Application of SRSF1 as a therapeutic target for aortic dissection

Abstract

The present invention discloses the application of SRSF1 as a therapeutic target for aortic dissection, and belongs to the field of biomedical technology. SRSF1 can be used as a target to screen drugs for preventing and / or treating aortic dissection. SRSF1 is upregulated in both BAPN-induced aortic dissection model mice and patients with aortic dissection. Mice with SRSF1 knockdown in vascular smooth muscle cells are not prone to aortic dissection and elastic fiber degradation under BAPN induction. Mice with high expression of SRSF1 in vascular smooth muscle cells are more susceptible to aortic dissection and elastic fiber degradation under BAPN induction. Mechanistically, SRSF1 can regulate the inflammatory phenotype of vascular smooth muscle and promote the degradation of vascular extracellular matrix, and knocking down SRSF1 can improve this phenomenon, providing a new target for the treatment of aortic dissection.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and in particular relates to the application of SRSF1 as a therapeutic target for aortic dissection. Background Art

[0002] Aortic dissection (AD) is a life-threatening cardiovascular disease caused by tearing of the aortic intima or bleeding in the aortic wall, and separation (dissection) of the aortic wall. Aortic dissection develops suddenly, progresses rapidly, and is a serious condition. If not diagnosed and treated in time, it can lead to the patient's death in a short period of time, or blood enters the media to form true and false lumens, leading to ischemia and hypoxia of major distal organs, such as cerebral ischemia causing stroke, renal artery involvement or renal ischemia causing acute renal failure, gastrointestinal ischemia causing intestinal necrosis and stress ulcers / bleeding, etc., with very high mortality or disability rates. However, for this highly lethal and destructive vascular disease, since the pathogenesis is still unclear, there is currently no effective drug to prevent the occurrence of aortic dissection and block the rupture of aortic dissection except for surgical intervention. Surgical treatment is difficult and expensive, and the mortality and disability rates of surgical treatment are high. Therefore, it is very important to actively study its causes and pathological mechanisms and find therapeutic targets for aortic dissection to effectively prevent and treat the disease. Summary of the invention

[0003] In view of this, the purpose of the present invention is to provide an application of SRSF1 as a target in screening drugs for preventing and / or treating aortic dissection, so that the screened drugs can effectively prevent and / or treat aortic dissection, providing a new target for the treatment of aortic dissection.

[0004] Another object of the present invention is to provide a use of a SRSF1 inhibitor in the preparation of a drug for preventing and / or treating aortic dissection.

[0005] Another object of the present invention is to provide a drug for preventing and / or treating aortic dissection.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0007] The present invention provides an application of SRSF1 as a target in screening drugs for preventing and / or treating aortic dissection.

[0008] Preferably, the SRSF1 includes the SRSF1 gene or the SRSF1 protein.

[0009] Preferably, the overexpression of SRSF1 promotes the occurrence of aortic dissection, and the underexpression of SRSF1 inhibits the occurrence of aortic dissection.

[0010] The present invention also provides use of a SRSF1 inhibitor in preparing a medicament for preventing and / or treating aortic dissection.

[0011] Preferably, the inhibitor comprises a SRSF1 gene inhibitor or a SRSF1 protein inhibitor.

[0012] Preferably, the SRSF1 gene inhibitor comprises a nucleic acid molecule, a nucleic acid construct or a lentivirus.

[0013] Preferably, the nucleic acid molecule is shRNA, and the shRNA comprises a sense chain fragment, an antisense chain fragment, and a stem-loop structure connecting the sense chain fragment and the antisense chain fragment; the sequences of the sense chain fragment and the antisense chain fragment are complementary; the sequence of the sense chain fragment comprises any one of SEQ ID NO: 1 to SEQ ID NO: 2, or a sequence complementary to any one of SEQ ID NO: 1 to SEQ ID NO: 2.

[0014] Preferably, the SRSF1 protein inhibitor includes an antibody to the SRSF1 protein, a binding molecule to the SRSF1 protein, or a degrader to the SRSF1 protein.

[0015] The present invention also provides a drug for preventing and / or treating aortic dissection, comprising a pharmaceutically acceptable carrier and a SRSF1 inhibitor.

[0016] Preferably, the inhibitor comprises a SRSF1 gene inhibitor or a SRSF1 protein inhibitor.

[0017] Beneficial effects of the present invention:

[0018] The present invention found that SRSF1 was upregulated in both BAPN-induced aortic dissection model mice and patients with aortic dissection. Mice with SRSF1 knockdown in vascular smooth muscle cells were less likely to suffer from aortic dissection and degradation of elastic fibers under BAPN induction. Mice with high expression of SRSF1 in vascular smooth muscle cells were more susceptible to aortic dissection and degradation of elastic fibers under BAPN induction. Mechanistically, SRSF1 can regulate the inflammatory phenotype of vascular smooth muscle and promote the degradation of vascular extracellular matrix, while knocking down SRSF1 can improve this phenomenon. The present invention uses SRSF1 as a target for screening drugs for the prevention and / or treatment of aortic dissection, so that the screened drugs can effectively prevent and / or treat aortic dissection, providing a new target for the treatment of aortic dissection. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 The expression of SRSF1 in patients with aortic dissection and mice; Figure 1A: mRNA expression of SRSF1 in vascular tissues of patients with aortic dissection and healthy subjects; B: protein expression of SRSF1 in vascular tissues of patients with aortic dissection and healthy subjects; C: immunofluorescence staining of SRSF1 in vascular tissues of patients with aortic dissection and healthy subjects; D: protein expression of SRSF1 in vascular tissues of mouse aortic dissection; E: mRNA expression of SRSF1 in vascular tissues of mouse aortic dissection; F: IHC staining of SRSF1 in vascular tissues of mouse aortic dissection; G: immunofluorescence staining of SRSF1 in vascular tissues of mouse aortic dissection; H: quantitative immunofluorescence staining of SRSF1 in vascular tissues of mouse aortic dissection; Healthy refers to healthy subjects, Dissection refers to patients with aortic dissection, D7, D14, D21, and D28 are the 7th, 14th, 21st, and 28th days of BAPN induction, respectively;

[0020] Figure 2 To investigate the effect of knocking down SRSF1 on the occurrence of aortic dissection; Figure 2 A: Whole-body vascular map of aortic dissection in BAPN-induced control and knockout mice; B: Mouse survival rate; C: Ratio of aortic dissection formation in BAPN-induced control and knockout mice; D: Ratio of different degrees of aortic dissection in whole-body vascular map in BAPN-induced control and knockout mice; E: Ratio of different degrees of aortic dissection in ascending aorta, descending aorta, aortic arch, and abdominal aorta in BAPN-induced control and knockout mice; F: Elastic membrane staining; G: Quantification of Elastic membrane staining;

[0021] Figure 3 To investigate the effects of knocking down SRSF1 on inflammation levels and extracellular matrix degradation; Figure 3 A: mRNA expression of inflammatory factors in control and knockout mice; B: protein expression of inflammatory factors in control and knockout mice; C: quantification of protein expression of inflammatory factors in control and knockout mice; D: mRNA expression of matrix metalloproteinases in control and knockout mice; E: protein expression of matrix metalloproteinases in control and knockout mice; F: quantification of protein expression of matrix metalloproteinases in control and knockout mice;

[0022] Figure 4 The effect of overexpression of SRSF1 on the occurrence of aortic dissection; Figure 4A: Overall vascular map of aortic dissection in BAPN-induced control and overexpressed mice; B: Mouse survival rate; C: Aortic dissection formation ratio in BAPN-induced control and overexpressed mice; D: Ratio of aortic dissection of different degrees in the overall blood vessels in BAPN-induced control and overexpressed mice; E: Ratio of aortic dissection of different degrees in ascending aorta, descending aorta, aortic arch, and abdominal aorta in BAPN-induced control and overexpressed mice; F: Elastic membrane staining and quantification; G: Immunofluorescence staining and quantification of inflammatory factors in control and knockout mice; H: Immunofluorescence staining and quantification of matrix metalloproteinases in control and knockout mice;

[0023] Figure 5 SRSF1 promotes the occurrence of aortic dissection by upregulating FosB; Figure 5 A: Heat map of vascular RNA-seq results of control mice and knockout mice with or without BAPN stimulation; B: The intersection of upregulated or downregulated genes in control mice under BAPN treatment compared with water feeding, and the upregulated or downregulated genes in knockout mice and control mice under BAPN treatment; C: GO enrichment results of genes upregulated in control mice under BAPN treatment compared with water feeding, and downregulated in knockout mice and control mice under BAPN treatment; D: Heat map of inflammatory factors expression in control mice and knockout mice; E: Heat map of extracellular matrix expression in control mice and knockout mice; F: Heat map of matrix metalloproteinase expression in control mice and knockout mice; G: Schematic diagram of SRSF1 regulatory gene screening; H: mRNA expression of AP1 family genes in control mice and knockout mice; I: Protein expression and quantification of FosB in control mice and knockout mice;

[0024] Figure 6 SRSF1 promotes the increase of cellular inflammation levels by upregulating FosB; Figure 6 A: mRNA expression of FosB and matrix metalloproteinases after knockdown of SRSF1; B: protein expression and quantification of FosB and matrix metalloproteinases after knockdown of SRSF1; C: mRNA expression of FosB and matrix metalloproteinases after overexpression of SRSF1; D: protein expression and quantification of FosB and matrix metalloproteinases after overexpression of SRSF1; E: Effect of overexpression of SRSF1 on the expression of FosB and matrix metalloproteinases after knockdown of FosB;

[0025] Figure 7 The effect of SRSF1 inhibitor on aortic dissection; Figure 7A: Binding pattern of Labetalol and SRSF1; B: Labetalol inhibits the binding of SRSF1 and downstream RNA; C: Overall image of blood vessels with aortic dissection in mice treated with inhibitors; D: Mouse mortality rate; E: Elastic membrane staining and quantitative image of mouse blood vessel cross-section; F: Immunofluorescence staining and quantification of inflammatory factors and matrix metalloproteinases in blood vessels with aortic dissection in mice after inhibitor treatment. DETAILED DESCRIPTION

[0026] The present invention provides an application of SRSF1 as a target in screening drugs for preventing and / or treating aortic dissection.

[0027] In the present invention, the SRSF1 includes the SRSF1 gene or the SRSF1 protein. As an implementable embodiment, the human SRSF1 gene sequence number is: Gene ID: 6426; the mouse SRSF1 gene sequence number is: Gene ID: 110809. The SRSF1 gene or protein is upregulated in BAPN-induced aortic dissection model mice and patients with aortic dissection. Mice with SRSF1 knockdown in vascular smooth muscle cells are not prone to aortic dissection and elastic fiber degradation under BAPN induction. Mice with high expression of SRSF1 in vascular smooth muscle cells are more susceptible to aortic dissection and elastic fiber degradation under BAPN induction. Mechanistically, SRSF1 can regulate the inflammatory phenotype of vascular smooth muscle and promote the degradation of vascular extracellular matrix, and knocking down SRSF1 can improve this phenomenon, which provides a new target for the treatment of aortic dissection.

[0028] In the present invention, as an implementable method, by detecting the effect of the drug on the expression level of SRSF1, a drug capable of preventing and / or treating aortic dissection is screened; if the drug can reduce the expression level of SRSF1 gene or protein, it has the effect of preventing and / or treating aortic dissection.

[0029] The present invention also provides use of a SRSF1 inhibitor in preparing a medicament for preventing and / or treating aortic dissection.

[0030] In the present invention, the inhibitor includes an SRSF1 gene inhibitor or an SRSF1 protein inhibitor. The SRSF1 gene inhibitor includes a nucleic acid molecule, a nucleic acid construct or a lentivirus. The nucleic acid molecule includes an SRSF1 gene-specific siRNA, an SRSF1 gene-specific shRNA, an SRSF1 gene-specific microRNA, a nucleic acid molecule that inhibits the SRSF1 gene promoter, and the like. As an optional embodiment, the shRNA includes a sense chain fragment, an antisense chain fragment, and a stem-loop structure (loop sequence) connecting the sense chain fragment and the antisense chain fragment; the sequences of the sense chain fragment and the antisense chain fragment are complementary; the sequence of the sense chain fragment includes any one of SEQ ID NO: 1 to SEQ ID NO: 2, or a sequence complementary to any one of SEQ ID NO: 1 to SEQ ID NO: 2. The present invention does not specifically limit the sequence of the stem-loop structure, and it can be conventionally selected according to actual needs. The nucleic acid construct is a gene fragment containing the above-mentioned nucleic acid molecule, which can express the above-mentioned nucleic acid molecule. The lentivirus is formed by viral packaging of the above-mentioned nucleic acid construct with the assistance of a lentiviral packaging plasmid and a cell line. The SRSF1 protein inhibitor includes an antibody to the SRSF1 protein, a binding molecule to the SRSF1 protein, or a degrader to the SRSF1 protein, etc. As an optional embodiment, the SRSF1 protein inhibitor includes Labetalol, Betaxolol, etc.; the Labetalol or Betaxolol inhibits the binding of the SRSF1 protein to the downstream RNA by binding to the SRSF1 protein.

[0031] The present invention also provides a drug for preventing and / or treating aortic dissection, comprising a pharmaceutically acceptable carrier and a SRSF1 inhibitor.

[0032] In the present invention, the pharmaceutically acceptable carrier includes, but is not limited to, water, saline, buffer, glycerol, ethanol, liposomes, lipids, proteins, protein-antibody conjugates, peptides, cellulose, nanogels, or combinations thereof. The choice of carrier should match the dosage form of the drug. The SRSF1 inhibitor includes an SRSF1 gene inhibitor or an SRSF1 protein inhibitor. The SRSF1 gene inhibitor includes a nucleic acid molecule, a nucleic acid construct, or a lentivirus. The nucleic acid molecule includes an SRSF1 gene-specific siRNA, an SRSF1 gene-specific shRNA, an SRSF1 gene-specific microRNA, a nucleic acid molecule that inhibits the SRSF1 gene promoter, and the like. As an optional embodiment, the shRNA comprises a sense chain fragment, an antisense chain fragment, and a stem-loop structure (loop sequence) connecting the sense chain fragment and the antisense chain fragment; the sequences of the sense chain fragment and the antisense chain fragment are complementary; the sequence of the sense chain fragment comprises any one of SEQ ID NO: 1 to SEQ ID NO: 2, or a sequence complementary to any one of SEQ ID NO: 1 to SEQ ID NO: 2. The present invention does not specifically limit the sequence of the stem-loop structure, and it can be conventionally selected according to actual needs. The nucleic acid construct is a gene fragment containing the above-mentioned nucleic acid molecule, which can express the nucleic acid molecule. The lentivirus is formed by viral packaging of the above-mentioned nucleic acid construct with the assistance of lentiviral packaging plasmids and cell lines. The SRSF1 protein inhibitor includes antibodies to SRSF1 protein, binding molecules to SRSF1 protein, or degraders of SRSF1 protein, etc. As an optional embodiment, the SRSF1 protein inhibitor includes Labetalol, Betaxolol, etc.; Labetalol or Betaxolol inhibits the binding of SRSF1 protein to downstream protein RNA by binding to SRSF1 protein. The present invention does not specifically limit the dosage form of the drug, and can be an injection, oral preparation (tablets, capsules, oral liquid), transdermal agent, sustained release agent, etc. The present invention does not specifically limit the mode of administration, and injection, oral administration, application, etc. can be conventionally selected according to the dosage form of the drug and actual needs.

[0033] In the present invention, as an implementable embodiment, the method for treating aortic dissection includes achieving the treatment of aortic dissection by reducing the expression level of SRSF1 gene or protein; the method for reducing the expression level of SRSF1 gene or protein includes using gene knockout technology to specifically knock down SRSF1 and using drugs containing SRSF1 gene or protein inhibitors.

[0034] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0035] In the following embodiments, unless otherwise specified, all of them are conventional methods.

[0036] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0037] Example 1

[0038] (1) Determination of SRSF1 expression level in patients with aortic dissection

[0039] Aortic tissues of 10 patients with aortic dissection and 10 healthy subjects were collected to detect the SRSF1 mRNA and protein levels in aortic tissues. Figure 1 As shown in A and B; immunofluorescence staining of SRSF1 in aortic tissues of patients with aortic dissection and healthy subjects was performed, and the results were as follows Figure 1 As shown in C. It can be seen that compared with healthy people, SRSF1 mRNA and protein levels are upregulated in patients with aortic dissection, and the results of immunofluorescence staining show that the fluorescence expression of SRSF1 is upregulated in patients with aortic dissection.

[0040] (2) Determination of SRSF1 expression level in mice with aortic dissection

[0041] Establishment of aortic dissection mouse model: 40 3-week-old wild-type C57 mice were selected, and 0.5% β-aminopropionitrile (BAPN) was added to the drinking water (i.e., 0.5 g BAPN was added to 100 mL water), and BAPN drinking water was fed for 4 weeks. 3-week-old wild-type C57 mice (10 mice) that were fed without BAPN drinking water for 4 weeks were used as the control group (Control group).

[0042] Ten mice were killed on the 7th, 14th, 21st, and 28th day after the start of BAPN drinking water feeding. The whole aortic tissue was taken, and part of it was fixed to make aortic sections, and the expression of SRSF1 protein was detected by immunofluorescence staining. After the remaining aortic tissue was quickly frozen in liquid nitrogen, part of it was used to extract RNA, and QPCR was used to detect the mRNA expression of SRSF1; part of it was used to extract protein, and Western Blot was used to detect the expression of SRSF1 protein. The results are shown in Figure 1 As shown in DH. It can be seen that the mRNA and protein levels of SRSF1 are upregulated during the formation of aortic dissection in mice ( Figure 1 D, E). Immunohistochemistry and immunofluorescence results showed that the fluorescence expression of SRSF1 was upregulated in ascending aortic dissection ( Figure 1 (in FH).

[0043] Example 2

[0044] (1) Construction of smooth muscle cell-specific SRSF1 knockdown mouse Srsf1 f / f ;SM22 Cre-ERT2 :Insert LoxP sites at both ends of the exon of SRSF1 to obtain loxP-exons-loxP mice (SRSF1 flox / flox Homozygous mice); SRSF1 flox / flox Homozygous mice and SM22-cre ERT2 After genotyping, the offspring obtained by crossbreeding mice were found to have the exon sequence of SRSF1 in smooth muscle cells deleted under the induction of tamoxifen, so that SRSF1 protein was knocked out only in smooth muscle cells, and Srsf1 was obtained. f / f ;SM22 Cre-ERT2 Mouse.

[0045] (2) Experimental grouping: 31 3-week-old Srsf1 f / f ;SM22 Cre-ERT2 Mice and littermates 34 Srsf1 f / f Mice were given BAPN (concentration 0.5%) in drinking water at 3 weeks of age for 4 weeks and recorded as BAPN+Srsf1 f / f ;SM22 Cre-ERT2 group and BAPN+Srsf1 f / f Group: 15 Srsf1 f / f ;SM22 Cre-ERT2 Mice and littermates of 15 Srsf1 f / f Mice were given drinking water without BAPN at 3 weeks of age for 4 weeks and recorded as Srsf1 f / f ;SM22 Cre-ERT2 group and Srsf1 f / f Group.

[0046] (3) Experimental determination:

[0047] On the 28th day of induction, the whole aorta tissues of the four groups of mice were taken and photographed under a stereomicroscope to compare the changes in aortic vascular morphology and the severity of dissection. Figure 2 As shown in A. It can be seen that BAPN induces Srsf1 f / f Mice showed congestion in the vascular wall at different locations in the aorta, and mice with SRSF1 knockout specifically in smooth muscle cells showed f / f SM22α Cre-ERT2 Can improve this phenomenon.

[0048] The mortality of mice in each group was counted. Figure 2As shown in B. As can be seen, compared with BAPN-induced non-knockout mice (BAPN+Srsf1 f / f ) compared with BAPN-induced knockout mice (BAPN+Srsf1 f / f ;SM22 Cre-ERT2 ) showed a decrease in mortality.

[0049] The dissection was performed on the 28th day after induction, and the rates of different degrees of aortic dissection in the ascending aorta, descending aorta, aortic arch, abdominal aorta, and all aortic segments of BAPN-induced non-knockout mice and knockout mice were recorded. Figure 2 As shown in CE. It can be seen that compared with non-knockout mice, SRSF1 knockout inhibited the rate of BAPN-induced acute aortic dissection (AAD) and vascular rupture, and was able to inhibit the formation of aortic dissection in mice.

[0050] On the 28th day of induction, the ascending aortas of the four groups of mice were fixed, embedded in paraffin and sliced, and HE and EVG staining were performed to compare whether there were any differences in the rupture of vascular elastic fibers. The results are as follows: Figure 2 As shown in FG. It can be seen that compared with non-knockout mice, BAPN-induced knockout mice (BAPN+Srsf1 f / f ;SM22 Cre-ERT2 )The degradation of extracellular elastic fibers was significantly reduced.

[0051] Example 3

[0052] The inflammation levels and extracellular matrix degradation of the four groups of mice were measured on the 28th day after BAPN induction in Example 2.

[0053] The aortic tissues of mice in each group were taken out and quickly frozen by liquid nitrogen to detect the mRNA and protein levels of inflammatory factors (IL-1β, IL-6, TNF-α, MCP-1, IL-8, Cxcl1, Cxcl2, IL-23A, IL-12A, TLR2, TLR4, TLR9) and matrix metalloproteinases (MMP2, MMP3, MMP8, MMP9, MMP12). The results are shown in Figure 3 As shown. It can be seen that BAPN induction can significantly increase the mRNA and protein expression of inflammatory factors, while SRSF1 knockout inhibits the increase in the expression level of inflammatory factors induced by BAPN, and reduces the mRNA / protein level of inflammatory factors; BAPN induction can increase the mRNA and protein expression of extracellular matrix metalloproteinases, while SRSF1 knockout inhibits the increase in the expression level of extracellular matrix metalloproteinases induced by BAPN.

[0054] Example 4

[0055] (1) Construction of SRSF1 overexpression mice: In order to verify the effect of SRSF1 on aortic dissection in vivo, SRSF1 overexpression mice were constructed. Adeno-associated virus (AAV-Srsf1-GFP) overexpressing SRSF1 was purchased from Vital River Pharmaceuticals. Three-week-old wild-type C57 mice (WT) were selected and injected with 10% SRSF1 overexpression adeno-associated virus (AAV-Srsf1-GFP) through the tail vein. 12 vg / mouse, and obtained SRSF1 overexpression mice.

[0056] (2) Experimental groups: 30 mice overexpressing SRSF1 were selected and fed with BAPN (concentration of 0.5%) in drinking water for 4 weeks, which was recorded as the BAPN+AAV-Srsf1-GFP group. 31 mice of the same species and age were injected with the same dose of adeno-associated virus (AAV-GFP) without SRSF1 overexpression as control and fed with BAPN (concentration of 0.5%) in drinking water for 4 weeks, which was recorded as the BAPN+AAV-GFP group.

[0057] (3) Experimental determination:

[0058] On the 28th day of induction, the whole aorta tissues of the two groups of mice were taken and photographed under a stereomicroscope to compare the changes in aortic vascular morphology and the severity of dissection. Figure 4 As shown in middle A. It can be seen that SRSF1 overexpressing mice exhibit more severe aortic dissection.

[0059] The death of mice in the two groups was counted, and the results were as follows Figure 4 As shown in B. It can be seen that the mortality rate of SRSF1 overexpressing mice was significantly increased.

[0060] The mice were killed on the 28th day after induction, and the aorta was dissected and isolated for observation. The formation rates of different degrees of aortic dissection in the ascending aorta, descending aorta, aortic arch, abdominal aorta and all aortic segments of BAPN-induced overexpression mice (BAPN+AAV-Srsf1-GFP) and control mice (BAPN+AAV-GFP) were recorded. The results are shown in Figure 4 As shown in C-E, it can be seen that SRSF1 overexpressing mice showed a more obvious increase in dissection.

[0061] On the 28th day of induction, the ascending aortas of the two groups of mice were fixed, embedded in paraffin and sectioned, and HE and EVG staining were performed to compare whether there were any differences in the rupture of vascular elastic fibers. The results are as follows: Figure 4 As shown in F, it can be seen that the degradation of extracellular elastic fibers in SRSF1-overexpressing mice was significantly increased.

[0062] Subsequently, the aortic tissues of the two groups of mice were taken out and the mRNA and protein levels of inflammatory factors and matrix metalloproteinases were detected by immunofluorescence staining. Figure 4 As shown in Figure GH, it can be seen that SRSF1 overexpression mice have increased vascular inflammation and increased expression of extracellular matrix metalloproteinases.

[0063] Example 5

[0064] In order to study the mechanism of SRSF1 regulating aortic dissection formation, the four groups of experimental mice in Example 2 were taken, and the mouse aortic tissues were dissected, and RNA was extracted and high-throughput sequencing was performed. The results are as follows Figure 5 As shown in A. Searching for downstream target genes of SRSF1, the results are as follows Figure 5 As shown in B. It can be seen that Srsf1 f / f There are 222 genes that are upregulated in mice treated with BAPN compared to water-fed mice, and downregulated in knockout mice and control mice treated with BAPN. The KEGG method was used to enrich the pathways of differentially expressed genes. The results are as follows Figure 5 As shown in C. It can be seen that the inflammatory pathway is widely enriched. Gene expression heat maps of inflammatory factors, extracellular matrix, and matrix metalloproteinases of the four groups of mice were drawn separately. The results are shown in Figure 5 As shown in Figure DF. It can be seen that under BAPN treatment, extracellular matrix proteins, inflammatory factors and matrix metalloproteinases in knockout mice were downregulated compared with control mice. f / f ;SM22 Cre-ERT2 The mRNA and FosB protein expression levels of AP1 family genes in aorta tissue of mice and control mice were as follows Figure 5 As shown in the middle HI, it can be seen that some genes of the AP1 family are changed in the knockout mice, and the FosB mRNA and protein levels are downregulated.

[0065] Example 6

[0066] To verify whether SRSF1 regulates inflammation of smooth muscle cells through FosB, aortic smooth muscle cells (HASMC) with knockdown and overexpression of SRSF1 were constructed.

[0067] SRSF1 was knocked down in aortic smooth muscle cells (HASMC) using SRSF1-shRNA. The specific process was as follows: two shRNAs were designed targeting the coding region of SRSF1 to specifically knock down the expression level of SRSF1, namely SRSF1-sh1 and SRSF1-sh2, and the sequences were: the positive chain fragment of SRSF1-sh1 was CGGAAAGAAGATATGACGTAT (SEQ ID NO: 1), the antisense chain fragment was ATACGTCATATCTTCTTTCCG (SEQ ID NO: 3), and the stem-loop structure was CTCGAG; the positive chain fragment of SRSF1-sh2 was TATCTGAAGAGATGGATTAAG (SEQ ID NO: 2), the antisense chain fragment was CTTAATCCATCTCTTCAGATA (SEQ ID NO: 4), and the stem-loop structure was CTCGAG. The two shRNAs were connected to the pLKO.1 vector to obtain the SRSF1 gene interference vectors pLKO-SRSF-sh1 and pLKO-SRSF-sh2; the gene interference vectors were transfected into 293 cells together with the packaging plasmid (psPAX2 lentiviral packaging plasmid (with plasmid pMD2G)), and the culture medium was collected 48 hours later, which were sh1RNA virus and sh2RNA virus; the sh1RNA virus and sh2RNA virus were added to aortic smooth muscle cells (HASMC), and the medium was changed after 48 hours, which were aortic smooth muscle cells (HASMC) with SRSF1 knockdown, recorded as SRSF1 sh1 and SRSF1 sh2. Normal HASMC cells (NT) were used as controls.

[0068] Ad-SRSF1 was used to overexpress SRSF1 in aortic smooth muscle cells (HASMC), and the specific process was as follows: Ad-SRSF1 was added to the cultured smooth muscle cells at a titer of 100 MOI, which was recorded as Ad-SRSF1. Ad-GEP was added to the cultured smooth muscle cells at the same titer as a control, which was recorded as Ad-GEP.

[0069] IL-1β was added to the culture medium of NT, SRSF1 sh1, SRSF1 sh2, Ad-SRSF1 and Ad-GEP cells to simulate aortic dissection in the cells, and NT and Ad-GEP without IL-1β were used as controls. The expression of FosB and MMP2 / MMP9 mRNA and protein in each group of cells was detected. The results are shown in Figure 6 As shown in Figure 4A-D. It can be seen that the addition of IL-1β upregulated the mRNA and protein expression levels of FosB, MMP2, and MMP9; SRSF1 knockdown could inhibit the upregulation of FosB, MMP2, and MMP9 expression ( Figure 6A, B), overexpression of SRSF1 can further promote the upregulation of FosB, MMP2 and MMP9 expression ( Figure 6 (C, D).

[0070] Knockdown of FosB in HASMC cells overexpressing SRSF1 (Ad-SRSF1) using shRNA: Two shRNAs were designed for the coding region of FosB to specifically knockdown the expression level of FosB in Ad-SRSF1 cells, namely FosB-sh1 and FosB-sh2, with sequences as follows: FosB-sh1 sense chain fragment is AGGTCACGTTGGCCCTCAA (SEQ ID NO: 5), antisense chain fragment is TTGAGGGCCAACGTGACCT (SEQ ID NO: 6), and stem-loop structure is CTCGAG; FosB-sh2 sense chain fragment is GAGGAAGAGGAGAAGCGAA (SEQ ID NO: 7), and antisense chain fragment is TTCGCTTCTCCTCTTCCTC (SEQ ID NO: 8), and stem-loop structure is CTCGAG. HASMC cells overexpressing SRSF1 with knockdown of FosB were constructed and recorded as FosB sh1+Ad-SRSF1 and FosB sh2+Ad-SRSF1. Ad-GFP without knockdown of FosB was used as a control and was denoted as NT+Ad-GFP.

[0071] IL-1β was added to the culture medium of NT+Ad-GFP, FosB sh1+Ad-SRSF1 and FosB sh2+Ad-SRSF1 cells, respectively, and NT+Ad-GFP without IL-1β was used as a control. The effect of overexpressing SRSF1 after knocking down FosB on the expression of FosB and matrix metalloproteinases was detected. Figure 6 As shown in E. It can be seen that knockdown of FosB inhibits the expression of MMPs induced by SRSF1.

[0072] It was concluded that SRSF1 promoted inflammation in smooth muscle cells through FosB.

[0073] Example 7

[0074] (1) Experimental groups: Fifteen 3-week-old wild-type C57 mice were intraperitoneally injected with 5 mg / kg / d of labetalol (MCE, HY-121383), an inhibitor of SRSF1, and fed with drinking water for 4 weeks, designated as the labetalol group; 15 mice of the same species and age were given the same dose of normal saline in the same manner as the control group and fed with drinking water for 4 weeks, designated as the saline group; 30 mice of the same species and age were given the same dose of labetalol in the same manner and fed with BAPN (concentration of 0.5%) with drinking water for 4 weeks, designated as the BAPN+labetalol group; 29 mice of the same species and age were given the same dose of normal saline in the same manner and fed with BAPN (concentration of 0.5%) with drinking water for 4 weeks, designated as the BAPN+saline group.

[0075] (2) Experimental determination:

[0076] The molecular docking method was used to obtain the binding pattern of Labetalol and SRSF1. The results are as follows Figure 7 As shown in A. It can be seen that the amino acid residues in the RRM region of SRSF1 are covalently bound to Labetalol.

[0077] The same method as in Example 6 was used to overexpress SRSF1 in smooth muscle cells to obtain Ad-SRSF1, and Ad-GFP was used as a control. 10 μmol Labetalol was added to the Ad-SRSF1 culture medium, and no Labetalol was added as a control (Vehicle). The RNA pull-down method was used to detect the binding of SRSF1 and RNA. The results are shown in Figure 2. Figure 7 As shown in B, it can be seen that labetalol can inhibit the binding of SRSF1 and downstream RNA.

[0078] On the 28th day of induction, the whole aorta tissues of the four groups of mice were taken and photographed under a stereomicroscope to compare the changes in aortic vascular morphology and the severity of dissection. Figure 7 As shown in C. It can be seen that under BAPN induction, the aortic dissection formation of mice injected with SRSF1 inhibitor was reduced.

[0079] The death of mice in the four groups was counted, and the results were as follows Figure 7 As shown in D, it can be seen that under BAPN induction, the mortality rate of mice injected with SRSF1 inhibitor was reduced compared with that of control mice.

[0080] On the 28th day of induction, the ascending aortas of the four groups of mice were fixed, embedded in paraffin and sliced, and HE and EVG staining were performed to compare whether there were any differences in the rupture of vascular elastic fibers. The results are as follows: Figure 7 As shown in E. It can be seen that under BAPN induction, the degradation of extracellular elastic fibers in mice injected with SRSF1 inhibitors was reduced compared with that in control mice.

[0081] On the 28th day of induction, the mRNA and protein levels of inflammatory factors and extracellular matrix proteases in the aorta tissues of the four groups of mice were measured. Figure 7 As shown in F. It can be seen that under BAPN induction, the mRNA and protein levels of inflammatory factors and extracellular matrix proteases in mice injected with SRSF1 inhibitors were reduced compared with those in control mice.

[0082] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Application of SRSF1 as a target in screening drugs for preventing aortic dissection.

2. The use according to claim 1, characterized in that: The SRSF1 includes the SRSF1 gene or the SRSF1 protein.

3. The use according to claim 1, characterized in that: The overexpression of SRSF1 promotes the occurrence of aortic dissection, and the low expression of SRSF1 inhibits the occurrence of aortic dissection.

4. Use of a SRSF1 inhibitor in the preparation of a drug for preventing aortic dissection, characterized in that: The SRSF1 inhibitor includes a nucleic acid molecule, a nucleic acid construct or a lentivirus; The nucleic acid molecule is shRNA, and the shRNA comprises a sense strand segment, an antisense strand segment, and a stem-loop structure connecting the sense strand segment and the antisense strand segment; the sequences of the sense strand segment and the antisense strand segment are complementary; the sequence of the sense strand segment comprises any one of SEQ ID NO: 1 to SEQ ID NO: 2, or a sequence complementary to any one of SEQ ID NO: 1 to SEQ ID NO: 2; The nucleic acid construct is a gene fragment containing the coding nucleic acid molecule and can express the nucleic acid molecule; The lentivirus is formed by viral packaging of the nucleic acid construct with the assistance of a lentivirus packaging plasmid and a cell line.

5. A drug for preventing aortic dissection, characterized in that: It comprises a pharmaceutically acceptable carrier and a SRSF1 inhibitor; the SRSF1 inhibitor comprises a nucleic acid molecule, a nucleic acid construct or a lentivirus; The nucleic acid molecule is shRNA, and the shRNA comprises a sense strand segment, an antisense strand segment, and a stem-loop structure connecting the sense strand segment and the antisense strand segment; the sequences of the sense strand segment and the antisense strand segment are complementary; the sequence of the sense strand segment comprises any one of SEQ ID NO: 1 to SEQ ID NO: 2, or a sequence complementary to any one of SEQ ID NO: 1 to SEQ ID NO: 2; The nucleic acid construct is a gene fragment containing the coding nucleic acid molecule and can express the nucleic acid molecule; The lentivirus is formed by viral packaging of the nucleic acid construct with the assistance of a lentivirus packaging plasmid and a cell line.

Images