A Gramineae PACMAD group HB gene and its use in increasing crop yield and resisting high temperature

By screening and applying the HB gene unique to the PACMAD group of the Grape family, the yield and stress resistance of Grape family plants in high temperature environments are solved, and the yield increase and resistance of crops in high temperature environments are achieved.

CN118703507BActive Publication Date: 2025-08-15INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI
View PDF 1 Cites -1 Cited by

Patent Information

Application Number
CN202410648111.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-05-23
Publication Date
2025-08-15
Estimated Expiration
2044-05-23

AI Technical Summary

Technical Problem

In the prior art, the yield and stress resistance of grass plants in high temperature environments are affected, especially the correlation between the HB gene of PACMAD group plants and their high temperature resistance or yield has not been reported.

Method used

The HB gene unique to the PACMAD group of the Grape family was screened and used to construct recombinant vectors and engineered bacteria through directed evolution and point mutation methods, overexpress or knock out the gene in crops to improve their viability and yield in high temperature environments.

Benefits of technology

Overexpression of HB gene in rice, corn and Arabidopsis significantly improved yield and improved high-temperature resistance. Knockout of HB genes reduced the growth and development effect in corn.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118703507B_ABST
    Figure CN118703507B_ABST
Patent Text Reader

Abstract

The present invention discloses an HB gene from the PACMAD group of the Poaceae family and its use in increasing crop yield and resisting high temperatures, belonging to the field of genetic engineering technology. This HB gene is a conserved gene that evolved through selection in the ancestors of the PACMAD group during a high-temperature era 49 million years ago. It originates from plants in the subfamily Trigonoidea, Arundoideae, Trichodermaideae, Platycodonoideae, Chlorophyceae, and Panicoidea, which are also included in the PACMAD group. The present invention screened and obtained HB genes unique to the PACMAD group of the Poaceae family. Since plants compete for light resources in high-temperature tropical environments by increasing plant height and biomass, the HB genes that evolved through selection in the ancestors during the Earth's high-temperature era can further enhance the plant's photosynthetic capacity, carbon and nitrogen utilization efficiency, and high-temperature tolerance, thereby helping to increase crop yields.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and in particular relates to a PACMAD group HB gene of the Poaceae family and its use in increasing crop yield and resisting high temperatures. Background Art

[0002] The Poaceae family, a monocotyledonous plant family within the order Graminales, encompasses approximately 10,000 species, distributed worldwide. Cereals in the Poaceae family are the world's most important crops. However, global warming threatens crop yields and food security. In temperate and subtropical regions, high temperatures have become a major climatic factor affecting rice production. Research by Peng et al. shows that every 1°C increase in average temperature can reduce rice yield by 10%. Frequent extreme weather events deteriorate the rice growing environment, disrupting the rice source-sink relationship and negatively impacting yield. Therefore, ensuring the yield of Poaceae plants in high-temperature environments is crucial for food security.

[0003] Under the current classification system, the 12 subfamilies within the Poaceae family are generally divided into three groups: the basal group, the BOP group, and the PACMAD group. The basal group includes three subfamilies: Anomochlooideae, Pharoideae, and Puelieae; the BOP group includes Oryzoideae, Bambusoideae, and Pooideae; and the PACMAD group includes Aristidoideae, Arundiaceae, Micrairoideae, Danthonioideae, Chloridoideae, and Panicoideae.

[0004] Both the BOP and PACMAD clades evolved from basal groups, but PACMAD evolved under the selective pressure of high temperatures, diverging from the BOP. Analysis of the climatic characteristics of the modern distribution of each subfamily of the Poaceae family aligns with evolutionary patterns. BOP groups, represented by crops like rice and wheat, tend to be distributed in cooler regions, while PACMAD groups, represented by crops like maize, sorghum, and millet, tend to be distributed in hotter and wetter regions.

[0005] We found that the genes selected by the PACMAD group during its evolution to adapt to tropical environments differ from those selected by the BOP group, and that the former may obtain more light energy by promoting growth and other means to establish the ecological advantage of plants in tropical environments. However, there are currently no reports on the association between the HB gene in the PACMAD group and the high temperature tolerance or yield of grass plants. Summary of the Invention

[0006] In view of the above-mentioned deficiencies in the prior art, the present invention provides a PACMAD group HB gene of the Poaceae family and its use in increasing crop yield and high temperature resistance, so as to increase crop yield and improve its stress resistance in high temperature environments.

[0007] To achieve the above-mentioned purpose, the technical solution adopted by the present invention to solve the technical problem is:

[0008] An HB gene unique to the PACMAD group of the Poaceae family, which was selected and evolved by the ancestors of the PACMAD group during the high temperature period of the Earth 49 million years ago.

[0009] Furthermore, the HB gene comes from the PACMAD group, which includes the subfamily Trigonoides, Arundoideae, Trichodermaideae, Platycodonoideae, Chlorophyteoideae and Panicoideae.

[0010] Furthermore, HB genes include but are not limited to (species name / gene name):

[0011] Pearl millet Cenchrus_americanus / Pgl_GLEAN_10021578,

[0012] Pearl millet Cenchrus_americanus / Pgl_GLEAN_10021577,

[0013] Cleistogenes songorica / CsA702234.1,

[0014] Cleistogenes songorica / CsA702236.1,

[0015] Coix_lacryma-jobi / Cl032106_T1,

[0016] Crabgrass Digitaria_exilis / De010331g0300.1,

[0017] Crabgrass Digitaria_exilis / De011001g0189.1,

[0018] Echinochloa crus-galli / AH05.717.mRNA1,

[0019] Echinochloa crus-galli / BH05.779.mRNA1,

[0020] Echinochloa_oryzicola / BT05.1099.mRNA1,

[0021] Eragrostis curvula / transcript:TVU18330,

[0022] Eremochloa_ophiuroides / evm.model.ctg494.81,Eremochloa_ophiuroides / evm.model.ctg494.82,Erianthu s_rufipilus / Eru01G003650.t1,Erianthus_rufipilus / Eru07G006240.t1,Erianthus_rufipilus / Eru07G006241.t1,

[0023] Miscanthus_lutarioriparius / rna-NCGR_LOCUS3508,

[0024] Miscanthus_lutarioriparius / rna-NCGR_LOCUS9015,

[0025] Miscanthus_lutarioriparius / rna-NCGR_LOCUS9016,

[0026] Miscanthus_lutarioriparius / rna-NCGR_LOCUS56537,

[0027] Miscanthus_lutarioriparius / rna-NCGR_LOCUS56538,

[0028] Miscanthus lutarioriparius / rna-NCGR_LOCUS59015, Miscanthus lutarioriparius / rna-NCGR_LOCUS59016, Oropetium thomaeum / Oropetium_20150105_27740A.v1.0,

[0029] Oryza brachyantha / rna-XM_015836963.2, Oryza longistaminata / transcript:KN538901.1_FGT001, Panicum hallii / rna-XM_025949443.1, Panicum hallii / rna-XM_025950752.1,

[0030] Panicum miliaceum / transcript:longmi025112_T1,

[0031] Panicum miliaceum / transcript:longmi028927_T1,

[0032] Panicum miliaceum / transcript:longmi028928_T1,

[0033] Panicum virgatum / rna-XM_039980348.1,

[0034] Panicum virgatum / rna-XM_039980349.1,

[0035] Panicum virgatum / rna-XM_039942950.1,

[0036] Panicum virgatum / rna-XM_039942949.1,

[0037] Panicum virgatum / rna-XM_039942948.1,

[0038] Paspalum vaginatum / Pavag09G010600.1.v3.1,

[0039] Paspalum_vaginatum / Pavag09G010700.1.v3.1,

[0040] Phragmites australis / Pau_c03263_0020.mRNA1,

[0041] Phragmites australis / Pau_c03464_0020.mRNA1,

[0042] Saccharum_spontaneum / Sspon.01G0022450-1A-mRNA-1,

[0043] Saccharum_spontaneum / Sspon.01G0022450-2P-mRNA-1,

[0044] Saccharum_spontaneum / Sspon.07G0011460-1A-mRNA-1,

[0045] Saccharum_spontaneum / Sspon.07G0011460-2B-mRNA-1,

[0046] Saccharum_spontaneum / Sspon.07G0011460-3C-mRNA-1,

[0047] Saccharum_spontaneum / Sspon.07G0011460-4D-mRNA-1, Saccharum_spp. / Sh09_t001300, Saccharum_spp. / Sh09_t001310, Setaria_italica / rna-XM_022825063.1,

[0048] LiangSetaria_italica / rna-XM_022824953.1,

[0049] Setaria_viridis / rna-XM_034732865.1,

[0050] Setaria_viridis / rna-XM_034732864.1,

[0051] Sorghum_bicolor / transcript:KXG38103,

[0052] Sorghum_bicolor / transcript:KXG21079,

[0053] Sorghum_bicolor / transcript:KXG21080,

[0054] Sporobolus_pyramidalis / Sp2s00032_12171.mRNA1,

[0055] Corn Zea_mays / transcript:Zm00001eb266930_T001,

[0056] Corn Zea_mays / transcript:Zm00001eb355860_T001,

[0057] Zizania_latifolia / Zla01G013220.1,

[0058] Zoysia_japonica / Zjn_sc00016.1.g06200.1.am.m.

[0059] Furthermore, the HB gene is Zm00001eb266930_T001 from corn, and its nucleotide sequence is shown in SEQ ID NO.1.

[0060] Furthermore, the Poaceae family includes 12 subfamilies, including Anomocholooideae, Oryzoideae, Bambusoideae and Panicoideae, with major representative plants including corn, rice, wheat, barley, bamboo, etc.

[0061] Those skilled in the art can readily mutate the HB gene nucleotide sequence using known methods, such as directed evolution and point mutagenesis. Artificially modified nucleotide sequences that share 80% or greater identity with the HB gene nucleotide sequence isolated herein are considered to be derived from and equivalent to the nucleotide sequence of the present invention, as long as they encode the same protein and have the same function.

[0062] A recombinant vector comprising the above-mentioned HB gene.

[0063] Furthermore, vectors include but are not limited to plasmids, phages, viral vectors, and the like.

[0064] An engineered bacterium comprising the above-mentioned HB gene or recombinant vector.

[0065] Furthermore, engineered bacteria include but are not limited to yeast, bacteria, fungi, etc.

[0066] A transgenic cell line comprises the above-mentioned HB gene or recombinant vector.

[0067] Any of the following uses of the above-mentioned HB gene, recombinant vector, engineered bacteria or transgenic cell line:

[0068] A1) Increased crop yields;

[0069] A2) Improve crop resistance to high temperatures;

[0070] A3) Cultivate genetically modified, gene-edited, and synthetic biology-modified crops.

[0071] Furthermore, the crop is a dicotyledonous or monocotyledonous crop.

[0072] Furthermore, the crop is corn, rice or wheat.

[0073] The HB gene is used in screening and / or identifying high-yield rice, high-temperature-resistant rice, and high-temperature-resistant corn.

[0074] The use of the above-mentioned HB gene in improving rice germplasm with high yield and high temperature resistance related qualities.

[0075] Beneficial effects of the present invention:

[0076] This study screened and identified the HB gene, specific to the PACMAD group of the Poaceae family. This gene is a dominant gene that evolved in Poaceae plants under high-temperature selection, potentially enhancing their ability to survive in high-temperature tropical environments and increasing yields. Subsequent research has further demonstrated its efficacy, such as boosting rice yield when cloned into rice and improving heat tolerance when overexpressed in Arabidopsis thaliana. Therefore, it holds promise for breeding high-yield, heat-tolerant plant varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0077] Figure 1 is the phylogenetic tree of the HB gene obtained for the present invention;

[0078] Figure 2 The HB gene obtained by the present invention is analyzed for colinearity in various species;

[0079] Figure 3 To investigate the effects of overexpression of Zm00001eb266930 gene on rice;

[0080] Figure 4 It is a knockout fragment of the maize Zm00001eb266930 gene;

[0081] Figure 5 To knock out the Zm00001eb266930 gene in maize;

[0082] Figure 6 This is the effect of overexpression of the Zm00001eb266930 gene on Arabidopsis thaliana. DETAILED DESCRIPTION

[0083] The specific embodiments of the present invention are described below to facilitate understanding of the present invention by those skilled in the art. However, it should be clear that the present invention is not limited to the scope of the specific embodiments. For those skilled in the art, as long as various changes are within the spirit and scope of the present invention as defined and determined by the appended claims, these changes are obvious, and all inventions and creations utilizing the concepts of the present invention are protected.

[0084] Example 1 Obtaining the HB gene

[0085] A total of 46 high-quality Poaceae genomes were collected from plant genome databases such as Gramene and Phytozome, and comparative genome analysis was performed to identify HB genes unique to the PACMAD group, specifically.

[0086] The above HB gene was analyzed and found to belong to the LISCL subfamily (see Figure 1 ), the two GRAS genes with similar evolutionary positions have no branch-specific distribution in all Poaceae, which indicates that the generation of HB gene may be after the differentiation of PACMAD and BOP. Further analysis found that the sister GRAS gene of HB gene is located in the adjacent position of the genome of the same species (see Figure 2 ), which indicates that the generation of HB gene may be the result of tandem duplication, and in the subsequent evolution process, it has produced new functions, and the maize Zm00001eb266930 gene (Zm00001eb266930_T001) was used as a representative for subsequent yield increase and high temperature resistance verification.

[0087] Example 2 Obtaining HB gene overexpression rice plants

[0088] 1. Construction of overexpression vector

[0089] (1) Total RNA was extracted from immature embryos of maize KN5585 (a name of a maize inbred line) and reverse transcribed to obtain cDNA.

[0090] (2) Using the cDNA obtained in step (1) as a template, PCR amplification was performed using a primer pair consisting of OE_4_F and OE_4_R to obtain an amplified product. The amplification primers are as follows:

[0091] OE_4_F: 5'-ATGGAAAGTCCTGAGTACTGTGAGATA-3';

[0092] OE_4_R: 5'-CTGATTAGTATATGATTCCTTTGGTTTCCATGA-3';

[0093] Amplification system: 2×Phanta Max Master Mix 25 μL, OE_4_F 1.5 μL, OE_4_R 1.5 μL, cDNA template 2 μL, ddH2O 20 μL.

[0094] Amplification program: 95°C for 3 min; 95°C for 15 s; 56°C for 15 s; 72°C for 45 s; repeat the above three steps 30 times, 72°C for 5 min, and cool at 16°C.

[0095] (3) Using the amplified product obtained in step (2) as a template, PCR amplification was performed using a primer pair consisting of OE_4_F_ha and OE_4_R_ha. The underlined portion of the primer set is the homologous base used for the subsequent BP reaction. The amplified product was recovered and purified. The amplification primers are as follows:

[0096] OE_4_F_ha: 5'- GGGGACAAGTTTGTACAAAAAAGCAGGCTCC ATGGAAAGTCCTGAGTACTGTGAGATA-3';

[0097] OE_4_R_ha: 5'- ggggaccactttgtacaagaaagctgggtc CTGATTAGTATATGATTCCTTTGGTTTCCATGA-3'.

[0098] Amplification system: 2×Phanta Max Master Mix 25μL, OE_4_F_ha 1.5μL, OE_4_R_ha 1.5μL, step (2) purified product 2μL, ddH2O 20μL.

[0099] Amplification program: 95°C for 3 min; 95°C for 15 s; 56°C for 15 s; 72°C for 45 s; repeat the above three steps 30 times, 72°C for 5 min, and cool at 16°C.

[0100] (4) The amplified product recovered in step (3) was subjected to BP reaction with the p-donor primary vector, and the product was spread on zeo-resistant LB solid culture medium for screening. Sequencing was performed to confirm that the target fragment was connected to the primary vector.

[0101] (5) The p-donor primary vector connected with the target fragment obtained in step (4) was subjected to LR reaction with the final vector PACT-3*FLAG-gw to obtain the PACT-3*FLAG-gw-4-HB recombinant plasmid.

[0102] 2. Obtaining recombinant Agrobacterium

[0103] The final vector plasmid PACT-3*FLAG-gw-4-HB was introduced into Agrobacterium EHA105 to obtain recombinant Agrobacterium containing the recombinant plasmid PACT-3*FLAG-gw-4-HB, which was named Agrobacterium EHA105-PACT-3*FLAG-gw-4-HB.

[0104] 3. Preparation of HB gene overexpression rice

[0105] The embryonic callus of Nipponbare was infected with Agrobacterium EHA105-PACT-3*FLAG-gw-4-HB, and then co-culture, screening culture, differentiation culture and rooting culture were carried out in sequence to obtain 26 T0 generation regenerated plants.

[0106] 4. Identification and screening of genetically modified rice

[0107] The T0 generation regenerated plants were used as test plants, and transgenic rice was screened by PCR identification. The specific identification process is as follows:

[0108] The leaves of the test plants were taken and genomic DNA was extracted. PCR identification was performed using a primer pair consisting of M13F and 0301-4-R. If a 500 bp amplification product was displayed, the test plant was a transgenic rice.

[0109] M13F: 5'-GTAAAACGACGGCCAGT-3';

[0110] 0301-4-R: 5'-AATTGCTGACCTATCGAACG-3'.

[0111] Amplification system: 2×Taq Mix 10 μL, M13F 0.5 μL, 0301-4-R 0.5 μL, rice genomic DNA 1 μL, ddH2O 8 μL.

[0112] Amplification program: 95°C for 3 min; 95°C for 15 s; 56°C for 15 s; 72°C for 30 s; repeat the above three steps 33 times, 72°C for 5 min, and cool at 16°C.

[0113] 5. Cultivating homozygous transgenic rice

[0114] The T0 generation transgenic rice screened in step 4 is self-pollinated, seeds are harvested and cultivated to obtain T1 generation transgenic plants, and then the method described in step 4 is used to screen and identify the T1 generation transgenic rice.

[0115] Repeat the above process. If all T2 plants obtained from self-pollination of T1 transgenic rice are transgenic rice, then the T1 plant is a homozygous transgenic line, and eventually multiple homozygous transgenic lines including the OEHB-2 line (T1 plant) are obtained.

[0116] 6. Detection of relative expression level of HB gene

[0117] Rice Nipponbare plants and the T1 generation plants of the obtained OEHB-2 strain were used as test plants. Total RNA was extracted from the test plants and reverse transcribed to obtain cDNA. Using cDNA as a template and the rice actin gene as an internal reference gene, the relative expression level of the HB gene was detected by fluorescence quantitative PCR. The results are shown in Figure 3 .

[0118] The primers used to identify the Actin gene are as follows:

[0119] ACTIN-qRT-F: 5'-TGCTATTGTACGTCGCCATCCAG-3';

[0120] ACTIN-qRT-R: 5'-AATGAGTAACCACGCTCCGTCA-3';

[0121] The primers used to identify the HB gene are as follows:

[0122] 4_Qpcr_F1: 5'-AATGGTCTTGAGGCACGCTTGG-3';

[0123] 4_Qpcr_R1: 5'-CCGCCTTCTCGCTTCGCAAA-3'.

[0124] Amplification system: 2×SYBR mix 7.5 μL, forward and reverse primers 0.3 μL each, cDNA 2 μL, ddH2O 4.9 μL.

[0125] Amplification procedure: 94°C for 30 s; 94°C for 5 s; 56°C for 15 s; 72°C for 10 s; the above three steps were repeated 40 times.

[0126] like Figure 3 As shown in A, compared with rice Nipponbare plants, the transcriptional expression level of the HB gene in the transgenic overexpression plants was significantly increased.

[0127] Example 3. Preparation and identification of HB gene-deficient corn plants

[0128] 1. Construction of gene editing vector

[0129] (1) Screening target sequences

[0130] CTACATAAACCGACTGTTAA TGG and TCGCCCCCGTGCAATAATTG AG G as Target sequence. The underlined part in the target sequence is the PAM (Protospacer Adjacent Motif) sequence.

[0131] (2) Using the SGRNA-CS intermediate vector as a template, PCR amplification was performed using a primer pair consisting of A_F and A_R, and the amplified product was recovered. The amplification primers are as follows:

[0132] A_F: 5'-CAATGGTCTCAattgTACATAAACCGACTGTTAAgttttagagctagaaata g-3';

[0133] A_R: 5'-TTGGGGTCTCTAAACCAATTATTGCACGGGGGCGCAATTCGG TGCTTGCGGCTC-3';

[0134] Amplification system: 2×Phanta Max Master Mix 25μL, A_F 1.5μL, A_R 1.5μL, sgRNA-CS intermediate vector 2μL, ddH2O 20μL.

[0135] Amplification program: 95°C for 3 min; 95°C for 15 s; 56°C for 15 s; 72°C for 20 s; repeat the above three steps 30 times, 72°C for 5 min, and cool at 16°C.

[0136] (3) The pWMV009-CCDB vector was digested with the restriction endonuclease BSAI to recover the vector backbone of approximately 16717 bp.

[0137] (4) The amplified product recovered in step (2) and the vector backbone recovered in step (3) are seamlessly connected to obtain a recombinant plasmid HB-Cas9. In the recombinant plasmid HB-Cas9, positions 775 to 793 encode sgRNA1, positions 1409 to 1427 encode sgRNA2, and positions 3537 to 7805 encode Cas9 protein.

[0138] (5) Obtaining recombinant Agrobacterium tumefaciens

[0139] The recombinant plasmid HB-Cas9 was introduced into Agrobacterium EHA105 / pSoup to obtain recombinant Agrobacterium containing the recombinant plasmid HB-Cas9, which was named Agrobacterium EHA105-HB-Cas9.

[0140] 2. Obtaining HB gene-edited plants

[0141] (1) Agrobacterium EHA105-HB-Cas9 was soaked and infected into corn embryos that had been pollinated for 15 days. Co-culture, callus induction, screening culture, differentiation culture, and rooting culture were then performed simultaneously to obtain 33 T0 generation regenerated plants (one of which was a large fragment deletion gene-edited plant). The T0 generation regenerated plants were used as test plants to screen gene-edited plants. The specific screening process was as follows:

[0142] (2) Take leaves of the test plant, extract genomic DNA, and perform PCR amplification using the primer pair consisting of A_0301_F and A_1219_R2. Then, recover the amplified product and sequence it. Use corn KN5585 as the wild-type control of the test plant. If the sequencing results of the PCR amplification product of the test plant are different from those of the wild-type control, the test plant is a gene-edited plant. The detection primers are as follows:

[0143] A_0301_F:5'-ATGGAAAGTCCTGAGTACTGT-3';

[0144] A_1219_R2: 5'-ATAAGCGCCTCATCATTGTC-3'.

[0145] Amplification system: 2× Taq Mix 10 μL, A_0301_F 0.5 μL, A_1219_R2 0.5 μL, maize genomic DNA 1 μL, ddH2O 8 μL.

[0146] Amplification program: 95°C for 3 min; 95°C for 15 s; 56°C for 15 s; 72°C for 30 s; repeat the above three steps 33 times, 72°C for 5 min, and cool at 16°C.

[0147] (3) The gene-edited plants obtained in step (2) were cultured normally, and the seeds were self-pollinated and harvested. The seeds were cultivated into plants, namely T1 generation plants. The T1 generation plants were used as test plants, and the above-mentioned method was used to screen homozygous gene-edited plants to obtain a homozygous gene-edited type plant, named hb-0571 plant. The knockout results of this homozygous gene-edited type plant are shown in Figure 4 .

[0148] (4) Normally culture the hb-0571 plants obtained in step (3), self-pollinate and harvest seeds, and cultivate the seeds into plants, namely the T2 generation plants of the hb-0571 strain.

[0149] Example 4 Detection of traits of rice overexpression plants

[0150] 1. Detection of overexpression rice plant traits

[0151] 1. Vascular development in leaves of rice overexpressing plants

[0152] Five Nipponbare rice plants and five T1 plants of the OEHB-2 line were used as test plants. The test plants were planted at the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, south of Qibei Road, Beiqijia, Changping District, Beijing. The fourth leaf of rice was vibrated and sectioned 10 cm from the tip to observe its vascular development. The results are shown in the figure. Figure 3 B.

[0153] 2. Agronomic traits of rice overexpression plants

[0154] Rice Nipponbare plants (70 plants), T2 generation plants of OEHB-2 line (100 plants), wild-type maize KN5585 plants (100) and hb-0571 plants (100 plants) were used as test plants and planted in the Southern Breeding Base of the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Yelin Town, Lingshui Li Autonomous County, Hainan Province. The plant height was measured at the heading stage of the rice plants. The measurement method was to measure the average height from the soil surface to the highest leaf tip of each cluster. After heading, the average height from the soil surface to the highest ear top (not including the awn) was measured. The plant height and grain weight of each test plant were recorded and statistically analyzed. The results are shown in Figure 2. Figure 3 C~F and Figure 5 Middle E, F.

[0155] like Figure 3 As shown in C and D. Compared with rice Nipponbare plants, OEHB-2 plants showed a phenotype of increased plant height. Figure 3 The average yield of E, F, and Nipponbare plants was 17.02g, while the yield of OEHB-2 was 22.08g. The yield of OEHB-2 was higher than that of Nipponbare, indicating that overexpression of the maize HB gene (Zm00001eb266930) in rice can effectively increase rice yield. Figure 5 The results of E and F tests showed that the HB gene (Zm00001eb266930) had no significant effect on corn yield.

[0156] 2. Effects of high temperature stress on corn growth

[0157] T2 generation plants of maize KN5585 and hb-0571 were used as test plants, with 15 plants of each line. The plant materials were cultured in a high-temperature incubator at a temperature of 38°C and a humidity of 50%. After 10 days of culture, the growth, chlorophyll content and leaf vascular bundle development of mutant plants and wild-type plants were detected. The results are shown in Figure 5 .

[0158] like Figure 5 As shown in A and B, the height of the mutant hb-0571 plant was significantly reduced compared with the wild-type plant KN5585. Figure 5 As shown in C, the chlorophyll content of the mutant hb-0571 plant was significantly lower than that of the wild type KN5585. Under a microscope, it was found that the leaf vascular development of the hb-0571 plant was abnormal ( Figure 5 D) indicates that knocking out this gene significantly affects the growth and development of corn under high temperature.

[0159] Example 5: Obtaining Arabidopsis plants overexpressing the HB gene

[0160] 1. Construction of overexpression vector

[0161] (1) Total RNA was extracted from maize KN5585 embryos and reverse transcribed to obtain cDNA.

[0162] (2) Extract DNA from corn KN5585 leaves.

[0163] (3) Using the cDNA obtained in step (3) as a template, PCR amplification was performed using a primer pair consisting of OE_4_F and OE_4_R to obtain an amplified product. The amplification primers are as follows:

[0164] OE_4_F: 5'-AATGGAAAGTATGGAAAGTCCTGAGTACTGTGAGATAA ACT-3';

[0165] OE_4_R: 5'-CTGATTAGTATATGATTCCTTTGGTTTCCATGA-3'.

[0166] Amplification system: 2×Phanta Max Master Mix 25 μL, OE_4_F 1.5 μL, OE_4_R 1.5 μL, cDNA template 2 μL, ddH2O 20 μL.

[0167] Amplification program: 95°C for 3 min; 95°C for 15 s; 56°C for 15 s; 72°C for 45 s; repeat the above three steps 30 times, 72°C for 5 min, and cool at 16°C.

[0168] (4) Using the DNA obtained in step (2) as a template, PCR amplification was performed using a primer pair consisting of 4_promoter_F and 4_promoter_R to obtain an amplified product. The amplification primers are as follows:

[0169] 4_promoter_F:5'-CTGAGCAATTTCAAGTCTATGCAG-3';

[0170] 4_promoter_R:5-GACTTTCCATACTTTCCATTGTGTTAGAGATCCACGG-3';

[0171] Amplification system: 2×Phanta Max Master Mix 25 μL, 4_promoter_F 1.5 μL, 4_promoter_R 1.5 μL, cDNA template 2 μL, ddH2O 20 μL.

[0172] Amplification program: 95°C for 3 min; 95°C for 15 s; 56°C for 15 s; 72°C for 60 s; repeat the above three steps 30 times, 72°C for 5 min, and cool at 16°C.

[0173] (5) Using the PCR products obtained in steps (3) and (4) as templates, PCR amplification was performed using primers 0615-F-WMV012 and 0615-R-WMV012 to obtain an amplified product. The amplification primers are as follows:

[0174] 0615-F-WMV012:5'-acgacggccagtgccaagctCTGAGCAATTTCAAGTCTATG CAGCAG-3';

[0175] 0615-R-WMV012:5'-CATcccggggctgttggatctCTGATTAGTATATGATTCCTTTGGTTTCCATGAGG-3'.

[0176] Amplification system: 2× Phanta Max Master Mix 25 μL, 0615-F-WMV012 1.5 μL, 0615-R-WMV012 1.5 μL, cDNA template 2 μL, ddH2O 20 μL.

[0177] Amplification program: 95°C for 3 min; 95°C for 15 s; 56°C for 15 s; 72°C for 2 min; repeat the above three steps 30 times, 72°C for 5 min, and cool at 16°C.

[0178] (6) The pWMV012 vector was double-digested with restriction endonucleases HindIII and BamHI to recover the vector backbone of approximately 11405 bp.

[0179] (7) The PCR product recovered in step (5) and the vector backbone recovered in step (6) were connected by seamless cloning to obtain the recombinant plasmid OE-NP-HB.

[0180] 2. Obtaining recombinant Agrobacterium tumefaciens

[0181] The recombinant plasmid OE-NP-HB was introduced into Agrobacterium EHA105 / pSoup to obtain recombinant Agrobacterium containing the recombinant plasmid OE-NP-HB, which was named Agrobacterium EHA105-OE-NP-HB.

[0182] 3. Preparation of HB gene overexpression plants

[0183] (1) For Arabidopsis plants that have not yet flowered during the bolting stage, apply Agrobacterium tumefaciens to the inflorescence and axillary buds of the unflowered Arabidopsis plants. Co-cultivate in the dark and culture normally after 1 day until harvest. A total of 8 T0 overexpressing seeds were obtained.

[0184] (2) The T0 overexpression seeds were screened on a 1 / 2MS solid medium containing 10 mg / L barsta resistance to select positive seedlings, which were transplanted into soil and cultured normally until harvest to obtain T1 overexpression seeds.

[0185] (3) The T1 overexpressing seeds were plated on 1 / 2 MS solid medium containing 10 mg / L barsta resistance, and all positive seedlings were selected. The plates were transplanted to soil and cultured normally until harvest to obtain T2 overexpressing seeds. The plant with 100% positive seedlings on the plates was homozygous and designated NP-HB-1.

[0186] 4. Detection of relative expression level of HB gene

[0187] The T2 generation plants of Arabidopsis Col-0 and NP-HB-1 were used as test plants. Total RNA was extracted from the test plants and reverse transcribed to obtain cDNA. Using cDNA as a template and the Arabidopsis actin gene as an internal reference gene, the relative expression level of the HB gene was detected by fluorescence quantitative PCR. The results are shown in Figure 3 A.

[0188] The primers used to identify the Actin gene are as follows:

[0189] actin2-F: 5'-TATGAATTACCCGATGGGCAAG-3';

[0190] actin2-R2: 5'-GTCACGCATACCTGAGAACAT-3';

[0191] The primers used to identify the HB gene are as follows:

[0192] 4_Qpcr_F1: 5'-AATGGTCTTGAGGCACGCTTGG-3';

[0193] 4_Qpcr_R1: 5'-CCGCCTTCTCGCTTCGCAAA-3'.

[0194] Amplification system: 2×SYBR mix 7.5 μL, forward and reverse primers 0.3 μL each, cDNA 2 μL, ddH2O 4.9 μL.

[0195] Amplification procedure: 94°C for 30 s; 94°C for 5 s; 56°C for 15 s; 72°C for 10 s; the above three steps were repeated 40 times.

[0196] like Figure 6 As shown in A, compared with Arabidopsis Col-0 plants, the transcriptional expression level of the HB gene in the transgenic overexpression plants was significantly increased.

[0197] 5. Arabidopsis biomass identification

[0198] Arabidopsis Col-0 plants (24 plants) and T1 plants of the NP-HB-1 line (24 plants) were used as test plants. Top views of the Arabidopsis materials were photographed, and the pixels of the Arabidopsis rosette leaves were selected using the similar color tool for statistical analysis. The rosette leaf area of the overexpressing materials was significantly larger than that of the Col-0 plants, and their biomass was greatly increased ( Figure 6 B).

[0199] Finally, it should be noted that the above specific implementation methods are only used to illustrate the technical solutions of the present invention and are not limiting. Although the present invention has been described in detail with reference to examples, those skilled in the art should understand that the technical solutions of the present invention can be modified or replaced by equivalents without departing from the spirit and scope of the technical solutions of the present invention, which should all be included in the scope of the claims of the present invention.

Claims

1. Use of a HB gene unique to the PACMAD group of the Poaceae family for increasing rice yield. The HB gene was selectively evolved by an ancestor of the PACMAD group during the Earth's high temperature period 49 million years ago. The nucleotide sequence of the HB gene is shown in SEQ ID NO.

1. The HB gene is overexpressed in rice.

2. Use of a HB gene unique to the PACMAD group of the Poaceae family in improving the high-temperature tolerance of maize. The HB gene was selectively evolved by the ancestors of the PACMAD group during the Earth's high-temperature era 49 million years ago. Its nucleotide sequence is shown in SEQ ID NO.

1. The HB gene is knocked out in maize.

3. The use according to claim 1 or 2, characterized in that The HB gene is Zm00001eb266930_T001 from corn.

4. Use of a product overexpressing the HB gene according to claim 1 or 2 in increasing rice yield.

5. The use according to claim 4, characterized in that The product is a recombinant vector, an engineered bacterium or a transgenic cell line.

6. Use of overexpressing the HB gene described in any one of claims 1 to 3 in cultivating transgenic rice, rice gene editing and synthetic biology modification of rice.

7. Use of the HB gene knockout according to any one of claims 1 to 3 in the cultivation of transgenic corn, corn gene editing, and synthetic biology modification of corn.

8. Use of the HB gene according to any one of claims 1 to 3 in screening and / or identifying high-yield rice and heat-resistant corn, and in improving the germplasm of high-yield rice and heat-resistant corn related qualities.

Citation Information

Patent Citations

  • Gene MsGRAS60 for regulating and controlling saline-alkaline tolerance of miscanthus sinensis and application of gene MsGRAS60

    CN116179567A