A molecular marker related to chicken eight-week growth traits and application thereof

By conducting genomic analysis on an eight-week-old hybrid chicken population, a SNP molecular marker related to body weight was discovered. By utilizing the polymorphism of this marker to select individuals with the dominant allele A, the problem of improving growth traits in broiler breeding was solved, achieving early, rapid, and low-cost breeding results.

CN118703636BActive Publication Date: 2025-12-05CHINA AGRI UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202410839658.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-06-26
Publication Date
2025-12-05
Estimated Expiration
2044-06-26

AI Technical Summary

Technical Problem

There is a lack of clear and significant molecular markers in current broiler breeding, making it difficult to effectively improve the growth traits of chickens, especially body weight, shank length and shank circumference at eight weeks of age.

Method used

By resequencing and GWAS analysis of a hybrid population of 1163 eight-week-old chickens, an SNP molecular marker rs731116815 (chr1:170521442) located in genome version GRCg6a 104 was found. Genotyping was performed using the polymorphism of this marker, and individuals with the dominant allele A were selected for breeding to improve the weight of the chickens.

Benefits of technology

It enables early, rapid, and low-cost prediction and improvement of chicken flock weight, and has broad breeding application prospects and economic value.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure HDA0004914066740000011
    Figure HDA0004914066740000011
  • Figure HDA0004914066740000012
    Figure HDA0004914066740000012
Patent Text Reader

Abstract

The application discloses a SNP site (chr1: 170521442, located in an intron region of a CAB39L gene) related to an eight-week-old growth trait of a chicken and an application thereof. By determining and recording eight-week-old growth traits of individuals of a chicken crossbreeding population, whole genome correlation analysis is performed on 1163 chickens by using resequencing technology, a SNP (chr1: 170521442) site affecting the eight-week-old growth trait is found, SNP frequency analysis of the SNP site in a low-weight chicken breed and a high-weight chicken breed is performed, and it is found that the SNP frequency distribution exists significant difference in the low-weight chicken breed and the high-weight chicken breed. In the high-weight chicken, A is a dominant allele, and in the low-weight chicken, G is a dominant allele. By selecting the A / A genotype of the SNP site, the genetic breeding of the chicken can be accelerated.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular biology, specifically to a SNP molecular marker related to the growth traits of chickens at eight weeks of age and its application. Background Technology

[0002] Chicken is one of the main meat varieties in China, characterized by high protein, low fat, and low cholesterol. In recent years, my country's chicken production has continued to grow, and improving muscle yield and chicken quality has been a long-term focus for breeding scientists. Classical breeding methods have made significant contributions to the improvement of agricultural animal production traits. With the continuous advancement of genomics work and the extensive development of genetic markers, breeding scientists can select chickens with good yield and quality characteristics for breeding based on specific genetic markers. These genetic markers can help breeding scientists more accurately assess and select chickens for genetic potential, accelerating the breeding process.

[0003] SNPs (Single Nucleotide Polymorphisms) are one of the most common forms of genetic variation in genetics. SNPs are characterized by their large quantity, high frequency, and low mutation rate, playing a crucial role in genetic research and molecular selection breeding. However, current molecular breeding practices for broiler chickens still lack molecular markers with clearly defined functions and significant effects. Therefore, identifying high-efficiency, accurate molecular markers is a current research focus. Furthermore, if we can find SNP molecular markers associated with target traits in chickens and ultimately elucidate the molecular mechanisms underlying these sites, it will greatly promote genetic improvement in chickens and bring breakthrough progress to the field of poultry breeding. Summary of the Invention

[0004] To address the shortcomings of existing technologies, the present invention aims to provide a SNP molecular marker associated with growth traits in chickens at eight weeks of age and its application. Using resequencing technology, 1163 individuals from a hybrid chicken population with eight-week-old growth trait records were sequenced, and GWAS analysis was performed. A significantly associated SNP molecular marker was obtained, which is located at rs731116815 (chr1:170521442) in genome version GRCg6a 104. This SNP molecular marker has polymorphisms of A and G, including three genotypes: AA, GG, and AG. The SNP frequency in other low-weight and high-weight chicken breeds resequencing was statistically analyzed, revealing significant differences between the two breeds. A was the dominant allele in high-weight chickens, while G was the dominant allele in low-weight chickens. In a population with low body weight gain, selecting individuals with allele A can increase chicken weight.

[0005] To solve the above-mentioned technical problems, the technical solution provided by the present invention is as follows:

[0006] A SNP molecular marker associated with growth traits in chickens at eight weeks of age.

[0007] The SNP molecular marker is located at chr1:170521442 of GRCg6a 104 in the genome, and the alleles of the SNP locus are G and A; it includes three genotypes: AA, GG and AG.

[0008] The economic traits are body weight at eight weeks of age, shank length at eight weeks of age, and shank circumference at eight weeks of age. In high-weight chickens, A is the dominant allele, while in low-weight chickens, G is the dominant allele.

[0009] Preferred,

[0010] The SNP molecular marker is located at the 101st base in the nucleotide sequence shown in SEQ ID NO.1.

[0011] The above-mentioned SNP molecular markers were used in the detection of shank length and shank girth traits in chickens at eight weeks of age.

[0012] Preferred,

[0013] The above application includes the following steps:

[0014] (1) Detect the genotype of the sample chickens at the SNP locus;

[0015] (2) Select sample chickens with dominant allele genotypes for breeding superior strains.

[0016] Preferred,

[0017] Step (1) can be performed by direct sequencing, or by first amplifying the gene fragment containing the SNP molecular marker and then detecting it. For example, primers can be designed to amplify the fragment containing the SNP molecular marker from the sequence shown in SEQ ID No. 1, and then the alleles at that site can be detected.

[0018] The above-mentioned SNP molecular markers are used in marker-assisted selection breeding to select chicken breeds with the genotype A / A for breeding.

[0019] Primer pairs used to amplify the above-mentioned SNP molecular markers are shown in SEQ ID NO.2 and SEQ ID NO.3.

[0020] The beneficial effects of this invention are:

[0021] This invention provides a SNP molecular marker related to growth traits in chickens at eight weeks of age and its application. The economic traits are eight-week-old body weight, eight-week-old shank length, and eight-week-old shank circumference. Genotyping was performed on the SNP locus chr1:170521442 in 1163 chickens. SNP frequency analysis of this locus was conducted in other low-weight and high-weight chicken breeds, revealing that A is the dominant allele in high-weight chickens and G is the dominant allele in low-weight chickens. In a low-weight population, selecting individuals with allele A can increase the overall body weight. Using this SNP molecular marker as a breeding marker for superior chicken breeds allows for early, rapid, low-cost, and effective prediction of body weight, demonstrating broad application prospects in chicken breed improvement and promising significant economic value. Attached Figure Description

[0022] The accompanying drawings are provided to further illustrate the invention and form part of the specification. They are used in conjunction with embodiments of the invention to explain the invention and do not constitute a limitation thereof. In the drawings:

[0023] Figure 1 is a Manhattan plot of the GWAS results for 8-week-old infants, where A represents their body weight. Figure 1B Manhattan plot of GWAS results for tibial length at eight weeks of age. Figure 1C Manhattan plot of tibial circumference GWAS results at eight weeks of age Detailed Implementation

[0024] The preferred embodiments of the present invention will be described below with reference to the accompanying drawings. It should be understood that the following embodiments are given for illustrative purposes only and are not intended to limit the scope of the present invention. Those skilled in the art can make various modifications and substitutions to the present invention without departing from its spirit and essence.

[0025] This invention provides a SNP molecular marker related to growth traits in chickens at eight weeks of age and its application. The economic traits are eight-week-old body weight, eight-week-old shank length, and eight-week-old shank circumference. The SNP molecular marker is located in the intron region of the CAB39L gene, chr1:170521442 of the genome GRCg6a 104, and the SNP molecular marker is located at the 101st base in the nucleotide sequence shown in SEQ ID NO.1. The alleles of the SNP site are G and A. A is the dominant allele in high-weight chickens, and G is the dominant allele in low-weight chickens. In a low-weight population, the body weight of the breeding population can be increased by selecting individuals with allele A.

[0026] SEQ ID NO.1(chr1:170521342-170521542)

[0027] caagaaacaaacatcactaatatcaatggattttttataaaaagctttgctgtaatatcatctaaagacgtcatttcacaattaaa

[0028] ttgctctaggaatgtatggctgccaatctattgtctagtatcattcagtctttgtctgggtattgtattgtagcaaatagtatacttat

[0029] cttcttcagtgccaaactcatatat

[0030] Example 1: Genome-wide association analysis of growth traits in chickens at eight weeks of age

[0031] 1. Test materials

[0032] Using individuals from a hybrid chicken population as the research subject, 1163 individuals were measured at eight weeks of age, including body weight, left shank length, and shank circumference. The measurements were conducted strictly in accordance with the chicken farm's internal regulations.

[0033] 2. Test Methods

[0034] 2.1 Phenotypic determination

[0035] When the chickens reach eight weeks of age, each chicken is placed on a weighing device and waited for it to remain relatively calm and balanced. The displayed weight value is then recorded, along with its sex.

[0036] Simultaneously, measure the shank length and shank circumference of the left leg using a measuring tape: 1) Extend the chicken's left leg straight. Starting from the end of the leg (ankle joint), move upwards to the top of the tibia (leg bone). Place the measuring tape close to the outside of the chicken leg and measure in a straight line along the top of the tibia to the ankle joint. Ensure the measuring tool is perpendicular to the chicken leg and record the length obtained; this is the shank length. 2) Starting from the ankle joint (end of the leg), find the thickest part of the chicken leg. Wrap the measuring tape tightly around the thickest part of the chicken leg, ensuring the measuring tool is in close contact with the skin surface of the chicken leg. Record the circumference obtained; this is the shank circumference.

[0037] 2.2 Chicken whole-genome SNP genotyping method based on resequencing technology

[0038] Sequencing data were aligned to the GRCg6a 104 reference genome using GTX Align, and SNP loci were detected using Basevar. The genotype probability of all individuals was estimated using STITCH. For SNP loci obtained through genotyping, they were filtered based on MAF < 0.05, locus call rate < 0.95, and info score < 0.4, retaining a total of 7,901,521 high-quality SNPs.

[0039] The specific amplification steps were as follows: Blood tissue samples from the hybrid population were collected, and DNA was extracted using a total DNA extraction kit from Beijing Tiangen Biotech Co., Ltd. The extracted DNA was then analyzed using a NanoDrop 2000 spectrophotometer to determine its concentration and purity, specifically the OD values ​​(OD260 / OD280 and OD260 / OD230 ratios). Agarose gel electrophoresis was used to check the DNA integrity. Using the genome of the hybrid population samples as a template, primers were designed using Oligo7 software, and sequence amplification was performed using Novizan 2×Taq Master Mix. The reaction system was as follows: 95℃, pre-denaturation for 3 min; 95℃, denaturation for 15 s, 60℃, annealing for 15 s, 72℃, extension for 15 s, 30 cycles; 72℃, complete extension for 5 min. Finally, agarose gel electrophoresis was used to detect the fragment size of the product.

[0040] Primer pair sequences for amplifying fragments containing the above SNP sites:

[0041] F:CAAGAAACAAACATCACTAA(SEQ ID NO.2)

[0042] R:ATATATGAGTTTGGCACTGA(SEQ ID NO.3)

[0043] 2.3 Genome-wide association analysis

[0044] Genome-wide association analysis was performed on the growth phenotypic characteristics of 1163 chickens at eight weeks of age using fastGWA.

[0045] 2.4 SNP loci significantly associated with body weight trait

[0046] Detection of significant loci at the genomic level: significant loci are identified based on FDR < 0.05.

[0047] 3. Results and Analysis

[0048] This invention uses 1163 chickens from a hybrid population as subjects. Using resequencing technology, 7,901,521 SNPs were obtained to perform GWAS analysis on the growth traits of chickens at eight weeks of age. A SNP (chr1: 170521442) that was significantly associated with the growth traits of chickens at eight weeks of age was identified, as shown in Figure 1.

[0049] Example 2: Frequency distribution of SNP (chr1: 170521442) in different chicken breeds

[0050] 1. Test materials

[0051] Low-weight chicken breeds: Bearded Chicken (n=15), Beijing Oil Chicken (n=25), Daweishan Miniature Chicken (n=33) and Camellia Chicken (n=30).

[0052] High-weight chicken breeds: Lingnan yellow-feathered broiler (n=16), white-feathered broiler (n=20), Kebao chicken (n=33) and recessive white-feathered chicken (n=113).

[0053] 2. Test Methods

[0054] 2.1 Data Collection

[0055] The whole-genome resequencing data from the above four low-weight chicken breeds and four high-weight chicken breeds were downloaded from the NCBI SRA database (https: / / ncbi.nlm.nih.gov / sra).

[0056] 2.2 SNP typing using GATK

[0057] The gVCF was constructed based on the GRCg6a 104 reference genome using the gtx wgs command on the GTX server. Then, the gtx gi and gtxjoint commands were used to perform joint variant detection on all gVCF samples and obtain genotype VCF files.

[0058] 2.3 SNP Filtration and Quality Control

[0059] After the combined variant detection was completed, SNPs were extracted using the SelectVariants tool in the GATK software package. Subsequently, the whole genome resequencing data were quality controlled using the VariantFiltration tool in the GATK software package according to the following hard filtering parameters: MQ < 40.0, FS > 60.0, SOR > 3.0, MQRankSum < -12.5, ReadPosRankSum < -8.0, QUAL < 30. After the above quality control, a total of 44,272,587 resequencing SNPs were obtained.

[0060] 2.4 Calculation of allele frequencies of chr1:170521442 in different chicken breeds

[0061] The allele frequencies of chr1:170521442 in different chicken breeds were calculated using vcftools--freq2.

[0062] 3. Results and Analysis

[0063] Table 1 shows the SNP frequency distribution of SNP (chr1: 170521442) in different low-weight and high-weight chicken breeds, with significant differences between the two breeds. A is the dominant allele in high-weight chickens, while G is the dominant allele in low-weight chickens.

[0064] Table 1. SNP frequency (chr1: 170521442) in different low-weight and high-weight chicken breeds.

[0065]

[0066] Analysis revealed a SNP molecular marker associated with growth traits at eight weeks of age in chickens. The economic traits are eight-week-old body weight, eight-week-old shank length, and eight-week-old shank circumference. In a low-weight population, breeding individuals with alleles A / A can increase the body weight of the breeding population.

[0067] The contents not described in detail in this specification are existing technologies known to those skilled in the art.

[0068] Finally, it should be noted that the above descriptions are merely preferred embodiments of the present invention and are not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. Application of a SNP molecular marker in detection of eight-week-old body weight, eight-week-old shank length or eight-week-old shank girth traits of a chicken, characterized in that the SNP molecular marker is located at chr1: 170521442 of the genome GRCg6a, the alleles of the SNP site are G and A; and the SNP molecular marker comprises three genotypes of AA, GG and AG. The method comprises the following steps:

2. Use according to claim 1, characterized in that, (1) detecting the genotype of a sample chicken at the SNP site; (2) selecting a sample chicken with the A / A genotype for breeding of a superior strain.

3. The application according to claim 2, characterized in that the step (1) can adopt direct sequencing or first amplifying a gene fragment containing the SNP molecular marker and then detecting. ​ ​

Citation Information

Patent Citations

  • Haplotype molecular marker related to chicken weight traits and application

    CN110951889A