Genes atcah1 for enhancing drought tolerance of potato, expression proteins and application thereof
By overexpressing the AtCAH1 gene in potato plants, the problems of potato growth and yield under drought conditions were solved, resulting in significant drought resistance and yield improvement, which has important application value.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-05-23
- Publication Date
- 2026-03-27
AI Technical Summary
Potato growth and yield are severely affected by drought conditions, and existing technologies lack effective means to enhance drought resistance.
By cloning the AtCAH1 gene, which enhances the drought resistance of potatoes, and constructing the expression vector pEarleyGate100-AtCAH1-mGFP, the gene was introduced into potato plants using Agrobacterium-mediated transformation technology to achieve overexpression and enhance the plant's drought resistance.
It significantly improves the drought resistance and yield of potatoes, especially increasing the number of tubers and tuber quality under drought conditions, and has broad application prospects.
Smart Images

Figure CN118726376B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of plant genetic engineering, and particularly relates to a gene AtCAH1 for enhancing drought resistance of potatoes, and an expression protein and application thereof. BACKGROUND
[0002] Potato (Solanum tuberosum) is one of the important food crops in the world and plays an important role in global agriculture. Its tubers are rich in starch and are one of the main sources of people's daily diet. Due to its high yield and rich nutritional value, as well as its high yield and low growth cost, compared with other major food crops, potato has a relatively short growth cycle and can grow in a wide range of climate and soil conditions, so it is widely planted all over the world. However, although potato has many advantages, its growth process is often affected by various natural factors, including drought, pests and diseases. In particular, drought, an adverse environmental factor, has a serious impact on the growth and yield of potato. Therefore, we urgently need to find solutions to improve the drought tolerance of potato. Through technical means, cultivating potato varieties with stronger drought tolerance has become one of the current research hotspots. These drought-tolerant varieties not only can maintain high yield under drought conditions, but also can reduce the demand for water resources, which helps to improve the production efficiency and food security level of global agriculture. SUMMARY
[0003] The present application provides a gene AtCAH1 for enhancing drought resistance of potato, which effectively improves the drought tolerance of potato and increases its yield.
[0004] The present application also provides a protein of the gene AtCAH1 for enhancing drought resistance of potato and an application thereof.
[0005] Technical scheme: In order to achieve the above-mentioned purpose, the present application provides a gene AtCAH1 for enhancing drought resistance of potato, and the nucleotide sequence of the gene AtCAH1 is shown in SEQ ID NO. 1.
[0006] Among them, the primer pair for amplifying the gene AtCAH1 is SEQ ID NO. 2: TTGGAGAGGACACGCTCGAGATGAAGATTATGATGATGATTAAGCT; SEQ ID NO. 3: TTCTCCTTTACTCATGGATCCATTGGGTTTTTTCTTTTTGTTAC.
[0007] The protein expressed by the gene AtCAH1 for enhancing drought resistance of potato has an amino acid sequence shown in SEQ ID NO. 4.
[0008] The expression vector containing the gene AtCAH1 for enhancing drought resistance of potato.
[0009] The expression vector is based on the plasmid pEarleyGate100, and the plasmid pEarleyGate100 is linearized by double enzyme digestion, and the gene AtCAH1 is inserted into the pEarleyGate100 to construct the AtCAH1 overexpression vector.
[0010] As preferred, the prokaryotic expression vector is based on the plasmid pEarleyGate100, and the plasmid pEarleyGate100 is linearized by double enzyme digestion, and the enzyme digestion site is XhoI and XbaI, the gene AtCAH1 and mGFP are inserted into the pEarleyGate100 to construct the AtCAH1 expression vector pEarleyGate100-AtCAH1-mGFP, wherein the mGFP is used as a fluorescent gene.
[0011] The 5' end of the gene AtCAH1 is assembled with the constitutive strong promoter CaMV35S, and the 3' end of the gene AtCAH1 is assembled with the OCS-terminator.
[0012] The expression vector is assembled with the LB (T-Border left) and RB (T-Border right) sequences, so that the gene AtCAH1 expression frame and the screening marker gene BlpR assembled therebetween can be integrated into the chromosome of the potato recipient cell.
[0013] The host cell containing the gene AtCAH1 for enhancing drought resistance of potato is preferably based on the Agrobacterium as a starting strain.
[0014] The gene AtCAH1 for enhancing drought resistance of potato, the protein, the vector or the host cell is used for overexpression in enhancing drought resistance of potato and promoting yield.
[0015] The gene AtCAH1 for enhancing drought resistance of potato, the protein or the vector or the host cell is used for application in cultivating drought-resistant potato germplasm.
[0016] The process of cultivating the plant with the gene AtCAH1 for enhancing drought resistance of potato is as follows: taking leaves of Arabidopsis thaliana as material, cloning the gene AtCAH1, taking the vector for storing and publicly reporting sequences in the experiment as a template, cloning mGFP, then constructing AtCAH1 and mGFP into the overexpression vector pEarleyGate100 at the same time, obtaining a recombination vector by construction, transforming the recombination vector into Agrobacterium, and then soaking potato stem segments in the resuspended solution of Agrobacterium for genetic transformation of potato, so that AtCAH1 can be efficiently expressed in potato under the driving of the promoter CaMV35S. By overexpressing AtCAH1 in potato plants, the drought resistance of potato is significantly enhanced. In addition, it is found that the overexpression of AtCAH1 significantly increases the number of underground tubers of potato. Therefore, the present application provides a reference for improving the stress resistance of plants, and has a wide application prospect in improving crop yield and protecting food safety.
[0017] Beneficial effects: compared with the prior art, the present application has the following advantages:
[0018] The present application identifies a new AtCAH1 gene for enhancing drought resistance of potato and promoting crop yield, and provides a new genetic resource for molecular genetic improvement of drought resistance of potato.
[0019] Through stem segment transformation and tissue culture experiments, the gene AtCAH1 is introduced into potato for the first time, and the AtCAH1 overexpression strain of potato is successfully created. The results show that compared with the wild type, the drought resistance of the potato overexpression strain is significantly improved, and the tuber yield is obviously increased. Therefore, by overexpressing the gene AtCAH1, the drought resistance of plants and the yield of crops have potential application value.
[0020] Therefore, the gene AtCAH1 in the present application can improve the yield of potato while making potato water-saving and drought-resistant, and can be used for cultivating potato germplasm resources with better traits, and has good application prospect. BRIEF DESCRIPTION OF DRAWINGS
[0021] Figure 1 for cloning of the target gene;
[0022] Figure 2 for a structural schematic diagram of the expression vector pEarleyGate100-AtCAH1-mGFP;
[0023] Figure 3 for genetic transformation of the AtCAH1 gene and identification of the potato overexpression strain;
[0024] Figure 4 for phenotype analysis of the AtCAH1 overexpression strain after drought treatment and rehydration;
[0025] Figure 5 Analysis of tuber yield in AtCAH1 overexpression lines. Detailed Implementation
[0026] The present invention will be further described below with reference to the accompanying drawings and embodiments.
[0027] All raw materials or reagents used in this invention are commercially available. Among them, the carrier pEarleyGate100 is a known carrier. Subcellular localization of chlorophyllase2 reveals it is not involved in chlorophyll degradation during senescence in Arabidopsis thaliana. Plantscience 290(2020):110314.
[0028] Example 1
[0029] Cloning of AtCAH1 and mGFP
[0030] (1) Using Arabidopsis cDNA as a template, amplification primers were designed, with the forward primer (CAF) being 5'-TTGGAGAGGACACGCTCGAGATGAAGATTATGATGATGATTAAGCT-3' and the reverse primer (CAR) being 5'-TTCTCCTTTACTCATGGATCCATTGGGTTTTTTCTTTTTGTTAC-3'.
[0031] (2) PCR amplification.
[0032] The PCR reaction system is as follows:
[0033]
[0034] PCR reaction procedure:
[0035]
[0036]
[0037] Electrophoresis: The gene amplification products from the PCR instrument are retrieved and spotted onto a 1% agarose gel using an electrophoresis apparatus. After approximately 25 minutes, the product is removed and observed using an imaging system to obtain the target fragment, such as... Figure 1 As shown in A, the AtCAH1 gene sequence was determined to be 855 bp after sequencing of the PCR product, as shown in SEQ ID NO.1, and its amino acid sequence is shown in SEQ ID NO.4.
[0038] (3) The mGFP sequence was cloned by referring to the sequence (GenBank: U87973.1) in the NCBI database. The mGFP sequence was used as a template to design amplification primers. The forward primer (mGFPF) was 5'-TAACAAAAAGAAAAAACCCAATgGATCCATGAGTAAAGGAGAAGAACTT-3', and the reverse primer (mGFPR) was 5'-GGTCTTAATTAACTCTCTAGATTATTTGTATAGTTCATCCATGCCAT-3'.
[0039] (4) PCR amplification.
[0040] The PCR reaction system was as follows:
[0041]
[0042] The PCR reaction program was as follows:
[0043]
[0044]
[0045] The gel was run: the gene amplification product in the PCR instrument was taken out, and an appropriate amount of product was spotted on a 1% agarose gel for detection. After about 25 min, it was taken out and observed using an imaging system to obtain the target fragment, as shown in FIG. B. The PCR product was sequenced, and the sequence of the mGFP gene was SEQ ID NO. 5. Figure 1
[0046] Example 2
[0047] Construction of the expression vector pEarleyGate100-AtCAH1-mGFP vector
[0048] (1) In this experiment, the pEarleyGate100-based plasmid was used. The pEarleyGate100 vector plasmid (the vector has a promoter CAMV35S, a strong terminator NOS-ter, a BlpR gene expression cassette, LB and RB sequences) was linearized by double enzyme digestion, and the enzyme digestion site was XhoI and XbaI. The gene AtCAH1 and mGFP were inserted into pEarleyGate100 to construct the AtCAH1 expression vector pEarleyGate100-AtCAH1-mGFP.
[0049] The enzyme digestion reaction system, enzyme digestion reaction procedure, recombination reaction system, and recombination reaction procedure are as follows, respectively. The enzyme digestion reaction, agarose gel electrophoresis observation of enzyme digestion bands, adjustment of the addition volumes of the linearized vector and the insert according to the concentration sizes of the linearized vector and the insert, the molar ratio of the vector to the insert is 1:2, recombination using a recombination enzyme (Nanjing Novozyme Bio-Technology Co., Ltd., model C112-02-AA), and storage of the recombination product at -20℃ for subsequent transformation of E. coli competence.
[0050] The enzyme digestion reaction system is as follows:
[0051]
[0052]
[0053] The enzyme digestion reaction procedure is as follows:
[0054]
[0055] The recombination reaction system is as follows:
[0056]
[0057] The recombination reaction procedure is as follows
[0058]
[0059] The recombination product is transformed into E. coli competence for culture.
[0060] (2) Transformation of E. coli
[0061] According to the Trans1-T1 Phage Resistant Chemically Competent Cell product instruction (Quanxi Jin, China), the ligated product is mixed with the competent cells, after ice bath, heat shock, and recovery, an appropriate amount is coated on an LB plate, the plate is inverted, and the plate is cultured at 37℃ overnight.
[0062] (3) Positive clone screening and sequencing analysis
[0063] A single colony is selected from the screening plate and inoculated in LB liquid medium, and cultured at 37℃, 230rmp overnight; the overnight cultured bacterial solution is directly used as a template for PCR detection of the recombination transformant.
[0064] The reaction system is as follows:
[0065]
[0066]
[0067] The reaction procedure is as follows:
[0068]
[0069] The positive clones of the bacterial liquid PCR detection were sent to Shanghai Genechem Biotech Co., Ltd. for sequencing identification.
[0070] The product after recombination was transformed into E. coli competent cells for culture, and positive clone strains were detected by PCR. The plasmid was extracted to confirm that the overexpression vector of AtCAH1 was successfully constructed, named pEarleyGate100-AtCAH1-mGFP, as shown in Figure 2 The constructed expression vector assembled a constitutive strong expression promoter CaMV35S at the 5' end of AtCAH1, and a terminator OCS-terminator at the 3' end. The BlpR gene expression cassette was assembled on the expression vector as a screening marker of transgenic potato. At the same time, the LB and RB sequences were assembled on the expression vector to promote the integration of the gene expression framework and the screening marker gene BlpR assembled therebetween into the chromosome of the potato recipient cells.
[0071] Example 3
[0072] Genetic transformation of AtCAH1 gene and identification of potato overexpression strain
[0073] 1. Agrobacterium transformation
[0074] (1) 2.5 μL of the sequencing error-free plasmid pEarleyGate100-AtCAH1-mGFP was added to 50 μL of the thawed Agrobacterium GV3101 competent cells on ice, and mixed slowly with a gun head;
[0075] (2) The 1.5 mL centrifuge tube containing the competent cell mixture was placed on ice and incubated for 30 min, then placed in liquid nitrogen and cooled for 3 min;
[0076] (3) The centrifuge tube was transferred to a 37°C metal bath, thawed for 5 min, then placed on ice and incubated for 2 min;
[0077] (4) 1 mL of room temperature LB liquid medium was added to the centrifuge tube, and then the centrifuge tube was placed in a 28°C shaker for 2-3 h;
[0078] (5) Centrifuged at 6000 rpm for 2 min, collected the bacterial cells, discarded 800 μL of supernatant, and resuspended the remaining 200 μL of liquid and bacterial cell precipitate;
[0079] (6) 100 μL of the suspension was pipetted with a pipette tip and spread evenly onto LB solid medium containing the appropriate antibiotic resistance. After 20 min, the medium was inverted and incubated at 28°C for 48 h to obtain single colonies containing pEarleyGate 100-AtCAHl-mGFP.
[0080] 2. Growing sterile seedlings
[0081] All sterile potato seedlings were grown at 18-22°C under 16 h light (light intensity 80-110 μE / m 2 / s) and 8 h darkness.
[0082] (1) Growing test-tube seedlings from sprouted tubers
[0083] a. The sprouts from the tubers were cut off and rinsed with tap water.
[0084] b. The cut sprouts were first immersed in 70% ethanol with 2 drops of Tween 20 for 1 min, then in 10% Domestos for 15 min, rinsed 5 times with sterile water and finally incubated in BM medium.
[0085] c. The stem segments and sprout tips were subcultured in 90 mm Petri dishes or tissue culture bottles containing BM medium.
[0086] (2) Growing test-tube seedlings from plants growing in the greenhouse
[0087] a. Vigorous, healthy plants were selected and stem segments and sprout tips were cut off and immediately rinsed with tap water.
[0088] b. The stem segments and sprout tips were first cut into small pieces of 5-10 mm, then rinsed in 70% ethanol with 2 drops of Tween 20 for 1 min, then in 10% Domestos for 15 min, rinsed 5 times with sterile water and finally incubated in BM medium.
[0089] c. The stem segments and sprout tips were subcultured in 90 mm Petri dishes or tissue culture bottles containing BM medium.
[0090] 3. Inoculation, transformation and regeneration
[0091] (1) Leaf discs or stem segments of about 10 mm long with a cut surface of at least 2.5 mm in diameter (without axillary buds) were excised from 3-4 week old potato plants.
[0092] (2) The explants (at least 30 in number) were placed on pre-culture medium plates for 2 days (pre-culturing for 2 days increases transformation and regeneration efficiency).
[0093] (3) Add 1 mL of MS20 resuspended bacteria solution to a 90 mm Petri dish, then place explants in the dish, seal with parafilm, and place in a bacterial incubator at 22°C, 50 rpm for 45 minutes. (The concentration of Agrobacterium solution is OD600=0.5-0.8, and the infection time is 5-10 minutes for higher genetic transformation efficiency. If the concentration of the bacterial solution is too high, the wound of the explant is easy to turn black, and it is difficult to inhibit the growth of Agrobacterium during the later induction of callus, which can easily cause explant contamination and reduce the genetic transformation rate. Within the range of OD600=0.5-0.8, the concentration of the bacterial solution is increased, and the infection time is correspondingly shortened. Therefore, the lower concentration OD600=0.5 and longer time 10 minutes of infection are selected as the best.)
[0094] (4) Pour the Agrobacterium suspension into the container and inactivate the Agrobacterium.
[0095] (5) Use sterile filter paper to absorb the moisture on the surface of the explant, then place it on the CMC medium (30 explants per plate). After sealing the plate, place it in weak light (light intensity of 20 μE / m 2 / s) at 18-22°C for 48 hours of transformation.
[0096] (6) Then place the transformed explants on the CMC medium for co-culture, with less than 10 explants per plate. After sealing the plate, place it in sufficient light (light intensity of 80-110 μE / m 2 / s) at 18-22°C.
[0097] (7) After 12 days, transfer the explants in the CMC medium to the CMCK medium for culture.
[0098] (8) Replace the new CMCK medium every 14 days.
[0099] (9) Callus and shoots appear after 4 weeks, then continue to culture. When approximately the third time of replacing the CMCK medium, carefully cut off the shoots of about 5-10 mm, then place them in the SM medium.
[0100] (10) Continue to transfer the explants every 14 days, and cut off the shoots that grow later to ensure that each shoot develops into an individual plant.
[0101] 4. Selection and further growth of transgenic shoots
[0102] (1) After 14 days of culture in the SM medium, remove the surviving seedlings (i.e. those that only grow roots from the wound of the shoot). Cut off the shoot tips of 10-15 mm, then place them in new SM medium for 2 times of screening.
[0103] (2) When the test-tube plantlets with well developed root system grow to 4-5 stem nodes, wash off the excess agar, and transplant them into 3L pots filled with mixed fertilizer, and place them in a greenhouse, controlling the temperature at 15-20°C (light intensity 150 μE / m 2 / s, photoperiod 16 hours), and keep the soil moist for 2 days.
[0104] (3) If the above steps are followed carefully, the success rate of transplantation is usually 100%. Vigorous plants should be given liquid fertilizer (1:1:1 N:P:K) every week during the flowering period. Finally, each plant usually produces 7-10 tubers.
[0105] (4) The tubers obtained from the transgenic plants can be stored under low temperature conditions (dark, 4°C).
[0106] The culture media used in this example are shown below. Prepare the appropriate volume of culture medium according to the experiment, and divide it into Durand bottles (blue mouth bottles), and sterilize it under high pressure steam at 121°C for 20 minutes, and filter sterilize the antibiotics. Then, in a clean bench, first add the growth regulator stock solution to the culture medium, and then divide it into 10 9cm culture dishes or tissue culture bottles.
[0107] Plant growth essential medium (BM): 1X MS vitamin-containing basic medium 4.4 g / L (Duchefa product no. MO 22), 20 g / L sucrose, distilled water to 1 L, and adjust pH to 5.8. Add 8.0 g / L agar powder, sterilize under high pressure steam, and store at 4°C.
[0108] MS20 medium: liquid BM medium, same composition as above, but without agar powder.
[0109] MS20(30) medium: MS medium with 20 g (30 g) of sucrose; pre-culture R3B medium formula: MS30 + 2.0 mg·L-1NAA + 1.0 mg·L-1 6-BA;
[0110] Co-culture medium (CM): add 0.2 mg / L NAA, 0.02 mg / L GA3, 2.5 mg / L zeatin riboside (ZR) to the BM medium, and 8 g / L agar powder.
[0111] First-stage regeneration medium (CMC): add 500 mg / L cefotaxime (sterilized by filtration, the working concentration of cefotaxime can be adjusted according to whether it effectively inhibits Agrobacterium, the minimum can be 300 mg / L; a lower concentration of cefotaxime is conducive to the differentiation and development of explants, and a higher concentration will cause the explants to brown.) to the CM medium.
[0112] Second stage regeneration medium (CMCK): 0.02 mg / L NAA, 0.02 mg / L GA3, 2 mg / L Thidiazuion (TDZ), 500 mg / L Cefotaxime (sterilized by filtration), resistance screening according to the corresponding resistance of the transformed Agrobacterium.
[0113] Selection medium (SM): 500 mg / L Cefotaxime (sterilized by filtration) was added to the BM medium, and the resistance was screened according to the corresponding resistance of the transformed Agrobacterium.
[0114] LB medium: 10 g / L tryptone; 10 g / L yeast extract; 10 g / L NaCl, pH = 7.5; 18 g / L agar powder.
[0115] Example 4
[0116] Identification of AtCAH1 potato overexpression lines
[0117] The potato seedlings obtained in Example 3 above that can grow normally in SM medium were selected, the DNA of the leaves was extracted, and the expression of the exogenous gene AtCAH1 in the transformed lines was detected. The identification primers were designed, wherein the forward primer was SEQ ID NO. 6: 5'-CTTTGCTGTGGTGGCAAGTC-3', and the reverse primer was SEQ ID NO. 7: 5'-CGTGCCGCTTCATATGATCT-3'. The constructed vector was used as a positive control, and the wild-type potato plant was used as a negative control.
[0118] PCR reaction system for identification:
[0119]
[0120] PCR reaction program:
[0121]
[0122] From Figure 3 It can be seen that positive transgenic plants with stable inheritance were obtained, and the overexpression potato lines CAH1-2 and CAH1-9 were obtained.
[0123] Example 5
[0124] Analysis of phenotypes of AtCAH1 overexpression lines after drought treatment and rehydration
[0125] AtCAH1 overexpressing lines CAH1-2 and CAH1-9, along with wild-type potato plants of uniform growth, were selected and transplanted into seedling pots, one plant per pot. After thorough watering, they were placed in a 22℃ light incubator at 70% relative humidity for 16h / 8h (day / night). Watering was stopped during this period, and phenotypes were observed. Figure 4 As shown, after four weeks, wild-type potatoes exhibited water loss and severe wilting, while the overexpression lines only showed mild water loss. After watering, the plant phenotypes were observed and recorded two days later. Wild-type potatoes failed to recover after two days of rehydration and died. The overexpression lines, however, all recovered to normal phenotypes and survived. Further analysis of water loss rates revealed a significantly increased transpiration rate in the AtCAH1 overexpression lines compared to the wild type. This indicates that AtCAH1 overexpression significantly increases potato drought tolerance, effectively mitigating drought damage and improving plant survival rates.
[0126] Example 7
[0127] Analysis of tuber yield in AtCAH1 overexpression lines under drought conditions
[0128] Potatoes are an important food crop, and although they are widely cultivated due to their drought tolerance, drought, as an adverse environmental factor, still severely impacts their growth and yield. To further explore whether drought conditions increase tuber production in AtCAH1 overexpression lines, the drought culture conditions of Example 5 were used as a reference. Statistical analysis was performed on the number and quality of potato tubers after 4 weeks of drought growth. Figure 5 The results showed that under drought conditions, wild-type potatoes had an average of only one tuber, while AtCAH1-overexpressing lines had an average of two tubers, significantly higher than the wild type. Simultaneously, the weight of individual tubers in AtCAH1-overexpressing lines was also significantly higher than that of the wild type. This indicates that under drought conditions, AtCAH1 overexpression promotes both the number and growth of potato tubers, ultimately significantly increasing yield. This result suggests that AtCAH1 overexpression has promising application prospects for expanding potato planting areas and increasing potato yield. It is also of great significance for creating water-saving crop germplasm resources and maintaining food security.
Claims
1. An overexpression AtCAH1 Gene or overexpression AtCAH1 The application of gene-encoded proteins in promoting potato yield, wherein... AtCAH1 The nucleotide sequence of the gene is shown in SEQ ID NO.
1.
2. Contains AtCAH1 The application of gene overexpression vectors or host cells containing said overexpression vectors in promoting potato yield; wherein... AtCAH1 The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the host cell is Agrobacterium.
3. An overexpression AtCAH1 Gene or overexpression AtCAH1 The application of gene-encoded proteins in the breeding of high-yield potato germplasm, wherein... AtCAH1 The nucleotide sequence of the gene is shown in SEQ ID NO.
1.
4. Contains AtCAH1 The application of gene overexpression vectors or host cells containing said overexpression vectors in the cultivation of high-yield potato germplasm; wherein... AtCAH1 The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the host cell is Agrobacterium.
5. The application according to any one of claims 1-4, characterized in that, Used to amplify AtCAH1 The primer pairs for the gene are SEQ ID NO.2: TTGGAGAGGACACGCTCGAGATGAAGATTATGATGATGATTAAGCT; SEQ ID NO.3: TTCTCCTTTACTCATGGATCCATTGGGTTTTTTCTTTTTGTTAC.
6. The application according to claim 2 or 4, characterized in that, The overexpression vector uses pEarleyGate100 as the base plasmid. The pEarleyGate100 vector plasmid is linearized by double enzyme digestion. AtCAH1 Genes were inserted into pEarleyGate100 to construct an overexpression vector.
7. The application according to claim 6, characterized in that, The AtCAH1 The 5' end of the gene assembles the constitutive strong promoter CaMV35S, in AtCAH1 The 3' end of the gene assembles the OCS-terminator.
8. The application according to claim 6, characterized in that, The overexpression vector is assembled with LB and RB sequences, promoting the assembly between them. AtCAH1 The gene expression framework and the selection marker gene BlpR can be integrated into the chromosome of potato recipient cells.
Citation Information
Patent Citations
Plant CO2 sensors, nucleic acids encoding them, and methods for making and using them
CN101688201A