Acidophilic thiobacillus and gene scarless knockout method thereof

Abstract

The application belongs to the field of microorganisms, and discloses an acidophilic thiobacillus and a gene scarless knockout method thereof, which comprises the following steps: recombining an I-SceI gene, an IPTG inducible promoter lacI-PtacO gene and a suicide plasmid pSDUDI to construct a pSDUDI-LacI-I-SceI gene knockout plasmid, and knocking out the I-SceI gene by IPTG induction and expression of I-SceI enzyme; the method improves the probability of the gene knockout plasmid part “separating” from the acidophilic thiobacillus chromosome, simplifies the operation genetic operation step by one-step method, is less time-consuming, and shortens the gene knockout time.

Description

Technical Field

[0001] This invention relates to the field of microbial technology, and in particular to an acidophilic thiobacillus and a method for scarless gene knockout. Background Technology

[0002] The statements herein provide only background information in relation to this invention and do not necessarily constitute prior art.

[0003] Acidithiobacillus spp. is a Gram-negative chemoautotrophic bacterium that can obtain energy by oxidizing elemental sulfur, reducing sulfides and ferrous iron. It plays a very important role in bacterial leaching and can significantly improve leaching efficiency, making it one of the most valuable bacterial species in the biometallurgical industry.

[0004] Thiobacillus acidophilus is characterized by its demanding growth conditions, long generation time, slow growth, and complex genetic manipulation, leading to relatively slow research progress. Its study and modification are primarily conducted through conjugation transfer systems. Traditional genetic manipulation methods for Thiobacillus acidophilus have limited research and reports on knockout techniques. Therefore, in previous research, the inventors developed a scarless gene knockout method for Thiobacillus acidophilus based on homologous recombination, as described in patent CN102604929A, "Scarless Gene Knockout and Integration Method for Thiobacillus acidophilus." This method, based on a conjugation transfer system, requires two plasmids and at least two conjugations, as well as plasmid loss. While it can achieve gene knockout in Thiobacillus acidophilus, the inventors found that this method still suffers from cumbersome knockout procedures, complex genetic manipulation, and long processing times, hindering research on Thiobacillus acidophilus. Summary of the Invention

[0005] In view of the shortcomings of the existing technology, the purpose of this invention is to provide a method for the scarless knockout of the gene of Thiobacillus acidophilus, so as to solve the problems of complex genetic operations of Thiobacillus acidophilus and long time consumption.

[0006] The first aspect of this invention discloses a scarless knockout method for the gene of *Thiobacillus acidophilus*, comprising:

[0007] The I-SceI gene, the IPTG-inducible promoter lacI-PtacO gene, and the suicide plasmid pSDUDI were recombined to construct the pSDUDI-LacI-I-SceI gene knockout plasmid. The target gene was knocked out by expressing the I-SceI enzyme through IPTG induction.

[0008] This invention combines a suicide plasmid containing the I-SceI restriction site and an I-SceI enzyme expression plasmid to successfully construct a one-step knockout plasmid pSDUDI-LacI-I-SceI that can be induced to express the I-SceI enzyme via IPTG. This effectively shortens the gene knockout time of Thiobacillus acidophilus and provides a new approach for in-depth research and modification of Thiobacillus acidophilus.

[0009] In some embodiments, the suicide plasmid pSDUDI is double-digested to obtain a linearized fragment, and the IPTG-inducible promoter lacI-P is then used. tacO The gene fragment and the linearized fragment were ligated using homologous recombinase to construct the pSDUDI-LacI plasmid;

[0010] The pSDUDI-LacI plasmid was ligated to the I-SceI gene fragment using homologous recombinase to construct the pSDUDI-LacI-I-SceI plasmid.

[0011] The homologous arm fragment of the target gene to be knocked out in Thiobacterium acidophilus was ligated with the pSDUDI-LacI-I-SceI vector using homologous recombinase to construct a gene knockout plasmid.

[0012] The gene knockout plasmid was transformed into competent E. coli, then conjugated and transferred into Thiobacillus acidophilus, and screened to obtain gene knockout Thiobacillus acidophilus.

[0013] In some implementations, the suicide plasmid pSDUDI is double-digested with restriction endonucleases MluI and NdeI to obtain a linearized fragment.

[0014] In some embodiments, the homologous recombinase is EEnase II.

[0015] In some implementations, the IPTG-inducible promoter gene fragment lacI-P is obtained by PCR amplification using a plasmid containing the IPTG-inducible promoter as a template. tacO .

[0016] In some embodiments, the acidophilic thiobacillus is acidophilic thermophilic thiobacillus caldus.

[0017] In some implementations, the suicide plasmid pSDUDI is coupled with the IPTG-inducible promoter lacI-P tacO The pSDUDI-LacI plasmid was constructed by fusion using the homologous recombinase EEnase II, transformed, and cultured.

[0018] In some implementations, the suicide plasmid pSDUDI is coupled with the IPTG-inducible promoter lacI-PtacO The fusion reaction conditions were 37°C and water bath heating for 30 minutes.

[0019] In some implementations, the I-SceI gene fragment is obtained by PCR amplification using a plasmid pMSD1-I-SecⅠ containing the I-SceI gene fragment containing a nuclease as a template.

[0020] In some implementations, the linearized plasmid pSDUDI-LacI fragment is ligated to the I-SceI gene fragment using the homologous recombinase EEnase II to construct the pSDUDI-LacI-I-SceI plasmid, which is then transformed and cultured.

[0021] In some implementations, using the Thiobacillus acidophilus genome as a template, gene fragments of the upstream and downstream homologous arms of the gene to be knocked out are amplified by PCR.

[0022] In some implementations, using the genome of Thiobacillus acidophilus as a template, UHA and DHA gene fragments of the upstream and downstream homologous arms of the pelD gene are amplified by PCR.

[0023] In some implementations, the genome of Thiobacillus acidophilus is extracted using a genome extraction kit.

[0024] In some embodiments, the target gene is the pelD gene. The pSDUDI-LacI-I-SceI plasmid is digested with restriction endonucleases SpeI and SacI to obtain the pSDUDI-LacI-I-SceI linearized plasmid. The pSDUDI-LacI-I-SceI linearized plasmid is then ligated with the upstream and downstream homologous arms of the pelD gene, UHA and DHA gene fragments, using the homologous recombinase EEnase II to construct the knockout plasmid pSDUDI-LacI-I-SceI-pelD.

[0025] In some embodiments, the constructed knockout plasmid pSDUDI-LacI-I-SceI-pelD is transformed into competent cells of Escherichia coli to obtain a donor bacterium for conjugation transfer, and the plasmid is transferred into the recipient bacterium Thiobacillus acidophilus according to the conjugation transfer method.

[0026] Another aspect of this application provides a gene-knockout acidophilic thiobacillus obtained using the method described above.

[0027] One or more technical solutions provided in the embodiments of the present invention have at least the following technical effects or advantages:

[0028] 1. This invention provides a traceless gene knockout method for *Thiobacillus acidophilus*. Using synthetic biology methods, a laboratory-constructed IPTG-inducible promoter is used to combine a suicide plasmid containing a wide range of I-SceI restriction sites with an I-SceI enzyme expression plasmid, constructing a one-step knockout plasmid vector capable of expressing I-SceI enzyme via IPTG induction. Homologous arm fragments of the gene to be knocked out are inserted into the multiple cloning site of the vector to obtain the one-step gene knockout plasmid. This one-step gene knockout plasmid is transformed into *Escherichia coli* strain SM10, and then transferred into *Thiobacillus acidophilus* via conjugation transfer. Screening and identification yield the gene-knockout *Thiobacillus acidophilus*. Compared to traditional knockout methods, this novel knockout method requires only one conjugation and does not involve plasmid loss, reducing the gene knockout time by half. Attached Figure Description

[0029] The accompanying drawings, which form part of this invention, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an improper limitation of the invention.

[0030] Figure 1 The pSDUDI-LacI-I-SceI plasmid vector map;

[0031] Figure 2 PCR verification diagram of pelD knockout strain;

[0032] Wherein: lane M is Trans 5K DNA Maker; lanes 1-2 are PCR results of the knockout strain and wild-type genome using PDF1 / R1 primers, respectively; lanes 3-4 are PCR results of the knockout strain and wild-type genome using PDF2 / R2 primers, respectively; lanes 5-6 are PCR results of the knockout strain and wild-type genome using PDF3 / R3 primers, respectively;

[0033] Figure 3 This is a flowchart of a one-step, scarless gene knockout process for *Thiobacillus acidophilus*. Detailed Implementation

[0034] The technical solution of the present invention will be further described below with reference to the accompanying drawings and specific embodiments. However, the following examples are merely simple examples of the present invention and do not represent or limit the scope of protection of the present invention. The scope of protection of the present invention shall be determined by the claims.

[0035] As described in the background section, existing technologies for gene knockout of *Thiobacillus acidophilus* suffer from problems such as a low probability of the knockout plasmid detaching from the chromosome, a low probability of selecting knockout strains, complex genetic operations, and long processing times. To address these technical issues, this invention proposes a method for scarless gene knockout of *Thiobacillus acidophilus*. This method increases the probability of the knockout plasmid detaching from the *Thiobacillus acidophilus* chromosome, increases the probability of selecting knockout strains, simplifies the genetic operations in one step, and reduces processing time.

[0036] It should be noted that the embodiments of the present invention use *Acidithiobacillus caldus* (A. caldus) and *Acidithiobacillus ferrooxidans* (A. ferrooxidans) as examples to illustrate the technical solution of the present invention. Other *Acidithiobacillus* species performing the same or similar operations will also have similar effects.

[0037] Unless otherwise specified, the experimental methods used in the following embodiments are all common techniques in the art; the reagents, consumables and strains used can all be purchased from conventional manufacturers in the art.

[0038] In this embodiment of the invention, some of the materials were sourced as follows: Trans 5K DNA Maker was purchased from Jinan Yutong Biotechnology Co., Ltd., and plasmid extraction kit and DNA purification and recovery kit were purchased from Tiangen Biotech (Beijing) Co., Ltd.

[0039] The acidophilic thermophilic thiobacillus is A. caldus MTH-04, which has been deposited at the China General Microbiological Culture Collection Center, with accession number CGMCC NO.1742, and see patent CN102604929A;

[0040] The type strain, A. ferrooxidans ATCC23270, was obtained from the American Culture Collection.

[0041] plasmids pSDUDI and pMSD1-I-SecⅠ are both disclosed in patent CN102604929A;

[0042] E. coli DH5α was purchased from Beijing Qingke Biotechnology Co., Ltd.

[0043] E.coli SM10 refers to (Liu et al., 2007). Liu,

[0044] coli and moderately thermophilic, etremely acidophilic Acidithiobacillus caldus MTH-04. Journal of microbiology and biotechnology 17,162-167.

[0045] Example 1: Knockout of the pelD gene, a protein related to the synthesis of extracellular polysaccharides in *Thiobacillus acidophilus*.

[0046] 1. Construction of pSDUDI-LacI by fusing the suicide plasmid pSDUDI with the IPTG-inducible promoter:

[0047] (1) Plasmid extraction: plasmid pSDUDI was extracted using a plasmid extraction kit and set aside for later use.

[0048] (2) Obtaining the IPTG-induced promoter

[0049] Using a plasmid containing an IPTG-inducible promoter as a template, and LacIF and LacIR as primers, PCR amplification was performed to obtain the IPTG-inducible promoter.

[0050] LacIF: CTAGAGCTCGGATCCACGCGT AAAAGGCCATCCGTCAGGA

[0051] LacIR: ACCAAGCTTCAATTGCATATG TGTTTCCTGTGTGAAATTGTTATCC

[0052] The underlined portions of primers LacIF and LacIR are lacI-P. tacO Homologous arms of gene sequences.

[0053] The PCR amplification conditions described above are: pre-denaturation at 95°C for 3 min; 95°C for 15 sec; annealing at 60°C for 15 sec; extension at 72°C for 1 min / 1 kb; 35 cycles; extension at 72°C for 5 min; and incubation at 12°C.

[0054] The PCR products were verified by 0.8% agarose gel electrophoresis to confirm the amplification results.

[0055] IPTG inducible promoter lacI-P tacO The nucleotide sequence is SEQ ID No. 1, with a sequence size of 1492 bp. The target gene product was recovered using a DNA purification and recovery kit. For specific operating procedures, please refer to the kit's instruction manual.

[0056] (3) Restriction of plasmid pSDUDI:

[0057] The suicide plasmid pSDUDI was obtained by double digestion with restriction endonucleases MluI and NdeI;

[0058] (4) Fusion of suicide plasmid pSDUDI with IPTG-inducible promoter via homologous recombination: Using the homologous recombination enzyme EEnase II, the linearized plasmid pSDUDI and the IPTG-inducible promoter fragment were mixed and reacted at 37°C for 30 min; the ligation solution was then transformed into competent E. coli DH5α cells and inoculated onto cells containing kanamycin Km r Incubate overnight at 37°C on a solid selective plate.

[0059] (5) Verification: On the second day, colonies from the plate were picked and colony PCR was performed using primers PML-SF / R. Electrophoresis was performed, and the target band of 1879 bp was obtained. The bacterial culture that had been verified by colony PCR was inoculated into 20 mL of fresh LB broth and activated overnight at 37°C and 180 rpm. The plasmid was extracted and sent to the company for sequencing. The results were correct, indicating that pSDUDI-LacI was successfully constructed.

[0060] PML-SF: CGCTTCCTCGTGCTTTAC

[0061] PML-SR: TTCGCCACCTCTGACTTG

[0062] 2. pSDUDI-LacI plasmid was fused with the I-SceI fragment to construct pSDUDI-LacI-I-SceI

[0063] (1) Using the plasmid pMSD1-I-SceI containing a wide range of endonucleases as a template, and I-SceIF1 and

[0064] I-SceIR1 was used as a primer for PCR amplification to obtain the I-SceI gene fragment product.

[0065] I-SceIF1:ACACATATGCAATTGAAGCTTATGCATCAAAAAAACCAGGTAATG

[0066] The PCR product I-SceIR1:GCTAGCCGCGGTACCAAGCTTTTATTTCAGGAAAGTTTCGGAGGA was verified by 0.8% agarose gel electrophoresis.

[0067] The I-SceI gene sequence is 702 bp in size. The target gene product was recovered using a DNA purification and recovery kit.

[0068] The nucleotide sequence of the extensive endonuclease I-SceI is SEQ ID No. 2.

[0069] (2) The plasmid pSDUDI-LacI was digested with the restriction endonuclease HindIII to obtain the linearized plasmid pSDUDI-LacI.

[0070] The linearized plasmid pSDUDI-LacI fragment and the I-SceI gene fragment were ligated using the homologous recombinase EEnase II, transformed, and the obtained positive clones were sequenced. The expression plasmid of the positive clones that were sequenced without error was the one-step knockout plasmid pSDUDI-LacI-I-SceI. The sequence of plasmid pSDUDI-LacI-I-SceI is shown in SEQ ID No. 3.

[0071] 3. Construction of the pelD gene knockout plasmid pSDUDI-LacI-I-SceI-pelD

[0072] (1) Genome extraction: The genome of wild-type A. caldus MTH-04 was extracted using a genome extraction kit and kept for later use.

[0073] (2) Using the genome of A. caldus MTH-04 as a template, PCR amplification was performed using pUHAF and pUHAR, pDHAF and pDHAR as primers, respectively, to obtain the upstream and downstream homologous arms of the pelD gene, UHA and DHA gene fragments.

[0074] pUHAF:

[0075] AGATTTCGATTGTCGACTAGTTAGGGATAACAGGGTAATGAGCTCTCGGGTACCGTGG

[0076] pUHAR:GTATCACATGCTCAGCGGTTCAAAGC

[0077] pDHAF:AACCGCTGAGCATGTGATACGCTGGCTTCTGCTCG

[0078] pDHAR:

[0079] TTTACGCGTGGATCCGAGCTCATTACCCTGTTATCCCTAATCGATCCGCCCCAGAGC

[0080] The PCR products were verified by 0.8% agarose gel electrophoresis to confirm the amplification results.

[0081] The upstream homologous arm UHA of the pelD gene has a size of 1162 bp, and its nucleotide sequence is shown in SEQ ID No. 4. The downstream homologous arm DHA of the pelD gene has a size of 1180 bp, and its nucleotide sequence is shown in SEQ ID No. 5. The target gene product was recovered using a DNA purification and recovery kit.

[0082] (3) The linearized plasmid pSDUDI-LacI-I-SceI was digested with restriction endonucleases SpeI and SacI.

[0083] (4) The linearized plasmid pSDUDI-LacI-I-SceI fragment was ligated with the upstream and downstream homologous arms of the pelD gene, UHA and DHA gene fragments, using the homologous recombinase EEnase II. The resulting positive clones were sequenced and analyzed. The expression plasmid of the positive clones that were sequenced without error was the one-step knockout plasmid pSDUDI-LacI-I-SceI-pelD.

[0084] 4. Construction of recombinant strain A. caldus MTH-04 (pSDUDI-LacI-I-SceI-pelD)

[0085] The successfully constructed knockout plasmid pSDUDI-LacI-I-SceI-pelD was transformed into competent Escherichia coli SM10 cells and used as the donor bacteria for conjugation transfer. Following the conjugation transfer method, the plasmid was transferred into the recipient bacteria A. caldus MTH-04.

[0086] Specifically, E. coli SM10 cultured to mid-log phase (LB medium, 37°C, 150 rpm / min, 3-4 h) and A. caldus acidophilus culture (Starky-S) were used. 0 Culture in the culture medium at 40℃ and 150 rpm / min for 6-8 days, centrifuge at 8000 rpm / min for 10 minutes to remove sulfur powder, wash 2-3 times with conjugation washing solution, mix at a ratio of 1:2, take 90 μL and drop it onto the filter membrane on the conjugation plate, place at 37℃ for 72 h, wash the filter membrane with 1 mL of conjugation washing solution, serially dilute the obtained cell suspension and spread it onto Starky-Na2S2O3 solid medium with kanamycin added, and culture at 40℃ for 7-10 days.

[0087] 5. Screening of knockout strains using ΔpelD

[0088] (1) Plate screening sheet exchange

[0089] Colonies were randomly selected from the plate and dissolved in sterile water. The bacterial solution was used as a template, and colony PCR was performed using the primer PDF2 / R2 inside the homologous arm of the knocked-out gene. The chromosome of the wild-type strain was used as a negative control. A large band (2289bp) was amplified. Single exchangers were screened, and a large (2289bp) and a small (1005bp) band were amplified.

[0090] PDF2:TGGACGAGTGGACCTAC

[0091] PDR2:ATCACGGCGAAGAAAGT

[0092] The selected single exchangers were cultured in vials until mid-log, then induced with IPTG (1 mol / mL) for 24 h, and then spread on Starky-Na2S2O3 solid medium containing IPTG and cultured at 40℃ for 7-10 days.

[0093] (2) Plate screening of double exchangers and further identification

[0094] Colonies were randomly selected from the plate and dissolved in sterile water. Using the bacterial solution as a template, colony PCR was performed using primers on the inner side of the homologous arm of the knockout gene. Wild-type strain chromosomes were used as a negative control. A large band was amplified. Double crossovers were screened, and a small band was amplified. Further identification: Chromosomes of the double crossovers were extracted and amplified by PCR using primers on the outer side of the homologous arm of the knockout gene (PDF1 / R1 and PDF2 / R2), and primers on the inner side of the knockout gene (PDF3 / R3). The amplification was then confirmed by electrophoresis.

[0095] PDF1:CTCAGTCAGTATGGTCCGC

[0096] PDR1:CAGAAATAATCCACAAAAGG

[0097] For the verification of double exchangers, the double exchanger, namely the knockout strain, showed a small band of 2766bp, while the wild type showed a large band of 4050bp.

[0098] PDF3:GTCCTCGTCCTCACGCACTT

[0099] PDR3:AATCCACGGGGCAGTCT

[0100] Used for verification of double exchangers, where knockout strains do not show bands, while wild-type strains show a band of 853 bp.

[0101] The vials containing the verified colonies were incubated statically to mid-log phase, and the genome was extracted for sequencing verification.

[0102] Example 2

[0103] The difference between this embodiment and Embodiment 1 is that: the acidophilic thermophilic thiobacillus is replaced with acidophilic ferrooxidizing thiobacillus A. ferrooEidans ATCC23270, and the knockout gene is replaced with the tetH gene instead of pelD. The remaining operation steps and conditions are similar to those in Embodiment 1.

[0104] The upstream homologous arm UHA sequence of the tetH gene is 1145 bp in size, and its nucleotide sequence is shown in SEQ ID No. 6;

[0105] The downstream homologous arm sequence DHA has a size of 1138 bp and its nucleotide sequence is shown in SEQ ID No. 7.

[0106] The relevant primers are shown below:

[0107] Homologous arm primers:

[0108] tUHAF: AGATTTCGATTGTCGACTAGTACCGGTGCGGTGCGGTCT

[0109] tUHAR:CCTAATCAAGTCTCCAATCCATTTGGTG

[0110] tDHAF:GGATTGGAGACTTGATTAGGTTTTCCAACGTGTTATCGG

[0111] tDHAR:

[0112] TTTACGCGTGGATCCGAGCTCATTACCCTGTTATCCCTAGTGGGTGCGGCTCCTGCG

[0113] Knockout verification primers:

[0114] PTF1: TTCCAATGTTCTTATTACCG

[0115] PTR1: TTCTAACGAAATAATCAACC (wild type 4176bp, knockout strain 2679bp)

[0116] PTF2: GGTATCAGCCGTAAGCAAC

[0117] PTR2: GCCAGGGACATAACTAAAT (single swap 2545bp, 1048bp wild type 2545bp)

[0118] PTF3: CGAGTCCTGTCGGAAATAA

[0119] PTR3: CCTTTGTAATAGGTTGGAG (wild type 817bp, knockout strain 0bp)

[0120] Comparative Example 1: Procedure for knocking out the pelD gene using traditional knockout methods

[0121] Both donor and recipient bacteria were cultured to mid-logarithmic growth. The suicide plasmid pSDUDI, containing the homologous arm of the knockout gene, was transferred into *A. caldus* via conjugation transfer. The colonies were plated and incubated statically. Single colonies were randomly picked from the plates, and colony PCR was performed using primers on the inner side of the knockout gene homologous arm to verify colony PCR and screen for single-exchange strains. The selected single-exchange strains were first inoculated into small Erlenmeyer flasks and incubated statically, then inoculated into large Erlenmeyer flasks and cultured to mid-logarithmic growth. A second conjugation transfer was performed, and the negative selection marker I-SceI enzyme expression plasmid pMSD1-I-SecⅠ was transferred into the single-exchange strains. The colonies were plated and incubated statically to screen for knockout strains. Since plasmid pMSD1-I-SecⅠ is not a suicide plasmid, to rule out its influence on strain growth, the selected knockout strains were plated and the plasmid was lost through subculturing on the plates, ultimately yielding the knockout strains.

[0122] Table 1 shows a comparison of gene knockout efficiencies between the examples and Comparative Example 1. Compared to the traditional method in Comparative Example 1, the one-step method in Examples 1 and 2 only requires one conjugation and does not involve plasmid loss, thus halving the gene knockout time. The double-exchange screening efficiency is also significantly higher than that of the traditional method in Comparative Example 1, demonstrating beneficial effects. Experiments show that the one-step method of this invention, when applied to *Thiobacillus acidophilus*, can shorten its gene knockout time and improve exchange screening efficiency.

[0123] Table 1 Comparison of gene knockout efficiency between the examples and the comparative examples

[0124]

[0125] IPTG inducible promoter lacI-P tacO The nucleotide sequence is SEQ ID No. 1, as follows:

[0126]

[0127] The nucleotide sequence of the meganuclease I-SceI is SEQ ID No.2 as follows:

[0128] ATGCATCAAAAAAACCAGGTAATGAACCTGGGTCCGAACTCTAAACTGCTGAAAGAATACAAATCCCAGCTGATCGAACTGAACATCGAACAGTTCGAAGCAGGTATCGGTCTGATCCTGGGTGATGCTTACATCCGTTCTCGTGATGAAGGTAAAACCTACTGTATGCAGTTCGAGTGGAAAAACAAAGCATACATGGACCACGTATGTCTGCTGTACGATCAGTGGGTACTGTCCCCGCCGCACAAAAAACAACGTGTTAACCACCTGGGTAACCTGGTAATCACCTGGGGCGCCCAGACTTTCAAACACCAAGCTTTCAACAAACTGGCTAACCTGTTCATCGTTAACAACAAAAAAACCATCCCGAACAACCTGGTTGAAAACTACCTGACCCCGATGTCTCTGGCATACTGGTTCATGGATGATGGTGGTAAATGGGATTACAACAAAAACTCTACCAACAAATCGATCGTACTGAACACCCAGTCTTTCACTTTCGAAGAAGTAGAATACCTGGTTAAGGGTCTGCGTAACAAATTCCAACTGAACTGTTACGTAAAAATCAACAAAAACAAACCGATCATCTACATCGATTCTATGTCTTACCTGATCTTCTACAACCTGATCAAACCGTACCTGATCCCGCAGATGATGTACAAACTGCCGAACACTATCTCCTCCGAAACTTTCCTGAAATAA。

[0129] The sequence of plasmid pSDUDI-LacI-I-SceI is shown in SEQ ID No.3 as follows:

[0130]

[0131] The UHA sequence of the upstream homologous arm of the pelD gene is shown in SEQ ID No. 4, as follows:

[0132]

[0133] The DHA sequence of the downstream homologous arm of the pelD gene is shown in SEQ ID No. 5, as follows:

[0134]

[0135] The UHA sequence of the upstream homologous arm of the tetH gene is shown in SEQ ID No. 6, as follows:

[0136]

[0137] The downstream homologous arm sequence, DHA, is shown in SEQ ID No. 7, as follows:

[0138] TAGGTTTTCCAACGTGTTATCGGCCGGACCGATAACACGTAACCAGCCAGCCATCTGCCTCGTTAGCTTTCTGGTCAACGAAACCAGCACGCCCGGGGCGATGTCTGAAGGAGATAGATATGGGGAAGAGGAAACAACCAAAAAAATATGCAATATATGCCGTTGCCGTTGCCGTTCTGGCTGCGGGTTCAATAGATTCTGCCGCTGCTGCAAATTGGTTCAAGCTGGAAGGTATCTCTCCAGTACAAGCACCGCTGTTAAACTTCAGCGGGTTCTTTATTCCGCTTTACAAATACATGAATGGCACAGCGGCAGAAAATGGCCAGACTCCGAGGTTTAACCTGGTGGCACCTCAAGACACATCCAGCAAGTCATTTAATATTCTCTTTGCGCATATCATGCTGCGAGGAAATATCAATAAGCATATTTCATATATGTTGGCCGGCGAGTTCGGGAACAATCAGTTCACTCATGTTGGCGGCAACTATACACCACAGCTTATGGACGCCCATGCTACATTTAGTTATGTCCCTGGCGCCCGCTTTGAAGTAGGTATCATCCGCGCACCAGGTCCGGAAGAGGATATGCAGGGATACCCGAACTTTGCGTTTGGGTTCAATTATAGTACCGTCGTACAACAACTGATGTTGCAGCCGTTTTATTCAACAAATACCAATTATGGGTCAGGGCCATACGAAAGTTATTCTGTTCCCGGTAAAAACATAATGGGAAACAACGCATTCAGATATCCTGGTGCGGAAGTAATGGACTGGTTCCGTGCGGGAAATATGGAGTACGCCTATGGCGTGATGGTCGGCAACTTTGGACCTCTGGTGGCGACCAACACCTCGAGCGGAGCGCTCGTCGCAGCGCGCCTGCAGGCGTCTTACATTTTAAAAGGGTTTGGGCCAATTCATGGACCATTTCGCAGTGACGTGACGGGATTCCTCTGGTATCAGCATGCGAACCCCATTTTTAATGGACAATCC

[0139] TACTCCATG

[0140] ACACGGGATGGACTTGGTCTGACGTATACGGCAGGGATATATGCACCGTTGGGGAAGATGGCTCAAGTTTGAATATATCCGTGGCTCCGGAATGATCGATGCCCCCGCGGTGTTTAATGCCTACGCAGGAGCCGCACCCAC.

[0141] While the specific embodiments of the present invention have been described above, they are not intended to limit the scope of protection of the present invention. Those skilled in the art should understand that various modifications or variations that can be made by those skilled in the art without creative effort based on the technical solutions of the present invention are still within the scope of protection of the present invention.

Claims

1. A method for scarless knockout of the *Thiobacillus acidophilus* gene, characterized in that, include: Will I-SceI Gene- and IPTG-inducible promoters lacI-PtacO The gene was recombined with the suicide plasmid pSDUDI to construct the pSDUDI-LacI-I-SceI gene knockout plasmid, and expression was induced by IPTG. I-SceI Enzyme knockout of target gene; This includes: double digestion of the suicide plasmid pSDUDI to obtain a linearized fragment, and the addition of an IPTG-inducible promoter. lacI- P tacO The gene fragment and the linearized fragment were ligated using homologous recombinase to construct the pSDUDI-LacI plasmid; pSDUDI-LacI plasmid and I-SceI Gene fragments were ligated using homologous recombinase to construct the pSDUDI-LacI-I-SceI plasmid; The homologous arm fragment of the target gene to be knocked out in Thiobacterium acidophilus was ligated with the pSDUDI-LacI-I-SceI vector using homologous recombinase to construct a gene knockout plasmid. The gene knockout plasmid was transformed into competent E. coli, then conjugated and transferred into Thiobacillus acidophilus, and screened to obtain gene knockout Thiobacillus acidophilus.

2. The method for scarless knockout of the *Thiobacillus acidophilus* gene as described in claim 1, characterized in that, The suicide plasmid pSDUDI was double-digested with restriction endonucleases MluI and NdeI to obtain a linearized fragment; or, the homologous recombinase was Exnase II; or, the IPTG-inducible promoter gene fragment was amplified by PCR using a plasmid containing an IPTG-inducible promoter as a template. lacI- P tacO .

3. The method for scarless knockout of the *Thiobacillus acidophilus* gene as described in claim 1, characterized in that, Acidophilic thiobacilli are either acidophilic thermophilic thiobacilli or acidophilic ferrous thiobacilli.

4. The method for scarless knockout of the *Thiobacillus acidophilus* gene as described in claim 1, characterized in that, Suicide plasmid pSDUDI and IPTG-inducible promoter lacI- P tacO The pSDUDI-LacI plasmid was constructed by fusion using the homologous recombinase Exnase II, transformed, and cultured.

5. The method for scarless knockout of the *Thiobacillus acidophilus* gene as described in claim 4, characterized in that, Suicide plasmid pSDUDI and IPTG-inducible promoter lacI- P tacO The fusion reaction conditions were 37°C and water bath heating for 30 minutes.

6. The method for scarless knockout of the *Thiobacillus acidophilus* gene as described in claim 1, characterized in that, With nuclease-containing I-SceI Using the plasmid pMSD1-I-SceⅠ as a template, the gene fragment was amplified by PCR to obtain... I-SceI Gene fragments; Alternatively, using the genome of Thiobacillus acidophilus as a template, PCR amplification can be performed on gene fragments of the upstream and downstream homologous arms of the gene to be knocked out.

7. The method for scarless knockout of the *Thiobacillus acidophilus* gene as described in claim 1, characterized in that, Linearized plasmid pSDUDI-LacI fragment and I-SceI The gene fragments were ligated using the homologous recombinase Exnase II to construct the pSDUDI-LacI-I-SceI plasmid, which was then transformed and cultured.

8. The method for scarless knockout of the *Thiobacillus acidophilus* gene as described in claim 1, characterized in that, The target gene is pelD The gene was digested with restriction endonucleases SpeI and SacI to obtain the linearized pSDUDI-LacI-I-SceI plasmid. pelD Upstream and downstream homologous arms of the UHA and DHA gene fragments were ligated using the homologous recombinase Exnase II to construct the knockout plasmid pSDUDI-LacI-I-SceI- pelD .

9. The method for scarless knockout of the *Thiobacillus acidophilus* gene as described in claim 1, characterized in that, The constructed knockout plasmid pSDUDI-LacI-I-SceI- pelD The plasmid was transformed into competent Escherichia coli cells to obtain donor bacteria for conjugation transfer. The plasmid was then transferred into the recipient bacteria, Thiobacillus acidophilus, using the conjugation transfer method.

Images