then tested by the LD-PCR melting curve method of this application and the conventional LD-PCR gel electrophoresis method.

[0096] (1) Conventional LD-PCR gel electrophoresis method:

[0097] LD-PCR was performed in two independent reaction systems: P&Q reaction (using Int22-P and Int22-Q primers) and P&B reaction (using Int22-P and Int22-B primers). LD-PCR was performed using the following system:

[0098] Element Dosage GC buffer I (TaKaRa) 10µL dNTP (dGTP:7-deaza-dGTP=3:1) (2.5 mM) 1.6µL LA Taq polymerase (TaKaRa) 0.12µL Int22-P (10 μM) 0.4µL Int22-Q / B (10 μM) 0.4µL gDNA 100 ng Nuclease-free water Up to 20µL Total volume 20µL

[0099] Experimental procedure: 98°C: 1 min; 98°C: 10 s, 68°C: 10 min, 30 cycles; 72°C: 10 min; 4°C, ∞.

[0100] A 0.6% agarose gel was prepared and the product was analyzed by agarose gel electrophoresis (voltage: 100 V, time: 40 min). Figure 2 The figure schematically shows the DNA gel electrophoresis diagram of one normal human sample, one patient sample and one carrier sample.

[0101] The primer and probe sequences used in LD-PCR are shown in the following table:

[0102] Serial number name Sequence (5'-3') SEQ ID NO.8 Int22-P GCCCTGCCTGTCCATTACACTGATGACATTATGCTGAC SEQ ID NO.9 Int22-Q GGCCCTACAACCATTCTGCCTTTCACTTTCAGTGCAATA SEQ ID NO.10 Int22-B CCCCAAACTATAACCAGCACCTTGAACTTCCCCTCTCATA

[0103] Figure 2 The figure schematically shows the DNA gel electrophoresis diagram of a normal sample, a patient sample and a carrier sample. Figure 2 Normal samples only produce PQ fragments of about 12kb, patient samples only produce PB fragments of about 11kb, and carrier samples have both PQ fragments and PB fragments.

[0104] (2) LD-PCR melting curve method:

[0105] ① Use the following system to perform LD-PCR and obtain LD-PCR products:

[0106] Element Dosage 2×GC Buffer I (TaKaRa) 10µL TaKaRa LA Taq(5U / µL) 0.12µL 2.5 mM dNTP (dGTP:7-deaza-dGTP=3:1) 1.6µL ET SSB Protein (1 μg / µL) 0.2µL Int22h1-F (first primer) (10 μM) 0.4µL Int22h1-R (second primer) (10 μM) 0.4µL Int22h2&3-R (third primer) (10 μM) 0.4µL gDNA 50ng Nuclease-free water Up to 20 µL Total volume 20µL

[0107] Experimental procedure: 98°C, 1 min; 98°C, 10 s; 65°C, 30 s, 72°C, 3 min, 15 cycles; stored at 4°C.

[0108] The primer sequences are shown in the following table:

[0109] Serial number name Sequence (5'-3') SEQ ID NO.1 First primer AAGAGCTGTTTCTAGTTCATCAATCTCTGTTC SEQ ID NO.2 Second primer GGACAACATTTACCTCCCCTGCCAT SEQ ID NO.3 The third primer CAGCACCTTGAACTTCCCCTCTCATA

[0110] ②The product of LD-PCR amplification was diluted 500 times. Using Biori Fluorescence Quantitative PCR Instrument, the following system was used for fluorescence quantitative PCR and melting curve analysis:

[0111] Element Volume (µL) SGExcel Universal SYBR qPCR Mix (Sanggong; B532958) 10 Int22h1-qF (fourth primer) (10 μM) 0.4 Int22h1-qR (fifth primer) (10 μM) 0.4 Int22h2&3-qF (sixth primer) (10 μM) 0.4 Int22h2&3-qR (seventh primer) (10 μM) 0.4 LD-PCR product (after 500-fold dilution) 2 <![CDATA[H2O]]> Up to 20

[0112] Experimental procedure: 95°C, 30 s; 95°C, 10 s, 60°C, 30 s, 27 cycles; 95°C, 5 s; 60°C~90°C (gradient heating; 0.1°C / s); fluorescence channel is SYBR.

[0113] The primer sequences are shown in the following table:

[0114] Serial number name Sequence (5'-3') SEQ ID NO.4 The fourth primer ATCTGGAGGTGAATGCTTAG SEQ ID NO.5 Fifth primer CATAGTAGTTGCTCAGTGAC SEQ ID NO.6 The sixth primer AATATAGATCAGATCCCTGCAT SEQ ID NO.7 The seventh primer TTCCCCTCTCATAGCACTTA

[0115] ③ Result judgment: If the melting peaks produced are double peaks, the patient is a carrier; if only one melting peak is produced and the Tm size is between 73℃~74.5℃, the patient is judged to be a normal person; if only one melting peak is produced and the Tm size is between 76.5℃~77.5℃, the patient is judged to be a patient.

[0116] Figure 3 The figure schematically shows the melting curves of a normal sample, a patient sample, and a carrier sample. Figure 3 , the normal sample has only one peak, and the Tm value is between 73℃ and 74.5℃, the patient sample has only one peak, and the Tm value is between 76.5℃ and 77.5℃, the carrier sample has two peaks, and there are no other miscellaneous peaks, indicating that the method has good specificity. The detection results of the LD-PCR melting curve method of this embodiment and the conventional LD-PCR gel electrophoresis method are consistent.

[0117] (3) Template amount for LD-PCR melting curve method:

[0118] Conventional LD-PCR gel electrophoresis has high requirements for DNA templates, and sometimes no results can be obtained when the template DNA is of poor quality or insufficient. The LD-PCR melting curve method of the present application has high sensitivity and low requirements for the amount of DNA template, and the minimum amount of DNA template can be as low as 5ng.

[0119] In this example, the amount of gDNA in the previous LD-PCR melting curve method was changed from 50 ng to 10 ng and 5 ng, respectively. Specifically, a nucleic acid sample from a patient was taken, the DNA concentration was measured, and then the LD-PCR reaction system contained 10 ng and 5 ng of gDNA template, respectively, and the other conditions remained unchanged, and LD-PCR detection was performed. Subsequently, the LD-PCR product was also diluted 500 times, and the melting curve analysis was also performed according to the qPCR amplification system and procedure. Figure 4 This is the melting curve of F8 Inv22 patient when the DNA template amount is 10 ng. Figure 5 This is the melting curve of F8 Inv22 patient when the DNA template amount is 5 ng. Figure 4 He Ru Figure 5 As shown, when the amount of DNA template in the first amplification was 10 ng and 5 ng, F8 Inv22 could be detected.

[0120] The above contents are further detailed descriptions of the present application in combination with specific implementation methods, and it cannot be determined that the specific implementation of the present application is limited to these descriptions. For ordinary technicians in the technical field to which the present application belongs, several simple deductions or substitutions can be made without departing from the concept of the present application.

Claims

1. A primer set for detecting hemophilia A, characterized in that: The primer set includes: a first primer, whose sequence is shown in SEQ ID NO.1; a second primer, whose sequence is shown in SEQ ID NO.2; a third primer, whose sequence is shown in SEQ ID NO.3; a fourth primer, whose sequence is shown in SEQ ID NO.4; a fifth primer, whose sequence is shown in SEQ ID NO.5; a sixth primer, whose sequence is shown in SEQ ID NO.6; and a seventh primer, whose sequence is shown in SEQ ID NO.7; wherein the first primer, the second primer and the third primer are used for a first amplification, and the first amplification is a long-distance PCR; the fourth primer, the fifth primer, the sixth primer and the seventh primer are used for a second amplification of the product of the first amplification, and the second amplification includes a melting curve analysis.

2. A detection device for hemophilia A, characterized in that: It includes a first amplification module, a melting curve analysis module and a judgment module; wherein: The first amplification module includes using a first primer, a second primer and a third primer to perform a first amplification, and the first amplification is a long-distance PCR; The melting curve analysis module includes using a fourth primer, a fifth primer, a sixth primer and a seventh primer to perform a second amplification and a melting curve analysis on the product of the first amplification; The judgment module includes judging the inversion of intron 22 of the F8 gene based on the Tm value of the melting curve; Among them, the sequence of the first primer is shown as SEQ ID NO.1, the sequence of the second primer is shown as SEQ ID NO.2, the sequence of the third primer is shown as SEQ ID NO.3, the sequence of the fourth primer is shown as SEQ ID NO.4, the sequence of the fifth primer is shown as SEQ ID NO.5, the sequence of the sixth primer is shown as SEQ ID NO.6, and the sequence of the seventh primer is shown as SEQ ID NO.

7.

3. The detection device according to claim 2, characterized in that: The reaction system of the first amplification includes a single-stranded DNA binding protein.

4. The detection device according to claim 3, characterized in that: The concentration of the single-stranded DNA binding protein in the first amplification reaction system is 0.0025-0.02 g / L.

5. The detection device according to claim 3, characterized in that: The annealing temperature of the first amplification is 60°C-65°C.

6. The detection device according to claim 5, characterized in that: The program of the first amplification is: 98°C, 1 min; 98°C, 10 s; 65°C, 30 s, 72°C, 3 min, 10-15 cycles; stored at 4°C.

7. The detection device according to claim 2, characterized in that: The product of the first amplification was diluted 500-1000 times and then used for the second amplification.

8. The detection device according to claim 2, characterized in that: The melting curve analysis was performed using fluorescent dyes.

9. The detection device according to claim 8, characterized in that: The fluorescent dye is SYBR Green I, SYTO9, EvaGreen, LC Green or ResoLight.

10. A kit for detecting hemophilia A, characterized in that: The kit comprises the primer set as claimed in claim 1, or further comprises reagents required for the detection device as claimed in any one of claims 2 to 9.

Images