Use of miR-128-1-5p

By targeting the EGR3 gene with miR-128-1-5p and regulating the AKT and ERK signaling pathways, the problem of existing drugs being unable to completely cure type I hypersensitivity reactions has been solved. This has achieved effective inhibition of mast cell degranulation and the release of inflammatory mediators, and significantly improved symptoms such as allergic asthma.

CN118697758BActive Publication Date: 2025-10-21HEBEI UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202410697406.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-05-31
Publication Date
2025-10-21
Estimated Expiration
2044-05-31

AI Technical Summary

Technical Problem

While existing drugs for treating type I hypersensitivity reactions have achieved some therapeutic effects, they still cannot completely cure the disease, especially since their inhibitory effects on mast cell degranulation and the release of inflammatory mediators are limited.

Method used

Using miR-128-1-5p or its modified sequence as a basis, a drug for treating type I hypersensitivity reactions was prepared. By targeting the EGR3 gene, the AKT and ERK signaling pathways were regulated, thereby inhibiting mast cell degranulation and the release of inflammatory mediators.

Benefits of technology

It effectively inhibits type I hypersensitivity reactions, including allergic asthma, by negatively regulating EGR3 gene expression, reducing the phosphorylation of downstream signaling molecules ERK and AKT of IgE-FcεRI, reducing β-Hex and histamine release, alleviating cell apoptosis, and significantly improving symptoms.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0004870117980000041
    Figure BDA0004870117980000041
  • Figure BDA0004870117980000042
    Figure BDA0004870117980000042
  • Figure BDA0004870117980000051
    Figure BDA0004870117980000051
Patent Text Reader

Abstract

The application belongs to the field of biomedicine and particularly relates to application of miR-128-1-5p in preparation of a drug for treating type I hypersensitivity. The sequence of the miR-128-1-5p is shown as SEQ ID NO. 1. In-vivo and in-vitro experiments show that the miR-128-1-5p can target EGR3 to inhibit cell degranulation, regulate AKT and ERK signal pathways, and play a role in inhibiting type I hypersensitivity.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and in particular relates to the application of miR-128-1-5p. Background Art

[0002] miRNA is a type of microRNA that participates in a variety of physiological activities and can negatively regulate the protein encoding process of its targeted mRNA. Currently, it has attracted the attention of many researchers as a biomarker and targeted drug for diseases, and many miRNAs have entered the clinical trial stage.

[0003] Type I hypersensitivity reaction is a common hypersensitivity reaction. The pathogenesis is mainly due to the binding of IgE to the high-affinity receptor FcεRI on the surface of mast cells, inducing mast cell degranulation and releasing inflammatory mediators, including histamine, proteases tryptase and chymase, proinflammatory lipid mediators, and newly synthesized growth factors, cytokines and chemokines.

[0004] Currently, the commonly used drugs for the treatment of type I hypersensitivity reactions include glucocorticoids, antihistamines, allergic reaction mediator release inhibitors, leukotriene receptor antagonists, and immunosuppressants. However, these drugs can only prevent or ameliorate the symptoms of type I hypersensitivity reactions. In 2004, the targeted therapeutic drug omalizumab was developed for the treatment of severe asthma, targeting the IgE-FcεRI pathway (Maurer M, et al., 2021, Okayama Y, et al., 2020). Subsequently, a variety of drugs, including anti-IgE antibodies, anti-FcεRI antibodies, and IgE molecular analogs, have been developed, targeting IgE (Shamji MH, et al., 2021). Although these drugs have achieved good therapeutic effects, they still cannot completely cure the disease. Summary of the Invention

[0005] The purpose of the present invention is to provide an application of miR-128-1-5p.

[0006] To achieve the above object, the technical solution adopted by the present invention is:

[0007] Use of miR-128-1-5p or a sequence modified based on the nucleotide sequence of miR-128-1-5p in preparing a drug for treating type I hypersensitivity reaction.

[0008] Furthermore, the sequence of the miR-128-1-5p is shown as SEQ ID NO.1.

[0009] Furthermore, overexpression of miR-128-1-5p can inhibit IgE-induced cell morphological changes, reduce the release of β-Hex and histamine, and alleviate cell apoptosis, thereby inhibiting type I hypersensitivity reactions.

[0010] Furthermore, the miR-128-1-5p regulates type I hypersensitivity reaction by targeting the EGR3 gene.

[0011] Furthermore, the miR-128-1-5p inhibits mast cell degranulation by targeting the EGR3 gene and regulates the AKT and ERK signaling pathways, thereby inhibiting type I hypersensitivity reactions.

[0012] Specifically, miR-128-1-5p improves mast cell degranulation levels and reduces the phosphorylation levels of IgE-FcεRI downstream signaling molecules ERK and AKT by negatively regulating EGR3 gene expression, thereby inhibiting type I hypersensitivity reactions.

[0013] Furthermore, the type I hypersensitivity reaction includes allergic asthma, but is not limited to allergic asthma.

[0014] The beneficial effects of the present invention are:

[0015] The present invention used whole-transcriptome analysis to identify miR-128-1-5p and its target gene, EGR3, associated with type I hypersensitivity reactions. In vivo and in vitro experiments demonstrated that miR-128-1-5p could target EGR3 to inhibit cell degranulation and suppress type I hypersensitivity reactions by regulating the AKT and ERK signaling pathways. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 The results of qRT-PCR detection of differentially expressed miRNAs are shown in Figure 2.

[0017] Figure 2 Effects of overexpression / inhibition of miR-128-1-5p on RBL-2H3 cell morphology (bar=100 μm).

[0018] Figure 3 Effects of overexpression / inhibition of miR-128-1-5p on the release of β-Hex (a) and histamine (b) from RBL-2H3 cells. Figure 4 The effect of overexpression / inhibition of miR-128-1-5p on the apoptosis of RBL-2H3 cells (bar=100μm) and the statistics of RBL-2H3 cell apoptosis.

[0019] Figure 5 The overlapping Venn diagram of miR-128-1-5p target genes and DEmRNA (a) and mRNA expression results (b).

[0020] Figure 6 The expression of mRNA after overexpression of miR-128-1-5p.

[0021] Figure 7The effect of overexpression of miR-128-1-5p on EGR3 protein expression.

[0022] Figure 8 is the dual-luciferase reporter gene plasmid sequence.

[0023] Figure 9 The results of dual-luciferase reporter gene analysis.

[0024] Figure 10 The effects of EGR3 knockdown and miR-128-1-5p overexpression on cell morphology (bar = 100 μm).

[0025] Figure 11 Figure 3. The effects of EGR3 knockdown, miR-128-1-5p overexpression, and β-Hex (a) and histamine (b) release from cells.

[0026] Figure 12 Statistics of the effects of EGR3 knockdown, miR-128-1-5p overexpression, and cell apoptosis in RBL-2H3 cells (bar=100 μm).

[0027] Figure 13 This is the effect of overexpression of miR-128-1-5p on p-AKT / AKT and p-ERK / ERK proteins.

[0028] Figure 14 Figure 4 shows the levels of miR-128-1-5p (a) and EGR3 mRNA (b) in lung tissues.

[0029] Figure 15 is the EGR3 protein level in lung tissue. DETAILED DESCRIPTION

[0030] The present invention will be described in further detail below with reference to specific examples. It should be understood that these examples are only for illustrating the present invention and are not intended to limit the scope of the present invention in any way.

[0031] In the following examples, various processes and methods not described in detail are conventional methods well known in the art, and all reagents can be purchased commercially.

[0032] Example 1 Screening of MiRNAs Related to Type I Hypersensitivity

[0033] 1. Experimental Materials

[0034] Rat basophilic leukemia cell line 2H3 (RBL-2H3) was purchased from the Cell Bank of the Chinese Academy of Sciences.

[0035] 2. Experimental Methods

[0036] 2.1 Transcriptome Sequencing

[0037] 2.1.1 Establishment of IgE-induced type I hypersensitivity reaction model

[0038] Take RBL-2H3 cells in logarithmic growth phase and count 1×10 6 Cells were inoculated into 6-well plates, and culture medium was added to 2 mL / well, and the plates were placed in an incubator. A normal group and a model group were set up separately, with 3 replicates in each group. After 24 hours, the old culture medium was removed and the plates were washed 3 times with PBS. 1 mL of 0.4 μg / mL DNP / IgE was added to the model group for sensitization, and an equal amount of culture medium was added to the normal group. After 12 hours, 400 μL of PIPES buffer containing 10 μg / mL DNP / BSA was added to the model group for excitation, and an equal amount of PIPES buffer was added to the normal group. After 1 hour, the excitation was terminated by ice bath for 10 minutes. Total RNA from the cells was extracted using Trizol according to the instructions. Its concentration and quality were detected using an ultra-micro spectrophotometer.

[0039] 2.1.2 Library construction and sequencing

[0040] The TruSeq Small RNA Library Preparation Kit was used to prepare the library fragments, enrich them by PCR amplification, and then quality-check and quantify them. The fragments were then sequenced using the Illumina HiSeq platform using next-generation sequencing technology. Sequencing was performed by Paisono Biotech Co., Ltd.

[0041] 2.1.3 Basic Data Analysis

[0042] After the samples were processed, raw data in FASTQ format was generated. High-quality sequences (clean reads) were obtained through data filtering. Clean reads were aligned and annotated with the reference genome using HISAT2 and miRDeep2 software. Expression levels were normalized using FPKM, and differentially expressed miRNAs and mRNAs were screened based on a fold change (|log2FoldChange|) greater than 1 and a significant P-value < 0.05.

[0043] Using the 3'UTR sequence of rat mRNA as the target sequence, the miranda database was used to predict target genes for differentially expressed miRNAs. Enrichment analysis of the predicted differentially expressed miRNA targets and differentially expressed mRNAs was performed. GO enrichment analysis was performed using topGO, and Kyoto Encyclopedia of Genes and Genomes annotation was performed. The list of annotated genes and the number of genes were calculated for each term. The P-value was then calculated using the hypergeometric distribution method. A P-value < 0.05 was used to identify terms with significant enrichment compared to the overall genomic background, thereby determining the primary biological functions and signaling pathways of the genes.

[0044] 2.2.qRT-PCR

[0045] The sequence of miR-128-1-5p is shown in SEQ ID NO. 1. The stem-loop specific primer used in the reverse transcription process of miR-128-1-5p is designed to be GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTCAGAC, the upstream primer is AATCAATCGGGGCCGTAGCAC, and the downstream primer is AACGCTCACGAATTTGCGT.

[0046] Use a reverse transcription kit to remove genomic DNA and prepare the system shown in Table 1 on ice.

[0047] Table 1 Reaction system for removing genomic DNA

[0048]

[0049] The RNA obtained in the above steps was reverse transcribed, and the reaction system was prepared on ice. The system shown in Table 2 was used to obtain cDNA for mRNA qRT-PCR reaction, and the system shown in Table 3 was used to obtain cDNA for miRNA qRT-PCR reaction.

[0050] Table 2 Reverse transcription reaction system (1)

[0051]

[0052] Set the PCR reaction conditions as follows: 37°C, 15 min; 85°C, 5 sec; place at 4°C, and store at -20°C.

[0053] Table 3 Reverse transcription reaction system (2)

[0054]

[0055] Set the PCR reaction conditions as follows: 37°C, 15 min; 85°C, 5 sec; place at 4°C, and store at -20°C.

[0056] Prepare the qRT-PCR reaction system according to Table 4. Keep the reaction system on ice throughout the process. Mix thoroughly, centrifuge briefly, and place the reaction system in a PCR instrument for reaction.

[0057] Table 4 qRT-PCR reaction system

[0058]

[0059] Reaction conditions were as follows: initial denaturation at 95°C for 30 seconds, PCR reaction at 95°C for 5 seconds, 60°C for 30 seconds, and 72°C for 30 seconds, followed by 55 cycles, and melting analysis at 95°C for 15 seconds, 55°C for 15 seconds, and 95°C for 15 seconds.

[0060] 3. Statistical Analysis

[0061] All experiments were repeated three times and one-way analysis of variance was performed using SPSS 22.0. Multiple sample data were compared pairwise and the results were expressed as mean ± standard deviation. P < 0.05 was considered statistically significant.

[0062] 4. Experimental Results

[0063] The present invention first uses Q20 and Q30 to control the quality of sequencing data to obtain sequencing data with reliable quality. Then, based on the expression difference fold |log2FoldChange|>1 and the expression difference significance P-value<0.05, 5 differentially expressed miRNAs and 297 differentially expressed mRNAs were identified. As shown in Table 5, among the differentially expressed miRNAs, 1 miRNA was upregulated and 4 miRNAs were downregulated, among which miR-128-1-5p had the highest degree of differential downregulation. Among the differentially expressed mRNAs, 169 mRNAs were upregulated and 128 mRNAs were downregulated. Table 6 shows the top 10 mRNAs that were differentially expressed upregulated and downregulated in the IgE-induced group.

[0064] Table 5 Differentially expressed miRNAs in the model group

[0065]

[0066] Table 6 Top 10 differentially expressed up-regulated and down-regulated mRNAs in the model group

[0067]

[0068]

[0069] Note: -Inf=minimum(min); Inf=maximum(max).

[0070] Enrichment analysis revealed that miRNA target genes and mRNAs were enriched in GO terms related to cytokine responses. The most significantly enriched KEGG pathways included the MAKP signaling pathway, the TNF signaling pathway, and the IL-17 signaling pathway. This suggests that type I hypersensitivity is a disease with complex pathogenesis. KEGG analysis revealed that pathways closely related to type I hypersensitivity, such as IL-17, TNF, MAPK, T cell receptor, and cytokine-cytokine receptor interaction, were enriched in the differentially upregulated mRNAs. Therefore, differentially downregulated miRNAs were selected for analysis.

[0071] like Figure 1 The results of qRT-PCR analysis of differentially expressed miRNAs are shown. Among the downregulated miRNAs, miR-128-1-5p was most significantly downregulated. Thus, miR-128-1-5p was identified as a miRNA associated with type I hypersensitivity reactions.

[0072] Example 2 MiR-128-1-5p regulates type I hypersensitivity response in vitro

[0073] In order to evaluate the regulatory function of miR-128-1-5p on type I hypersensitivity reaction, this example studied the regulatory effect of miR-128-1-5p on type I hypersensitivity reaction by detecting cell morphology, β-Hex and histamine release, cell apoptosis and other cell degranulation-related indicators.

[0074] 1. Experimental Materials

[0075] The expression level of miRNA can be regulated by transient transfection of mimics and inhibitors. The present invention first designed and synthesized mimics and inhibitors of miR-128-1-5p as well as negative control sequences of both. After testing, mimics and inhibitors can effectively overexpress or inhibit the expression of miR-128-1-5p in RBL-2H3 cells, and can be used to study the function of miR-128-1-5p. The miR-128-1-5p overexpression sequence mimics and negative control NCmimics, the miR-128-1-5p knockdown sequence inhibitor and negative control NC inhibitor were designed and synthesized by Jima Biotechnology Co., Ltd., and the sequences are shown in Table 7:

[0076] Table 7 Transfection sequence

[0077]

[0078]

[0079] 2. Experimental Procedure

[0080] 2.1 qRT-PCR detection of mimics and inhibitor transfection efficiency

[0081] 2.1.1 Mimics and Inhibitor Transfection

[0082] RBL-2H3 cells in the logarithmic growth phase were obtained and digested with trypsin, and 3×10 5 Seed cells per well in a 6-well plate, add complete MEM medium to 2 mL / well, and incubate at 37°C. Set up a mimic group: transfect with mimics; a mimic negative control group: transfect with NC mimics; an inhibitor group: transfect with the inhibitor; and an inhibitor negative control group: transfect with the NC inhibitor. Set up three replicates for each group.

[0083] Observe cell density before transfection. Transfection was performed when cells reached 60-80% confluence. Refer to the manufacturer's instructions for specific procedures. Aspirate the culture medium 4-6 hours after transfection and replace with complete culture medium. Detect miR-128-1-5p expression 24-72 hours after transfection.

[0084] 2.1.2 qRT-PCR detection of miR-128-1-5p expression

[0085] qRT-PCR was used to measure miR-128-1-5p expression in each group. Cells were trypsinized 36 hours after transfection, and RNA extraction, reverse transcription, and qRT-PCR were performed using the same setup and procedures as above. The results showed that transfection with mimics at a final concentration of 150 nM significantly increased miR-128-1-5p expression by approximately 84-fold, while transfection with an inhibitor at a final concentration of 150 nM reduced miR-128-1-5p expression to approximately 35% of its original level.

[0086] 2.2 Effects of overexpression and inhibition of miR-128-1-5p on IgE-induced RBL-2H3 cell morphology

[0087] RBL-2H3 cell count 5×10 4Cells were seeded / well in a 24-well plate. A blank control group (no transfection, no sensitization challenge) was set up. A model group (no transfection, sensitization challenge) was set up. A mimic group (mimics transfected, sensitization challenge) was set up. A mimic control group (NC mimics transfected, sensitization challenge) was set up. A mimic control group (NC mimics transfected, sensitization challenge) was set up. A inhibitor group (inhibitor transfected, sensitization challenge) was set up. A NC inhibitor control group (NC inhibitor transfected, sensitization challenge) was set up. Each group was set up in triplicate. Transfection was performed 12 hours after plating. 24 hours after transfection, except for the blank control group, sensitization challenge was performed by adding 500 μL of 0.4 μg / mL DNP / IgE to each well. 12 hours later, 200 μL of 10 μg / mL DNP / BSA in PIPES buffer was added for sensitization. After 1 hour, the reaction was terminated by incubating on ice for 10 minutes. 200 μL of neutral red stain was added to each well, incubated at room temperature for 5 minutes, and then rinsed twice with PBS for 1 minute each. The cells were observed and photographed under a microscope.

[0088] 2.3 Effect of miR-128-1-5p overexpression on IgE-induced β-Hex release in RBL-2H3 cells

[0089] Cells were grouped and cultured as described above for sensitization and stimulation. After 1 hour of stimulation, the reaction was terminated by incubating on ice for 10 minutes. The supernatant from each group was collected and lysed with 0.5% Triton X-100 on ice for 10 minutes in the blank control group. This was used as the total enzyme well. After centrifugation at 12,000 rpm and 4°C for 5 minutes, the supernatant was collected. 50 μL of supernatant from each group was added to 50 μL of 1 mM colorimetric solution in a 96-well plate and incubated at 37°C for 1 hour. The reaction was then terminated by adding 200 μL of 0.1 mol / L stop solution to each well. The absorbance at 405 nm was measured in a microplate reader.

[0090] β-Hex (%) = (OD of experimental group - OD of blank control group) / (total enzyme wells - OD of blank control group).

[0091] 2.4 Effect of miR-128-1-5p overexpression on IgE-induced histamine release in RBL-2H3 cells

[0092] Cells were grouped and cultured as described above for sensitization and stimulation. After 1 hour of stimulation, the reaction was terminated by incubating on ice for 10 minutes. The supernatant from each group was centrifuged at 12,000 rpm for 5 minutes at 4°C. The histamine kit was used according to the manufacturer's instructions, and the absorbance was measured at 450 nm in a microplate reader.

[0093] 2.5 Effect of overexpression of miR-128-1-5p on IgE-induced apoptosis in RBL-2H3 cells

[0094] Cells were grouped and cultured as described above for sensitization and stimulation. After 1 hour of stimulation, the reaction was terminated by incubating on ice for 10 minutes. The old culture medium was aspirated, and the cells were washed once with PBS. Following the AO / EB staining kit instructions, the cells were observed under a fluorescence microscope. Both normal and apoptotic cells were counted, and the apoptotic rate was calculated. Apoptosis rate (%) = number of apoptotic cells / total number of cells.

[0095] 3. Data Analysis

[0096] All experimental data are expressed as mean ± SD. Statistical significance was determined by one-way analysis of variance (ANOVA) and T-test using GraphPad Prism version 9.0. Statistical significance was set as * p<0.05, ** p<0.01, *** p<0.001.

[0097] 4. Experimental Results

[0098] like Figure 2 As shown in the figure, neutral red staining revealed intact cells in the blank control group, which were spindle-shaped or fusiform. In the model group, most cells lost their spindle shape and became rounded, even polygonal, with some exhibiting membrane rupture. Overexpression of miR-128-1-5p in the mimics group alleviated this rounding, with most cells adopting a spindle shape, a significant difference from the model group. In the inhibitor group, inhibition of miR-128-1-5p expression resulted in increased rounding and blurred cell edges. There were no significant differences in cell morphology between the mimics and inhibitor control groups and the model group. This suggests that overexpression of miR-128-1-5p can inhibit morphological changes caused by IgE-induced cell degranulation, whereas inhibition of miR-128-1-5p exacerbates these changes.

[0099] like Figure 3 As shown in (a), the β-Hex release rate of cells in the blank control group was significantly different from that in the model group (p<0.001). Overexpression of miR-128-1-5p significantly increased the β-Hex release rate compared with the model group (p<0.001). Inhibition of miR-128-1-5p significantly increased the β-Hex release rate compared with the model group (p<0.01). The β-Hex release rates of the mimic control group and the inhibitor control group were comparable. These results indicate that overexpression of miR-128-1-5p can reduce the IgE-induced β-Hex release rate in RBL-2H3 cells, while inhibition of miR-128-1-5p increases the β-Hex release rate.

[0100] As shown in 3-(b), the histamine release in the model group was significantly higher than that in the blank control group (p<0.001). After overexpression of miR-128-1-5p, the histamine release of cells was significantly lower than that in the model group (p<0.001). After inhibition of miR-128-1-5p expression, the histamine release of cells was significantly higher than that in the model group (p<0.001). There was no significant difference in the histamine release between the mimic control group and the inhibitor control group compared with the model group. The results indicate that overexpression of miR-128-1-5p can reduce IgE-induced histamine release in RBL-2H3 cells, while inhibition of miR-128-1-5p can increase histamine release in cells.

[0101] Normal cells emit green fluorescence, and apoptotic cells emit orange fluorescence. Normal cells and apoptotic cells are counted separately to calculate the apoptosis rate. Figure 4 As shown, the vast majority of cells in the blank control group emitted bright green fluorescence and were spindle-shaped, indicating intact cell membranes. In contrast, the model group showed an increase in apoptotic cells, with swollen and rounded cells, indicating cell membrane damage. The calculated apoptosis rate was significantly higher than that of cells in the blank control group (p < 0.001). Overexpression of miR-128-1-5p significantly reduced the apoptosis rate compared with the model group (p < 0.01). Inhibition of miR-128-1-5p resulted in an increase in the number of cells emitting orange-red fluorescence compared with the model group, and a significantly higher apoptosis rate than the model group (p < 0.01). The apoptosis rates of cells in the mimic and inhibitor control groups were not significantly different from those in the model group. These results indicate that overexpression of miR-128-1-5p can reduce IgE-induced apoptosis, while inhibition of miR-128-1-5p can increase apoptosis.

[0102] The above in vitro experimental results show that miR-128-1-5p can inhibit IgE-induced cell degranulation, thereby regulating type I hypersensitivity reactions.

[0103] Example 3 MiR-128-1-5p targets EGR3 to regulate type I hypersensitivity reaction

[0104] 1. Screening of miR-128-1-5p target genes

[0105] The online databases miranda, targetscan and miRWalk for miRNA target gene prediction were used to search for genes with potential binding ability to miR-128-1-5p, and the intersection of target genes predicted by the three databases and differentially expressed mRNAs in sequencing results was taken.

[0106] 1441 target genes were matched in the miranda database, 1877 target genes were matched in the miRWalk database, and 16730 target genes were matched in the targetscan database. A total of 297 differentially expressed mRNAs were found in the transcriptome sequencing results. After taking the intersection of the four, 5 overlapping genes were found ( Figure 5 -(a)), which are the differentially down-regulated DICER1 and the differentially up-regulated PALM, CPNE5, SIK1, and EGR3. Since miR-128-1-5p was down-regulated in the model group in the sequencing results and subsequent verification, the genes it regulates should be up-regulated in the model group, so 4 differentially up-regulated mRNAs were selected for qRT-PCR verification. The results showed that ( Figure 5 -(b) Except for PALM, which showed no significant difference, the other three proteins showed varying degrees of upregulation, consistent with the sequencing results, with EGR3 showing the highest fold increase. Therefore, CPNE5, SIK1, and EGR3 were selected for further verification of their targeting relationship with miR-128-1-5p.

[0107] 2. qRT-PCR Detection

[0108] After miR-128-1-5p was overexpressed, the intersection mRNA identified above was detected by qRT-PCR: RBL-2H3 cells in the logarithmic growth phase were taken and 3×10 5 Cells were seeded into 6-well plates with 100 cells / well. A mimic group was transfected with mimics, while a negative control group was transfected with NC mimics. Each group was set up in triplicate. Cells were challenged 24 hours after transfection, and total RNA was extracted 1 hour later for reverse transcription and qRT-PCR analysis.

[0109] like Figure 6 As shown, the mRNA expression of CPNE5 and SIK1 did not down-regulate with the change of miR-128-1-5p, while the mRNA expression of EGR3 was significantly down-regulated compared with the negative control group. The preliminary screening of the target gene of miR-128-1-5p was EGR3.

[0110] 3. Western blot detection

[0111] In this example, Western blot was used to detect the EGR3 protein content in the miR-128-1-5p overexpression group and the negative control group. Figure 7 As shown in Figure 3, when miR-128-1-5p was overexpressed, the protein expression of EGR3 was significantly decreased compared with the negative control group, indicating that miR-128-1-5p also had a negative regulatory effect on EGR3 at the protein level.

[0112] The above qRT-PCR and Western blot results showed that EGR3 was closely related to type I hypersensitivity reaction, and EGR3 was likely to have a targeting relationship with miR-128-1-5p.

[0113] 4. Dual Luciferase Assay

[0114] In order to verify whether there is a direct regulatory relationship between miR-128-1-5p and EGR3, dual luciferase reporter gene was used to detect the binding of miRNA and target genes.

[0115] The binding sites of miR-128-1-5p and EGR3 were predicted by Targetscan database, and the wild-type plasmid pmirGLO-EGR3-WT containing the miR-28-1-5p binding site was constructed, and the mutant plasmid pmirGLO-EGR3-MUT ( Figure 8 ). Amplify the wild-type and mutant sequences and connect them to the pmirGLO vector. After transfection of the wild-type and mutant plasmids, the fluorescence intensity was measured. Figure 9 As shown in the figure, after transfection of mimics, the fluorescence intensity of the dual-luciferase reporter gene plasmid containing the wild-type miR-128-1-5p binding site was significantly reduced, indicating that EGR3 can directly bind to miR-128-1-5p.

[0116] The above results indicate that miR-128-1-5p can target the EGR3 gene.

[0117] 5. Effects of EGR3 knockdown and overexpression of miR-128-1-5p on IgE-induced type I hypersensitivity reactions

[0118] Previous experiments have confirmed that miR-128-1-5p can inhibit IgE-mediated cell degranulation. However, since a single miRNA may regulate multiple target genes, this example further examined whether miR-128-1-5p still regulates IgE-mediated cell degranulation by inhibiting or overexpressing it while knocking down EGR3.

[0119] In this example, we used siRNA to knock down EGR3. After extensive exploration of the amount and timing of siRNA and transfection reagent addition, we ultimately selected si-EGR3-4 as the EGR3 siRNA strand. After EGR3 knockdown, we examined the effects of miR-128-1-5p inhibition and overexpression on IgE-induced cell morphology, β-Hex and histamine release, and apoptosis.

[0120] like Figure 10 As shown, after inhibiting EGR3, the si-EGR3 group showed less rounding than the model group, which was significantly different from the model group. The si-EGR3+inhibitor group showed less rounding than the model group, and the cell morphology was similar to that of the si-EGR3 group. The cells in the si-EGR3+mimics group were mostly spindle-shaped, and their morphology was closer to that of the blank control group compared with the si-EGR3 group. There was no significant difference in cell morphology between the negative control group and the model group. This indicates that knocking down EGR3 can alleviate IgE-induced cell morphological changes. On this basis, inhibiting miR-128-1-5p had no significant effect on cell morphology. Overexpression of miR-128-1-5p can further alleviate the degree of cell swelling.

[0121] The results of β-Hex and histamine release from each group of cells are shown in Figure 11 The β-Hex and histamine release in the model group was significantly higher than that in the blank control group. After inhibiting EGR3, the β-Hex and histamine release of the cells was significantly lower than that in the model group. The β-Hex and histamine release in the si-EGR3+inhibitor group was comparable to that in the si-EGR3 group. The β-Hex and histamine release in the si-EGR3+mimics group was less than that in the si-EGR3 group. The β-Hex and histamine release in the negative control group was comparable to that in the model group. The results showed that knocking down EGR3 could reduce the IgE-induced β-Hex and histamine release in RBL-2H3 cells. On this basis, inhibiting miR-128-1-5p had no significant effect on the release of β-Hex and histamine from the cells. Overexpression of miR-128-1-5p could further reduce the release of β-Hex and histamine.

[0122] AO / EB staining was used to detect the apoptosis status of cells. Figure 12As shown. In the blank control group, the vast majority of cells emitted bright green fluorescence and were spindle-shaped, indicating intact cell membranes. In the model group, however, an increase in apoptotic cells occurred, with cells swollen and rounded, indicating cell membrane damage. The apoptosis rate was significantly higher than that of the blank control group (p < 0.001). After EGR3 knockdown, the apoptosis rate was significantly lower than that of the model group (p < 0.01). The apoptosis rate of cells in the si-EGR3+inhibitor group was similar to that of the si-EGR3 group. The apoptosis rate of cells in the si-EGR3+mimics group was significantly lower than that of the model group (p < 0.001) and was lower than that of the si-EGR3 group. There was no significant difference in the apoptosis rate between the negative control group and the model group. These results indicate that EGR3 knockdown can reduce IgE-induced apoptosis in RBL-2H3 cells. Furthermore, inhibition of miR-128-1-5p had no significant effect on the extent of apoptosis. Overexpression of miR-128-1-5p further reduced apoptosis.

[0123] 6. KEGG Analysis

[0124] KEGG was used to analyze the signaling pathways in which EGR3 was involved. The results showed that it was involved in the C-type lectin receptor signaling pathway. The pathway diagram showed that its upstream was the nuclear factor of activating T cell (NFAT), which could directly mediate the expression of EGR3.

[0125] In type I hypersensitivity reactions, AKT can mediate Ca 2+ The release of inflammatory factors can be induced by signal transduction through the MAPK pathway, leading to cell apoptosis. Therefore, this experiment detected the phosphorylation levels of AKT and ERK1 / 2, key signaling molecules in these two pathways. The results showed that ( Figure 13 ), which can increase the phosphorylation of AKT and ERK1 / 2 after inducing type I hypersensitivity reaction, and the phosphorylation levels of AKT and ERK1 / 2 were significantly decreased after overexpression of miR-128-1-5p.

[0126] These results indicate that miR-128-1-5p can target EGR3 to regulate type I hypersensitivity reactions.

[0127] Example 4: Regulation of EGR3 by MiR-128-1-5p in vivo and its therapeutic effect on asthma in mice

[0128] To verify whether miR-128-1-5p can still regulate EGR3 in vivo, this example established an OVA-induced mouse asthma model with reference to previous studies (asthma is a typical type I hypersensitivity reaction, and the increase in IgE is closely related to the occurrence and progression of asthma and is a key indicator for asthma detection). The chemically modified miRNA mimic agomir was used to overexpress miR-128-1-5p in mice, and 11R-VIVIT-TFA was injected intraperitoneally to inhibit EGR3 in vivo. The expression of both in mouse lung tissue was analyzed by qRT-PCR and protein detection.

[0129] like Figure 14 Shown are the results of qRT-PCR analysis of miR-128-1-5p and EGR3 mRNA in lung tissue. In the asthma group, miR-128-1-5p levels were significantly decreased compared to the normal group, but expression was significantly increased after agomir treatment. EGR3 expression was significantly upregulated in the asthma group compared to the normal group, but was significantly downregulated in both the NFAT inhibitor and agomir groups. These results demonstrate that after OVA induction, the expression trends of miR-128-1-5p and EGR3 were consistent with those in cells, and that EGR3 mRNA expression in vivo is also negatively regulated by miR-128-1-5p.

[0130] The expression of EGR3 protein in mouse lung tissue was detected by Western blot. Figure 15 As shown in the results, EGR3 was significantly upregulated in the model group and significantly downregulated after induction by agomir and NFAT inhibitor of miR-128-1-5p, indicating that miR-128-1-5p can inhibit the protein expression of EGR3 in vivo.

[0131] The above qRT-PCR and Western blot test results showed that agomir can effectively overexpress miR-128-1-5p in vivo and negatively regulate EGR3, and overexpression of miR-128-1-5p or inhibition of EGR3 expression in vivo can alleviate asthma symptoms in mice.

[0132] In addition, the inventors observed the behavior of mice, classified and counted cells in BALF, tested lung tissue pathology, and cytokines in serum and BALF. They found that the symptoms of mice in the agomir group, such as nose scratching, itching, body curling, irritability, incontinence, and nodding breathing, were significantly alleviated compared with the asthma group. The total white blood cell count and the number of various types of cells showed a downward trend compared with the asthma group, lung tissue fibrosis was significantly alleviated, and the levels of various cytokines, including IgE, OVA-IgE, IL-4, IL-6, IL-13, and TNF-α, were all lower than those in the asthma group, indicating that miR-128-1-5p has a significant therapeutic effect on mouse asthma.

Claims

1. Use of miR-128-1-5p in the preparation of a drug for treating type I hypersensitivity reaction, characterized in that: The sequence of miR-128-1-5p is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that Overexpression of miR-128-1-5p can inhibit IgE-induced cell morphological changes, reduce the release of β-Hex and histamine, and alleviate cell apoptosis, thereby inhibiting type I hypersensitivity reactions.

3. The use according to claim 1, characterized in that The miR-128-1-5p regulates type I hypersensitivity reaction by targeting the EGR3 gene.

4. The use according to claim 3, characterized in that The miR-128-1-5p inhibits mast cell degranulation by targeting the EGR3 gene and regulates the AKT and ERK signaling pathways, thereby inhibiting type I hypersensitivity reactions.

5. The use according to claim 1, characterized in that Such Type I hypersensitivity reactions include allergic asthma.

Citation Information

Patent Citations

  • Purpose of Rap1b gene

    CN109295199A

  • Screening method and application of miRNA for metabolic remodeling caused by IBDV (Infectious Bursal Disease Virus) infection

    CN118028430A