A gene regulating cotton lint content and fiber strength and its application

Abstract

The present invention discloses a gene for regulating cotton lint content and fiber strength and its application, and relates to the field of genetic engineering. GhWY Gene, the GhWY The nucleotide sequence of the gene is shown in SEQ ID NO: 1. GhWY The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO: 2. GhWY , which can improve cotton lint content and fiber strength, and provide genetic resources for cotton breeding.

Description

Technical Field

[0001] The invention relates to the field of genetic engineering, and in particular to a gene for regulating cotton lint content and fiber strength and its application. Background Art

[0002] Upland cotton ( G. hirsutum L. ) is the most important natural fiber crop in the world. my country's high-quality cotton production is seriously insufficient, and 95% of high-quality raw cotton suitable for spinning high-end cotton yarn above 60 counts relies on imports. Cloth content is a direct factor affecting cotton fiber production. Increasing cotton fiber production by increasing cotton content is the main way to ensure my country's self-sufficiency in cotton fiber. At the same time, with the innovation of textile technology, the requirements for cotton fiber quality, especially the strength of cotton fiber, are getting higher and higher. However, the varieties currently promoted in production still generally have the problem of low cloth content and fiber strength. Therefore, cultivating high cloth content and high strength varieties is one of the important tasks of cotton breeding.

[0003] Cotton fiber is a single-cell protrusion of the epidermis of the ovule. The period from 0 to 15 days after flowering (day postanthesis, DPA, days after flowering) is mainly for fiber elongation. Among them, 1DPA-5DPA before and after flowering is the key period for the formation of long fibers and the formation of lint, while 15 to 40 DPA is mainly for secondary wall thickening, which is related to fiber strength. Cotton fiber development is a complex quantitative trait controlled by multiple genes. Due to the narrow genetic background of current upland cotton varieties and a certain degree of genetic negative correlation between fiber yield and quality, the traditional breeding methods are inefficient and time-consuming for quality improvement. It is crucial to explore fiber development-related genes, especially transcription factor genes, and understand their complex genetic basis to use biotechnology to synergistically improve fiber yield and quality.

[0004] The WRKY family is one of the largest transcription factor families in plants, and genes in this family play an important role in plant growth, development, and stress response. Research on the functions of WRKY family genes in cotton has mainly focused on drought resistance, salt tolerance, disease resistance, and other adverse stress areas. Currently, there are few studies on the relationship between this gene family and cotton lint percentage. In terms of fiber development, researchers analyzed the expression pattern of members of the III subgroup of upland cotton WRKY genes during cotton fiber development and found that they were mainly expressed in ovules or fibers at -3~3 DPA. It is speculated that they may be involved in the initiation of cotton fibers and further heterologously expressed in Arabidopsis. GhWRKY53 Significantly increased epidermal hair density. GhWRKY16 is a WRKY transcription factor that positively regulates cotton fiber initiation and elongation by activating GhMYB25 , GhHOX3 , GhMYB109 and cellulose synthase genes GhCesA6D-D11expression to promote fiber synthesis. GbWRKY40 The expression level was high in roots and fibers at 25 DPA, suggesting that it may be involved in the development of the secondary wall of cotton fibers in sea island cotton, but further experimental verification is lacking. GhWRKY40 The expression level in short fibers of upland cotton can increase fiber length. In summary, the function and molecular mechanism of WRKY in the formation of cotton clothing grade and fiber strength are still unclear. Summary of the invention

[0005] In view of the above problems, the present invention provides a gene and application for regulating cotton lint content and fiber strength. Wlq Phenotypic analysis of gene silenced / edited plants revealed Wlq The lint percentage and fiber strength are reduced. By utilizing this regulatory gene, the lint percentage and fiber strength of cotton can be synergistically improved, providing genetic resources for cotton breeding.

[0006] The present invention provides a method for regulating cotton lint content and fiber strength. WRKY40 Domain gene, the gene is Wlq Gene, the Wlq The nucleotide sequence of the gene is shown in SEQ ID NO:1.

[0007] Furthermore, the Wlq The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO:2.

[0008] The present invention provides an application of a gene for regulating cotton lint content and fiber strength, wherein the gene is Wlq Gene, the Wlq The nucleotide sequence of the gene is shown in SEQ ID NO: 1, and the amino acid sequence of the encoded protein is shown in SEQ ID NO: 2.

[0009] Furthermore, the Wlq Genes can regulate cotton lint content and fiber strength.

[0010] Furthermore, the Wlq The gene was cloned from cotton leaves (cloned from the cDNA of the leaves of the offspring of Ji 1518 using homologous cloning method) Wlq , Wlq The ORF of the gene is 942 bp in length and encodes 313 amino acids).

[0011] Compared with the prior art, the present invention has the following beneficial effects:

[0012] The present invention identified a candidate region that may be related to lint percentage and fiber strength through mixed pool resequencing. The region contains 86 candidate genes. Transcriptome sequencing was performed on two parents with different lint percentage / fiber strength, and it was found that one of the 86 candidate genes WRKY Transcription Factors Wlq Differentially expressed in the parents and silenced using VIGS Wlq It was found that the clothing content decreased, the fiber strength decreased, and the fiber surface and internal structure changed. Wlq After gene editing, strains with significantly reduced lint percentage were screened. Using this regulatory gene, the lint percentage and fiber strength of cotton can be improved synergistically, providing genetic resources for the breeding of high-quality cotton. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 It is the result of association analysis based on high-quality SNP (single nucleotide polymorphism) in the mixed pool sequencing of the present invention. Figure 1 A is the distribution of association values ​​on chromosomes based on the ED algorithm, Figure 1 B is the distribution of association values ​​on chromosomes based on the SNP-index algorithm;

[0014] Figure 2 The present invention Wlq the genetic structure of genes;

[0015] Figure 3 The present invention Wlq In high strength (A h ) and low strength (A l ) Analysis of expression levels during parental lint formation / fiber development;

[0016] Figure 4 The present invention is to inject pCLCrVA during the flowering period and the boll opening period: GhCLA1 After the growth point of the stem tip (arrow A), the new leaves are bleached (A, B), and the fibers are at 10DPA Wlq The expression level was significantly decreased compared with the control (C);

[0017] Figure 5 The present invention is silent Wlq Then the changes of the fiber content (A), the thickness of a single fiber (B), the fiber strength (C), and the changes of the fiber surface (D) and internal structure (E) were counted;

[0018] Figure 6 The gene editing of the present invention Wlq The changes of the sequencing sequence (A) and lint content (B) of the Ge4 target site in the stable strain;

[0019] Figure 7 The present invention WlqSubcellular localization in tobacco cells. In the figure, RFP represents nuclear and cytoplasmic markers, GFP represents green fluorescence field, BF represents bright field, and Merge represents superimposed field;

[0020] Figure 8 The yeast two-hybrid library of the present invention is constructed and screened to obtain the GhWY interacting protein GhAP D6 , Figure 8 In A, the seven lanes are markers from left to right. h -0 DPA, A h -10 DPA, A h -25 DPA, A l -0 DPA, A l -10 DPA, A l -25DPA, Figure 8 B is the identification of the secondary library capacity of the nuclear system. Figure 8 C is the size of the inserted fragment and the recombination rate of the nuclear system library. Figure 8 D is the result of GhWY rescreening; Figure 8 E is Wlq and aspartic protease GhAP D6 The yeast two-hybrid results, Figure 8 F is Wlq and aspartic protease GhAP D6 The results of luciferase complementation assay;

[0021] Fig. 9 The present invention GhAP D6 Gene structure analysis (A) and its role in high lint content and high strength A h and low clothing score and low strength A l Expression analysis during parental fiber development (B);

[0022] Fig.10 The present invention is silent Wlq back GhAP D6 The expression level was significantly upregulated (A), and the activity of aspartic acid protease increased (B);

[0023] Fig.11 The present invention is silent Wlq The activity of IAAO enzymes involved in fiber development increased significantly at 10-20 DPA (A), while the activity of POD enzymes decreased significantly at 10 DPA (B). DETAILED DESCRIPTION

[0024] In order to make the purpose and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0025] The instruments, reagents, materials, etc. involved in the following examples, unless otherwise specified, are all conventional instruments, reagents, materials, etc. in the prior art and can be obtained through regular commercial channels. The experimental methods, detection methods, etc. involved in the following examples, unless otherwise specified, are all conventional experimental methods, detection methods, etc. in the prior art.

[0026] Example 1 Candidate genes for cotton lint content and fiber strength Wlq Identification and cloning of

[0027] Research method: The hybrid cotton Ji 1518 segregation progeny was used to screen material A with significant differences in lint percentage and fiber strength. h and A l A secondary segregation population of 280 strains was constructed (Table 1). 20 strains with extreme fiber strength and lint percentage and two parents were screened for pooled resequencing (BSA-seq). Combined with high-quality SNPs in BSA-seq, association analysis was used to obtain lint percentage and fiber strength candidate regions. The intersection of ED distance and SNP-index association algorithm was combined to obtain a total of 0.82 Mb candidate regions on chromosomes D5 and D8 ( Figure 1 ), a total of 86 candidate genes in this region (Table 2), h and A l Transcriptome sequencing was performed at the critical period of lint percentage and fiber strength formation (0DPA, 5DPA, 10DPA, 20DPA and 30DPA) (data not published), and differentially expressed genes were screened. It was found that only 3 genes were differentially expressed among the above 86 genes (Table 3). Among these 3 genes, a WRKY transcription factor Wlq The differential expression fold is the largest in the parent, so it is determined Wlq Follow-up studies were conducted on candidate genes for lint percentage and fiber strength.

[0028] Take parent A h and A l Total RNA was extracted from fresh young leaves of 100 μg / ml using the Plant RNA Extraction Kit (DP441) (TIANGEN, Beijing, China), and then reverse transcribed into cDNA using the Reverse Transcription Kit (6210A) (TaKaRa, Dalian, China). The cloned cDNA was designed using Primer Premier 6.25 (PREMIER Biosoft International, SanFrancisco, USA). WlqSpecific primers for the coding region are shown in Table 4. After PCR amplification (amplification system: cDNA 1 μL, upstream and downstream primers, 0.5 μL each, 2× SparkHiFi Max Master Mix (with dye) 5 μL, ultrapure water: 3 μL. PCR reaction system: 95℃: 3 min; [95℃: 15 sec, 61℃: 15 sec, 72℃: 30 sec] 35 cycles, 72℃: 5 min) and PCR product purification, the product was ligated into TOPO-TA / simple vector (PT0102) (LABLEAD, Beijing, China) and transformed into Escherichia coli TOP10 competent cells. Eight single clones were randomly selected from each gene and then subjected to Sanger sequencing (Sangon Biotech, Shanghai, China). Multiple sequence alignment of the amplified genes was performed using MEGA 7.0, and the alignment results showed that the two parental A h and A l middle Wlq There is no sequence difference in the gene coding region. Wlq The gene open reading frame is 942 bp in length, encoding 313 amino acids ( Figure 2 ). Wlq The expression level of the gene was analyzed during the critical period of lint formation and fiber development, and it was found that the parent A with significant differences in lint and fiber strength h and A l There were significant differences in expression levels during the middle and multiple periods ( Figure 3 ). Wlq The nucleotide sequence of the gene is shown in SEQ ID NO: 1, and the amino acid sequence of the encoded protein is shown in SEQ ID NO: 2.

[0029] Table 1 Lint percentage and fiber strength data of the secondary group parents (average of three years)

[0030]

[0031] Table 2 Candidate regions for lint content and fiber strength determined by BSA-seq

[0032]

[0033] Table 3 Differentially expressed genes in candidate regions

[0034]

[0035] Table 4 Primer sequence list

[0036]

[0037] Example 2 Using VIGS to verify that GhWY can affect cotton lint content and fiber strength

[0038] Research methods: Using pCLCrVA vector as the backbone, the GhWY silencing vector was constructed. The primers for the construction are shown in Table 5:

[0039] Table 5 Primer sequence list

[0040]

[0041] The vector was then transferred into Agrobacterium strain GV3101, and inoculated when the two cotyledons of the cotton seedlings were fully expanded, with pCLCrVA: 00 and pCLCrVA: GhCLA1 As negative and positive controls, the cells were cultured at 28℃ / 23℃ and 15h / 9h light conditions until boll opening. Two weeks after inoculation, pCLCrVA: GhCLA1 The plant turned white, indicating that the inoculation was successful. Since the cotyledon stage is a long time before the boll opening, in order to ensure the silencing effect and reduce the impact of frequent inoculation on boll setting, the growth point was injected 1-2 times after the flowering stage to maintain the silencing effect. Figure 4 AB), pCLCrVA: Wlq The expression level of fibers at 10 DPA was similar to that of the control pCLCrVA: 00 Significantly lower than ( Figure 4 C), indicating that this method can effectively maintain the long-term silencing efficiency of the target gene. The middle bolls of 10-15 silenced plants that bloomed within three days were collected as a biological replicate, and three replicates were set. The cotton seeds were removed by a small sample gin and the lint content was measured (lint content = lint weight / seed cotton weight * 100%). The fiber measuring instrument FAVIMAT was used to measure the fineness of a single fiber (unit: dtex) and the fiber strength (unit: cN / dtex). 100 fibers were evenly screened for each biological replicate for measurement. Scanning electron microscopy (SEM) and transmission electron microscopy (TEM) were used to analyze the changes in the fiber surface and internal structure. SEM: The sample was taken and directly adhered to the conductive adhesive, and gold was sprayed for 45 seconds at 10 mA using a Quorum SC7620 sputter coater, and imaged at 3.0 kV (Czech Republic) using a TESCAN MIRA LMS (TESCAN, Czech Republic) scanning electron microscope. TEM: Cross sections of fiber samples were fixed in 2.5% glutaraldehyde and incubated in a 4°C refrigerator for 12 h-24 h, followed by incubation in 1% OsO4 for 2 h. They were further dehydrated by applying a stepwise ethanol gradient and embedded in Spurr's medium before ultrathin sectioning. Sections (70-90 nm thick) were cut with an ultramicrotome (EM UC7, 645 Leica, Germany) and transferred to copper grids.

[0042] The results showed that silence Wlq After that, the clothing percentage decreased ( Figure 5 A), the fineness of individual fibers related to the clothing content is significantly reduced ( Figure 5 B), fiber strength decreases ( Figure 5 C), and the fiber surface becomes smoother ( Figure 5 D), the internal structure is looser ( Figure 5 E), indicating Wlq Genes can regulate cotton lint formation and fiber strength.

[0043] Example 3 Gene Editing Wlq The strain Ge4 with significantly reduced lint content was obtained by screening.

[0044] By building Wlq CRISPR-Cas9 vectors, screening Wlq The specific target site on the PCR product was edited, and the editing target site was AGGGACATAATCCTCACACTCGG, as shown in SEQ ID NO: 7. The hypocotyls of cotton "Zhong 49" were transformed by Agrobacterium-mediated method, and T0-T1 generation plants were obtained. The editing site was sequenced in each generation. The sequencing primers are shown in Table 6, and the Wlq Homozygous edited plants ( Figure 6 A). Comparison of the same environment Wlq The lint percentage of gene-edited (Ge4) and wild-type (recipient) cotton was measured using a small cotton gin at maturity for 15 cotton bolls (flowering and boll opening time < 7 days) of both plants at the same time, with three replicates. The results showed that: Wlq The lint content of the edited strain Ge4 was significantly lower than that of the wild type ( Figure 6 B), which is consistent with the previous VIGS results ( Figure 5 A) The trend is consistent. The above data shows Wlq Can affect cotton clothing points.

[0045] Table 6 Primer sequence list

[0046]

[0047] Example 4 Subcellular localization of GhWY and screening and verification of interacting proteins

[0048] Using parent A h and A lThe cDNA of GhWY was used as a template, and homologous recombination and seamless cloning methods were used to construct the GhWY coding region segment into the N-terminal fusion green fluorescent protein (GFP) vector pR101-GFP. The construct was introduced into the Agrobacterium strain GV3101 and then infiltrated into the leaves of Nicotiana benthamiana plants. Observation using an Olympus FV1200 confocal microscope and using the nuclear membrane marker PBIN-RFP as an indicator marker showed that GhWY was only localized in the cell nucleus ( Figure 7 ).

[0049] In this study, we used parent A, which had significant differences in lint percentage and fiber strength. h and A l During the fiber development period, cotton fiber RNA at 0DPA, 10DPA, and 25DPA was mixed in equal amounts ( Figure 8 A) The cotton nuclear system yeast library was constructed using Gateway technology. The total number of clones in the primary library was 1.2×10 7 CFU, total clones of the secondary library nuclear system are 1.30×10 7 CFU, recombination rate 100%, average insert length>1000bp ( Figure 8 B). After transformation into yeast, clone identification showed that the average length of the inserted fragment was >1000bp ( Figure 8 C). Using the BD vector pGBKT7-GhWRKY40 as bait, the yeast AD library was screened, and 42 clones were obtained after primary and secondary screening ( Figure 8 D) After yeast two-hybrid one-to-one verification and luciferase complementation assay, a GhWRKY40-interacting protein, aspartic protease GhAP, was found. D ( Figure 8 EF). Therefore, firstly in the high strength A h and low strength A l GhAP D , GhAP was found D6 No sequence differences in genes, analysis of GhAP D6 Gene structure ( Fig. 9 A) and its h and A l The expression levels of the parental fibers during development were found to be significantly different at 0 DPA in the initial stage of fiber development (the period of fiber formation), but not much different in the later stages ( Fig. 9 B).

[0050] Example 5 GhWY and GhAP D6 Interactions regulate fiber development in upland cotton

[0051] Further study of GhWY and GhAP D How to participate in the regulation of fiber development, in low-cloth content and low-strength A l After GhWY was significantly down-regulated in the parent, the gene encoding its interacting protein aspartic protease GhAP D The expression level was increased by nearly 30 times ( Fig.10 A) and the activity of aspartic acid protease during the cotton fiber development period was determined, and it was found that its activity increased significantly during the fiber formation period of 10-20 DPA ( Fig.10 B), indicating that GhWY and GhAP D6 They are jointly involved in the fiber development of upland cotton.

[0052] At the same time, determination Wlq After silencing, the activities of indoleacetic acid oxidase (IAAO) and peroxidase (POD), two key enzymes in the fiber development process, were significantly increased at 10-20 DPA ( Fig.11 A), POD enzyme activity decreased significantly at 10 DPA ( Fig.11 B) further proves from a physiological perspective that GhWY regulates upland cotton fiber development.

[0053] In summary, this example combined mixed pool resequencing and transcriptome sequencing to identify a transcription factor Wlq Potential candidate genes for lint content and fiber strength, silenced / edited using VIGS Wlq It was found that the fiber content and fiber strength decreased, the individual fibers became thinner, the fiber surface became smoother, and the internal structure of the fibers changed. Wlq How does it affect fiber development? We constructed a yeast library during fiber development and screened out the GhWY interacting protein aspartic protease GhAP D6 ,exist Wlq After downgrade GhAP D6 The activity of aspartic acid protease was significantly upregulated by about 30 times, and correspondingly, the activities of indoleacetic acid oxidase (IAAO) and peroxidase (POD) involved in fiber development also changed, indicating that GhWY protein activated GhAP D6 Interactions regulate fiber development, thereby affecting fiber content formation or fiber strength.

[0054] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. An application of a gene for regulating cotton lint content and fiber strength, characterized in that: The gene is GhWY Gene, GhWY The nucleotide sequence of the gene is shown in SEQ ID NO: 1, and the amino acid sequence of the encoded protein is shown in SEQ ID NO: 2; GhWY Genetic regulation of cotton lint content and fiber strength.

Images