A SNP marker affecting early growth traits of cashmere goats and its application

Abstract

The present invention relates to the field of genetic breeding technology, and more specifically to a SNP marker that affects the early growth traits of cashmere goats and its application. The SNP marker includes marker one and / or marker two; the nucleotide sequence of marker one is shown in SEQ ID NO.1, and a mutation from A to G occurs at the 101bp site; the nucleotide sequence of marker two is shown in SEQ ID NO.2, and a mutation from T to G occurs at the 101bp site; the marker one affects the growth traits of cashmere goats at birth; the marker two affects the growth traits of cashmere goats after weaning. The present invention increases the birth weight of offspring by selecting individuals with AA and TT genotypes as the father or mother.

Description

Technical Field

[0001] The invention relates to the technical field of genetic breeding, and more specifically to a SNP marker affecting early growth traits of cashmere goats and an application thereof. Background Art

[0002] Inner Mongolia Cashmere Goats are an excellent local livestock breed bred through long-term natural selection and artificial system selection, and have important economic value. The growth and development of lambs after birth has a great impact on reproduction and production performance. With the changes in feeding methods and environment, how to improve the growth rate of cashmere goats has become one of the urgent problems to be solved. Birth weight and weaning weight are two important indicators to measure the growth rate of cashmere goats. Birth weight refers to the weight of cashmere goats at birth, and weaning weight refers to the weight of cashmere goats at weaning. These two indicators have a significant impact on the growth rate of cashmere goats. However, the existing technology does not consider the birth weight and weaning weight of cashmere goats at the same time, so it is very necessary to explore the molecular markers that affect the birth weight and weaning weight of Inner Mongolia cashmere goats at the genome level. Summary of the invention

[0003] To solve the above problems, the present invention provides a SNP marker affecting the early growth traits of cashmere goats and its application, so as to improve the growth rate of cashmere goats.

[0004] The present invention is achieved through the following technical solutions:

[0005] A SNP marker affecting early growth traits of cashmere goats, the SNP marker comprising marker one and / or marker two;

[0006] The nucleotide sequence of the marker 1 is shown in SEQ ID NO.1, and a mutation from A to G occurs at the 101 bp position;

[0007] The nucleotide sequence of the marker 2 is shown in SEQ ID NO.2, and a mutation from T to G occurs at the 101 bp position;

[0008] The nucleotide sequence of the molecular marker of the marker 2 is shown in SEQ ID NO.1, specifically: AACGTCATGAACACTGCGACAGAGGGAAGGAACTCCAAGCCAGGGAGAACAGTGAGCCCTGGGTGCTGCCCCCTGAGTAAGGCAGGCAGGCAGGGGCACCAGCTCTCCTTGGGGACCACACAGAGGGGCTGAGTACTTTACTATTTAGCGCTCTGGAGGCTTGAGGCCACCCTGGAGGGTTAATGTGTACAAAGAGCTGCC, showing the sequences of 100 bp upstream and downstream of the mutation site, and a mutation from A to G occurred at the 101st site.

[0009] The nucleotide sequence of the molecular marker of the marker 2 is shown in SEQ ID NO.2, specifically: TTAGTCTTAATTAAGTATCTTAATCTTCCCAGGTTAAGGGCAGAAAAGTAAGAGAAAGCAGGCAGCCACGGGTGGACCCTTCGTAAGAGTGTGTCCTGGATGCCCTGGAGCCCTGCATCGCGGCTGACCCGGGTGTGTACATCCGGGGTTTGATATAGAAGGAAGATGAACGTGGAGAAGAAACACGTCTGACACCTCTTTC, showing the sequence of 100 bp upstream and downstream of the mutation site, and a mutation from T to G occurred at the 101st site.

[0010] The SNP marker is used for identifying the birth weight and weaning weight of cashmere goats, and the SNP marker includes the marker one and / or the marker two.

[0011] When the base of the marker one is A, it is a cashmere goat that is newly born and heavy; when the base of the marker two is T, it is a cashmere goat that is heavy at weaning.

[0012] Preferably, identifying the birth weight and weaning weight of cashmere goats comprises the following steps:

[0013] Extract genomic DNA from ear tissue of cashmere goats;

[0014] The genomic DNA is broken into DNA fragments, and then a library is constructed using the DNA fragments, and the library is sequenced to obtain sequencing data;

[0015] The sequencing data is subjected to identification and screening of variant sites, and the marker 1 on chromosome 14 of cashmere goats is detected by genome-wide association analysis. When the base of the marker 1 is A, it is a newly born cashmere goat;

[0016] The marker 2 on chromosome 23 of cashmere goats is detected, and the base of the marker 2 is T, which is a significant weaning cashmere goat.

[0017] A genetic method for cashmere goats with large phenotypic values ​​of early growth traits, by selecting individuals with AA and TT genotypes as parents, to increase the birth weight of offspring.

[0018] Preferably, the cashmere goats are Inner Mongolia cashmere goats.

[0019] Compared with the prior art, the present invention has the following beneficial effects:

[0020] The present invention provides a SNP marker affecting the early growth traits of cashmere goats and its application. Two SNP markers affecting the early growth traits of cashmere goats, marker 1 and marker 2, are screened out through genome sequencing, identification of variant sites, genome-wide association analysis and other methods. The markers are used to identify the birth weight and weaning weight of the early growth traits of cashmere goats, and the birth weight of offspring is increased by selecting AA and TT genotype individuals as sires or dams. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0022] Figure 1 This is the distribution diagram of SNPs in the 1Mb window of chromosome after quality control;

[0023] Figure 2 is the principal component analysis diagram;

[0024] Figure 3 The Manhattan plot shows the results of genome-wide association analysis of birth weight traits of Inner Mongolia cashmere goats;

[0025] Figure 4 is the quantile-quantile plot of birth weight traits;

[0026] Figure 5 The Manhattan plot shows the results of genome-wide association analysis of weaning weight traits in Inner Mongolia cashmere goats;

[0027] Figure 6 This is the quantile-quantile plot of the weaning weight trait. DETAILED DESCRIPTION

[0028] In order to facilitate the understanding of the present invention, the present invention will be described more comprehensively below, and preferred embodiments of the present invention are provided. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present invention more thorough and comprehensive.

[0029] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art of the present invention. The terms used in the specification of the present invention herein are only for the purpose of describing specific embodiments and are not intended to limit the present invention.

[0030] The technical solution of the present invention will be further described below in conjunction with specific embodiments.

[0031] Example

[0032] Part I: Experimental animals and phenotype sources.

[0033] The experimental goats in this study were all from Erlangshan Ranch of Inner Mongolia Beiping Textile Co., Ltd. and Erlangshan National Seed Conservation Farm of Inner Mongolia Cashmere Goats. The cashmere goats raised were all Erlangshan Inner Mongolia Cashmere Goats. The birth weight and weaning weight were measured according to the method described in Table 1. Ear tissue samples were collected from 212 Inner Mongolia Cashmere Goats. All samples were immediately stored in liquid nitrogen after collection and stored at -80℃ for a long time after being transported to the laboratory.

[0034] Table 1 Determination method of early growth traits of Inner Mongolia cashmere goats

[0035]

[0036] Part 2: Genomic DNA extraction and quality inspection.

[0037] DNA extraction:

[0038] 1. Cut pea-sized tissue samples into 1.5 ml sterilized EP centrifuge tubes and chop as finely as possible; add 0.5 ml tissue lysis buffer STE, 50 μl 10% SD S, and 10 μl proteinase K, mix well; digest in a 55°C water bath overnight.

[0039] 2. Add an equal volume of about 500 μl of Tris-saturated phenol to each EP centrifuge tube, shake to mix thoroughly for 5 minutes, and then centrifuge at 12000 rpm for 5 minutes.

[0040] 3. Repeat step 2.

[0041] 4. Take the supernatant and put it into a new EP centrifuge tube. Add 500 μl of 25:24:1 phenol:chloroform:isoamyl alcohol, mix thoroughly and centrifuge at 12000 rpm for 5 min.

[0042] 5. Take the supernatant and put it into a new EP centrifuge tube. Add twice the volume of about 1 mL of ice isopropanol and shake horizontally. White flocculent DNA precipitate can be seen.

[0043] 6. Discard the ice isopropanol and wash the DNA with 75% ethanol. After shaking and washing, centrifuge at 12,000 rpm for 10 minutes.

[0044] 7. Discard 75% ethanol, dry naturally, and then add 100 μl of sterilized ddH2O to dissolve.

[0045] DNA quality test:

[0046] A NanoDrop2000 spectrophotometer was used to detect DNA concentration, the absorption wavelength ratio of the highest absorption peaks of nucleic acids, proteins and phenols was 260:280, and the absorption wavelength ratio of the highest absorption peak of carbohydrates was 260:230. 1% agarose gel was used to evaluate DNA quality.

[0047] The third part is library construction and sequencing.

[0048] The genomic DNA samples that passed the quality inspection were randomly interrupted into 350bp fragments using a Covaris ultrasonic crusher. The DNA fragments were repaired at the end, polyA was added, sequencing adapters were added, purified, PCR amplified, and other steps to complete the entire library preparation. After the library was constructed, Qubit2.0 was used for preliminary quantification, and the effective concentration of the library was accurately quantified using the qPCR method to ensure the quality of the library. After the library quality inspection was qualified, the sequencing was performed using the BGI-T7 sequencing platform, and the sequencing mode was PE150 mode to obtain the original sequencing data.

[0049] Part 4: Identification, screening and annotation of variant sites.

[0050] The raw sequencing data were quality controlled and preprocessed using fastp software version V0.20.0 to obtain the sequencing data Clean reads data, and a genome index was established for the reference genome. The quality-controlled Clean reads data were aligned with the goat reference genome ARS1, GCF_001704415.1 using Burrows-Wheeler Aligner software version V0.7.17. The aligned sam files were converted into bam files and sorted using SAMtools software version V1.8-20. The MarkDuplicates program in the Genome Analysis Toolkit software version V3.8 was used to remove duplicate data from the sorted bam files to obtain the final bam files. The final bam files were indexed, and the HaplotypeCaller module in the GATK software was used to detect SNP variations. After obtaining the vcf file, the VariantFiltration module was used for filtering. The ANNOVAR software package was used to perform functional annotation on the detected gene variants. Based on the location of the variant site on the reference genome and the gene location information on the reference genome, the region where the variant site occurred in the genome, such as the intergenic region, intron region or CDS region, and the impact of the variant, such as synonymous and non-synonymous mutations, were obtained.

[0051] Part V: Data quality control and population stratification correction.

[0052] Detection rate, English name is call rate; Minimum allele frequency, English abbreviation is MAF; Hardy-Weinberg equilibrium, English abbreviation is HWE.

[0053] The obtained genotyping data were quality controlled using Plink software version 1.90, and individuals with genotype detection rates < 90%, SNPs with detection rates < 95%, SNPs with minimum allele frequencies < 5%, and Hardy-Weinberg equilibrium test P values ​​< 10 were excluded. -6 A total of 34,248,064 SNPs were involved in quality control, and 460,822 SNPs with a detection rate less than 95% were eliminated. The remaining sites were filtered by Hardy-Weinberg equilibrium, minimum allele frequency, and individual detection rate, and a total of 17,258,261 SNPs were obtained for subsequent analysis. These sites are evenly distributed on the 29 pairs of autosomes of goats, such as Figure 1 The first three principal components were calculated using the "--pca3" parameter of the Plink software version V1.90, and the first three principal components were used as covariates to correct the population stratification phenomenon of the Erlangshan type Inner Mongolian cashmere goats. The PCA graph was drawn using the R software version V3.6.0, and the results are shown in Figure 2 As shown in the figure, there is population stratification in the test samples, and the genetic correlation between individuals is high. The first three principal components need to be used as covariates to correct the population stratification phenomenon of Inner Mongolia Cashmere Goats.

[0054] Part VI, genome-wide association analysis.

[0055] The fastGWA-mlm model in the GCTA software V1.94.0beta was used to perform association analysis between SNP and birth weight traits. The formula is as follows:

[0056] y=Xα+Zβ+Wu+e

[0057] where y is the phenotype vector; α is the vector of fixed effects, including sex, field, and birth type; β is the genotype vector; u is the random effect; X is the association matrix of α, Z is the association matrix of β, and W is the association matrix of u; and e is the residual vector.

[0058] Because the Bonferroni correction method was used to determine the significance threshold for genome-wide association analysis, it was too strict. In this study, the threshold for genome-wide significant association was adjusted to P = 1 × 10 -6 The genomic inflation factor of the test statistic, λ, was calculated from the slope of the linear regression between the observed and theoretical quantiles in R software version 3.6.0. Figure 4 As shown, the lambda value of the birth weight trait is 0.952, indicating that there is no genome expansion and the result is credible; Figure 6 As shown in Table 2, the lambda value of the weaning weight trait is 1.025, indicating that there is no genome expansion and the result is credible. Based on the resequencing data of 212 Erlangshan white cashmere goats, 17 significant SNP loci associated with the birth weight trait were detected. These loci are located on chromosomes 3, 10, 14, and 19, as shown in Table 2 and Figure 3 As shown in Table 3 and Figure 5 shown.

[0059] Table 2 Significant SNP loci associated with birth weight traits

[0060]

[0061] Table 3 Significant SNP loci associated with weaning weight

[0062]

[0063] Part VII, SNPs affecting early growth traits.

[0064] Further study of the SNPs that reached the genome-wide significance level revealed that the A→G mutation at position 54137103 on chromosome 14 of the goat genome can significantly affect the birth weight trait of cashmere goats.

[0065] The association analysis between the SNP locus at 54137103 on chromosome 14 of the goat genome and the birth weight trait is as follows:

[0066] Table 4 Polymorphism at position 54137103 on chromosome 14 of goat genome

[0067]

[0068] Note: Different letters indicate significant differences. p <0.05, the same letter indicates no significant difference, p >0.05

[0069] It can be seen from Table 4 that the birth weight of individuals with genotype AA is the largest, while the birth weight of individuals with genotype GG is the smallest.

[0070] In the whole genome association analysis using a mixed linear model, the SNP molecular marker at position 54137103 on chromosome 14 of the goat genome reached a genome-wide significant level, indicating that the marker was significantly correlated with the birth weight trait of cashmere goats, and when the genotype of the marker was AA, it was beneficial for cashmere goats to have a larger birth weight.

[0071] Table 5 SNP gene frequency and genotype frequency at position 54137103 on chromosome 14 of goat genome

[0072]

[0073] As can be seen from Table 5, the gene frequency of A is greater than that of G, indicating that A is the dominant allele; the genotype frequencies of AA and GA are both higher than those of GG, indicating that AA is the dominant allele type.

[0074] Further study of the SNPs that reached the genome-wide significance level revealed that the T→G mutation at position 16477721 on chromosome 23 of the goat genome can significantly affect the weaning weight trait of cashmere goats.

[0075] The association analysis between the SNP locus 16477721 on chromosome 23 of the goat genome and the weaning weight trait is as follows:

[0076] Table 6 Polymorphism at position 16477721 on chromosome 23 of goat genome

[0077]

[0078] Note: Different letters indicate significant differences. p <0.05, the same letter indicates no significant difference, p >0.05

[0079] It can be seen from Table 6 that the weaning weight of individuals with genotype TT is the largest, while the weaning weight of individuals with genotype GG is the smallest.

[0080] In the whole genome association analysis using a mixed linear model, the SNP molecular marker at position 16477721 on chromosome 23 of the goat genome reached a genome-wide significant level, indicating that the marker was significantly correlated with the birth weight trait of cashmere goats, and when the genotype of the marker was TT, it was beneficial for cashmere goats to have a larger weaning weight.

[0081] Table 7 SNP gene frequency and genotype frequency at position 16477721 on chromosome 23 of goat genome

[0082]

[0083] As can be seen from Table 7, the gene frequency of T is greater than that of G, indicating that T is the dominant allele; the genotype frequencies of TT and TG are both higher than GG, indicating that TT is the dominant allele.

[0084] It can be seen from this that the A→G mutation at position 54137103 on chromosome 14 of the goat genome can be used to select cashmere goat breeds with heavier weight at birth, the T→G mutation at position 16477721 on chromosome 23 of the goat genome can be used to select cashmere goat breeds with heavier weight at weaning, and the birth weight of offspring can be increased by selecting individuals with AA and TT genotypes as the father or mother.

[0085] It should be noted that when the claims of the present invention involve numerical ranges, it should be understood that the two endpoints of each numerical range and any numerical value between the two endpoints can be selected. In order to avoid redundancy, the present invention describes a preferred embodiment.

[0086] The technical features of the above-described embodiments may be arbitrarily combined. To make the description concise, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0087] The above-mentioned embodiments only express several implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. Application of SNP markers in identifying birth weight and weaning weight of cashmere goats, It is characterized in that The SNP marker includes marker one and / or marker two; The nucleotide sequence of the marker 1 is shown in SEQ ID NO.1, and a mutation from A to G occurs at the 101 bp position; The nucleotide sequence of the marker 2 is shown in SEQ ID NO.2, and a mutation from T to G occurs at the 101 bp position; The marker 1 affects the growth characteristics of cashmere goats after birth; the marker 2 affects the growth characteristics of cashmere goats after weaning; When the base at the 101 bp position of the marker 1 is A, it is a newborn cashmere goat; when the base at the 101 bp position of the marker 2 is T, it is a weaned cashmere goat; The cashmere goats are Inner Mongolia cashmere goats.

2. Use of the SNP marker according to claim 1 in identifying the birth weight and weaning weight of cashmere goats, It is characterized in that Identification of cashmere goat birth weight and weaning weight includes the following steps: Extract genomic DNA from ear tissue of cashmere goats; The genomic DNA is broken into DNA fragments, and then a library is constructed using the DNA fragments, and the library is sequenced to obtain sequencing data; The sequencing data was subjected to identification and screening of variant sites, and the marker 1 on chromosome 14 of cashmere goats was detected by genome-wide association analysis. When the base at the 101 bp position of the marker 1 was A, it was a newly born cashmere goat; The marker 2 on chromosome 23 of cashmere goats was detected, and the base at the 101 bp position of the marker 2 was T, which was the time for weaning of cashmere goats.

3. Application of SNP markers in genetic breeding of cashmere goats, It is characterized in that The SNP marker includes marker one and / or marker two; The nucleotide sequence of the marker 1 is shown in SEQ ID NO.1, and a mutation from A to G occurs at the 101 bp position; The nucleotide sequence of the marker 2 is shown in SEQ ID NO.2, and a mutation from T to G occurs at the 101 bp position; The marker 1 affects the growth characteristics of cashmere goats after birth; the marker 2 affects the growth characteristics of cashmere goats after weaning; By selecting individuals with AA and TT genotypes as parents, the birth weight of offspring can be increased; The cashmere goats are Inner Mongolia cashmere goats.

Images