Common wheat SNP site markers and their application in the detection of lutein content in wheat grains
By detecting the Ta-5B-SNP52 site haplotype in the wheat genome and utilizing the KASP reaction technology, the problem of low breeding selection efficiency in existing technologies has been solved, enabling efficient screening and breeding of wheat varieties with high lutein content.
Patent Information
- Application Number
- CN202310336318.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-03-31
- Publication Date
- 2026-06-30
- Estimated Expiration
- 2043-03-31
AI Technical Summary
The lack of tightly linked molecular markers for wheat grain lutein content in existing technologies leads to low breeding selection efficiency and makes it difficult to effectively increase the lutein content in wheat grains.
A substance was developed to detect the Ta-5B-SNP52 site haplotype in the wheat genome. By designing specific primers and PCR kits, genotyping was performed using KASP reaction technology to identify or screen wheat with high lutein content in grains, and to breed varieties with high lutein content.
This method enables efficient identification and screening of lutein content in grains, significantly increasing the lutein content in wheat grains and improving the efficiency and effectiveness of breeding selection.
Smart Images

Figure BDA0004156569080000051 
Figure BDA0004156569080000061 
Figure BDA0004156569080000071
Abstract
Description
Technical Field
[0001] This invention belongs to the fields of molecular detection technology and crop genetics and breeding, and relates to the marking of common wheat SNP sites and their application in the detection of lutein content in wheat grains. Background Technology
[0002] Lutein is a dihydroxy carotenoid containing an ionone ring, widely found in plants. Also known as "plant lutein" or "eye gold," it possesses coloring, antioxidant, and anti-atherosclerotic functions, and is used to prevent age-related macular degeneration, cataracts, cardiovascular sclerosis, and coronary heart disease (Fraser and Bramley 2004; Giordano et al. 2018; Oliver and Palou 2000). Currently, due to population aging and lutein deficiency, over 2.2 billion people worldwide suffer from visual impairment, posing new challenges to visual health. Since the human body cannot synthesize lutein, it must be obtained exogenously from vegetables, fruits, and eggs. However, due to economic conditions and dietary habits, many people still cannot afford foods other than staple foods. Therefore, increasing the lutein content of staple crops is an effective way to supplement lutein.
[0003] Wheat is my country's second largest staple food crop. Wheat grains are rich in natural pigments called carotenoids, of which lutein accounts for 80–90% (Digesù et al. 2009). In recent years, the appearance and nutritional quality of flour and flour products have received much attention and have become important goals for wheat quality improvement (Ashokkumar et al. 2020; Colasunno et al. 2019; Zhang et al. 2013). Considering the indispensable role of lutein in human nutrition and the importance of flour in providing dietary calories, increasing the lutein content of wheat grains through biofortification holds promise for supplementing lutein through daily diet. Assisted selection using molecular markers closely linked to genes or QTLs related to lutein content in wheat grains can significantly improve breeding selection efficiency and is of great significance for accelerating the improvement and breeding of wheat varieties with high lutein content.
[0004] Although some QTLs associated with lutein content in wheat grains have been identified, tightly linked molecular markers suitable for molecular breeding have not yet been reported. Therefore, further research into functional markers that can be used to identify lutein content in wheat grains is of great significance. Summary of the Invention
[0005] To address the aforementioned problems, the present invention aims to provide a method for detecting substances of the Ta-5B-SNP52 site haplotype in the wheat genome.
[0006] In a first aspect, the present invention provides the application of a substance for detecting the Ta-5B-SNP52 haplotype of the SNP site in the wheat genome in any of the following:
[0007] 1) To identify or assist in the identification of lutein content in wheat grains;
[0008] 2) Screening or assisted screening of wheat with high lutein content in the grains;
[0009] 3) Select wheat varieties with high lutein content in their grains;
[0010] The SNP site Ta-5B-SNP52 is the 52nd position of SEQ ID NO: 4.
[0011] In the application described above, the SNP site Ta-5B-SNP52 has a TT, CC, or CT haplotype.
[0012] In the application described above, the substance used to detect the Ta-5B-SNP52 haplotype of the SNP site in the wheat genome is either A1) or A2):
[0013] A1) Primer set;
[0014] A2) PCR reagents or kits containing the complete set of primers described above;
[0015] The primer set includes primer 1, primer 2 and primer 3;
[0016] The nucleotide sequence of primer 1 includes the sequence shown in positions 22-40 of SEQ ID NO: 1;
[0017] The nucleotide sequence of primer 2 includes the sequence shown in positions 22-40 of SEQ ID NO: 2;
[0018] The nucleotide sequence of primer 3 is SEQ ID NO: 3.
[0019] In the application described above, the nucleotide sequence of primer 1 is SEQ ID NO: 1;
[0020] The nucleotide sequence of primer 2 is SEQ ID NO: 2.
[0021] Secondly, the present invention provides any of the following substances:
[0022] The primer set described in the first aspect;
[0023] Alternatively, PCR reagents or kits containing the primer set described in the first aspect.
[0024] The PCR reagents mentioned above include primer 1, primer 2, primer 3, and KASP Master mix (LGC Biosearch, KBS-1050-122);
[0025] The molar ratio of primer 1, primer 2, and primer 3 is 1:1:2.5.
[0026] In the embodiments of this aspect, the concentration of primer 1 in the PCR reagent is 168 nM, the concentration of primer 2 in the PCR reagent is 168 nM, and the concentration of primer 3 in the PCR reagent is 420 nM.
[0027] Thirdly, the present invention provides the use of the primer kits described in the first aspect, and the PCR reagents or kits described in the second aspect, in any of the following:
[0028] 1) To identify or assist in the identification of lutein content in wheat grains;
[0029] 2) Screening or assisted screening of wheat with high lutein content in the grains;
[0030] 3) Select wheat varieties with high lutein content in their grains.
[0031] Fourthly, the present invention provides a method for identifying or assisting in the identification of lutein content in wheat grains, which involves detecting whether the SNP site Ta-5B-SNP52 in the wheat genome is TT or CC, and the lutein content of the wheat grains to be tested with the Ta-5B-SNP52 site haplotype TT is greater than or candidate greater than that of the wheat grains to be tested with the Ta-5B-SNP52 site haplotype CC.
[0032] Fifthly, the present invention provides a method for breeding wheat with high grain lutein content, which involves detecting whether the SNP site Ta-5B-SNP52 in the wheat genome is TT or CC, selecting wheat with the Ta-5B-SNP52 site haplotype TT for breeding, and obtaining the target wheat.
[0033] The method described above, which involves detecting whether the haplotype of the SNP site Ta-5B-SNP52 in the wheat genome is TT or CC, includes the following steps: using the wheat grain genome to be tested as a template, performing a KASP reaction with the PCR reagent described in the second aspect to obtain the haplotype.
[0034] The KASP reaction procedure described above is as follows:
[0035] Pre-denaturation at 94℃ for 15 min; denaturation at 94℃ for 20 s; annealing and extension at 61-55℃ for 60 s, 10 cycles, with a decrease of 0.6℃ per cycle; denaturation at 94℃ for 20 s, annealing and extension at 55℃ for 60 s, 32 cycles; 37℃ for 1 min, 37℃ for 1 s (scan fluorescence values for genotyping).
[0036] In the above text, the amplification products were detected using a Bio-RAD CFX96 real-time PCR instrument, and the KASP reaction was used to obtain the haplotypes. Genotyping was then performed based on the fluorescence data.
[0037] If the fluorescence signal of the amplified product aggregates in a sample close to the X-axis, it is a FAM fluorescent tag sequence, then the haplotype of the wheat Ta-5B-SNP52 site to be tested is TT homozygous;
[0038] If the fluorescence signal of the amplified product aggregates in a sample close to the Y-axis, it is a sample linked to a HEX fluorescent tag sequence, then the haplotype of the wheat Ta-5B-SNP52 site to be tested is CC homozygous.
[0039] This invention utilizes molecular markers to identify a SNP locus, Ta-5B-SNP52, on wheat chromosome 5B. Based on this SNP locus, a molecular marker was developed. Marker / trait association analysis in wheat microcore germplasm revealed a highly significant correlation between the SNP locus and lutein content in wheat grains (P<0.01), and its application was further validated during breeding. Furthermore, this marker is a KASP marker, exhibiting good reproducibility and low cost, demonstrating promising application prospects in marker-assisted selection and molecular design breeding for increasing lutein content in wheat grains. Attached Figure Description
[0040] Figure 1 HPLC peak chromatograms and standard curves of standards at different concentrations (A) and HPLC peak chromatogram of wheat sample (B).
[0041] Figure 2 The binocular distribution of Ta-5B-SNP52 markers in 90 natural populations.
[0042] Figure 3 Comparison of lutein content of KASP-5B-SNP52 under different environments in wheat microcore germplasm (A) and DH population (B). Detailed Implementation
[0043] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.
[0044] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.
[0045] All wheat varieties used in the examples were obtained from the China Crop Germplasm Information Network, and the unified numbers in Table 2 are the network's internal numbers. The website address is: http: / / www.cgris.net / query / croplist.php#.
[0046] Example 1: Discovery of Ta-5B-SNP52 locus and development of its detection marker
[0047] I. Discovery of Ta-5B-SNP52 locus
[0048] 1. Wheat materials used in the test
[0049] Using the 90 wheat germplasm resources (6 introduced varieties IMC, 7 local varieties CL, and 77 modern bred varieties MCS) shown in Table 1 that have completed resequencing as exploration materials, they were planted at the Wheat Research Institute of Yaodu District, Linfen City, Shanxi Province in 2019-2020 (19YD), 2020-2021 (20YD), and at the Hancun Experimental Base of Linfen City, Shanxi Province in 2020-2021 (20HC).
[0050] 2. Sequence alignment
[0051] Genomic DNA was extracted from each of the tested wheat materials using the conventional CTAB method. The 90 wheat materials were then amplified using specific primers F and R.
[0052] Specific primer F: 5'-TAGGCCCGCGTTTTCTCATT-3'
[0053] Specific primer R: 5'-GCGCTTGATTTGGGTACGTC-3'
[0054] A PCR amplification product of 653 bp was obtained.
[0055] The PCR amplification products of different tested wheat materials were sequenced, and the nucleotide sequences are SEQ ID NO: 4.
[0056] Sequence alignment using MegAlign revealed a SNP mutation at position 52 of the PCR amplification product sequence (SEQ ID NO: 4), named Ta-5B-SNP52. The nucleotide N at this Ta-5B-SNP52 site is either C or T, and the haplotype of this SNP site is either CC, TT, or CT.
[0057] 3. Relationship between SNP site haplotype and lutein content in wheat grains
[0058] The lutein content of 90 wheat samples was further determined by high-performance liquid chromatography (HPLC) (Guanet al. 2022). Specifically, 1.0 g of whole wheat flour was weighed and added to 6 mL of extraction solution (acetone:methanol 7:3, v / v; 0.1% BHT, w / v, g:mL). The mixture was vortexed vigorously for 45 s and then placed in a constant temperature incubator at 80 rpm and 35°C in the dark for 1 h. After shaking, the mixture was centrifuged at 10828 g and 4°C for 10 min using a high-speed low-temperature centrifuge, and the supernatant was collected. The extraction was repeated twice. The supernatant was dried using a nitrogen dryer at 35°C. The remaining residue was mixed with 3 mL of diethyl ether, 3 mL of 50% KOH aqueous solution, and ethanol (1:9, v / v). The mixture was shaken for 2 hours at room temperature in the dark to obtain a solution. 3 mL of this solution was taken and mixed with 3 mL of diethyl ether and n-hexane (1:1 volume ratio) and 3 mL of water. The mixture was centrifuged at 7000 g and 4 °C for 10 min. The aqueous phase containing KOH was removed using a syringe, and the mixture was dried under nitrogen at 35 °C. The resulting solid was reconstituted with 0.5 mL of a methanol / acetonitrile / n-hexane mixture containing 0.1% (g:ml) BHT (7:2:1, v / v / v). After complete dissolution, the mixture was centrifuged at 13000 g and 4 °C for 5 min. The supernatant was filtered through a 0.22 μm organic filter membrane into a brown centrifuge tube and stored at -20 °C.
[0059] An Agilent 1260 high-performance liquid chromatograph was used, with a Poroshell 120EC-C18 analytical column (4.6 × 150 mm, 4 μm particle size). The mobile phase consisted of acetonitrile (A), methanol (B), and n-hexane (C). The mobile phase was filtered through a 0.22 μm organic filter and then degassed by sonication for 20 min. Gradient elution was performed for 30 min at a flow rate of 1.0 mL / min. -1 The detection wavelength was 450 nm, and the temperatures of the injector and column oven were maintained at 4℃ and 25℃, respectively. The initial elution conditions were 76% mobile phase A, 21.5% mobile phase B, and 2.5% mobile phase C. The proportion of mobile phase A decreased from 76% to 70% within 20-22 min, and that of mobile phase B decreased from 21.5% to 20% within the same timeframe. Within 28-30 min, phase A increased to 76%, and phase B increased to 21.5%. Lutein standards (Sigma-Aldrich (Shanghai) Trading Co., Ltd., 07168-5MG) were used to determine the elution conditions and retention time. Figure 1 A) Lutein in the sample was identified by retention time, peak area was obtained by automatic integration, and quantification was performed using the external standard method. Each sample was measured three times and the average value was taken. Figure 1 B).
[0060] The lutein content in the grains and the haplotype of the Ta-5B-SNP52 site were statistically analyzed. The results are shown in Table 1. It can be seen that the average lutein content in the grains of wheat materials with the haplotype TT at the Ta-5B-SNP52 site was 3.13 μg / g (lutein content per gram of grain); the average lutein content in the grains of wheat materials with the haplotype CC at the Ta-5B-SNP52 site was 2.57 μg / g.
[0061] The average lutein content of wheat materials with the Ta-5B-SNP52 site haplotype TT was higher than that of wheat materials with the Ta-5B-SNP52 site haplotype CC, and the difference was extremely significant (P<0.01). Therefore, it can be determined or further determined that wheat materials with the Ta-5B-SNP52 site haplotype TT are wheat with high lutein content.
[0062] Table 1 shows the lutein content of grains and the SNP site haplotype statistics of 90 wheat materials used for SNP discovery.
[0063]
[0064]
[0065]
[0066] Therefore, the Ta-5B-SNP52 site can be used to detect or assist in the detection of lutein content in wheat grains, as detailed below:
[0067] The haplotype of the Ta-5B-SNP52 site in the genome of the wheat to be tested is determined to be TT or CC. The lutein content of the wheat grains of the wheat with the Ta-5B-SNP52 site haplotype TT is higher or candidate higher than that of the wheat with the Ta-5B-SNP52 site haplotype CC.
[0068] II. Detection method for Ta-5B-SNP52 site haplotype and development of dedicated markers
[0069] 1. Development of Ta-5B-SNP52 site haplotype detection marker
[0070] Following the design rules of KASP primers, KASP primers for amplifying the Ta-5B-SNP52 site were designed. The KASP-5B-SNP52 primers consist of three primer sequences (sequences as shown in SEQ ID NO: 1-3), as follows: Primer KASP-5B-SNP52-FAM: GAGGTGACCAAGTTCATGCTatgaagaaggcgacccacA (SEQ ID NO: 1)
[0071] Primer KASP-5B-SNP52-HEX: GAAGGTCGGAGTCAACGGATTatgaagaaggcgacccacG (SEQ IDNO: 2)
[0072] Primer KASP-5B-SNP52-R: gcccgcgttttctcattgt (SEQ ID NO: 3)
[0073] Among them, GAAGGTGACCAAGTTCATGCT is the FAM fluorescent tag sequence carried at the 5' end of primer KASP-5B-SNP52-FAM, and GAAGGTCGGAGTCAACGGATT is the HEX fluorescent tag sequence carried at the 5' end of primer KASP-5B-SNP52-HEX.
[0074] 2. Establishment of a method for detecting the haplotype at the Ta-5B-SNP52 locus
[0075] 1) Extract DNA from the wheat grains to be tested;
[0076] 2) Using the extracted DNA as a template, PCR amplification was performed using the KASP primers shown in SEQ ID NO: 1-3;
[0077] The amplification process is as follows:
[0078] (1) Preparation of KASP primer working solution.
[0079] The primers were diluted to 100 μM stock solutions, and then mixed to form the KASP-5B-SNP52 Assay Mix working solution according to the following ratios: 12 μL of primer KASP-5B-SNP52-FAM, 12 μL of primer KASP-5B-SNP52-HEX, 30 μL of primer KASP-5B-SNP52-R, and 46 μL of ddH2O.
[0080] (2) KASP reaction system and procedure.
[0081] The 10 μL reaction mixture for the 96-well plate consisted of: 5 μL KASP Master mix (LGC Biosearch, KBS-1050-122), 1.5 μL DNA template (approximately 60 ng), 0.14 μL KASP-5B-SNP52 Assay Mix working solution, and 3.5 μL ddH2O. The concentrations of KASP-5B-SNP52-FAM, KASP-5B-SNP52-HEX, and KASP-5B-SNP52-R in the reaction mixture were 168 nM, 420 nM, and 168 nM respectively.
[0082] The KASP reaction procedure is as follows:
[0083] Pre-denaturation at 94℃ for 15 min; denaturation at 94℃ for 20 s; annealing and extension at 61-55℃ for 60 s, 10 cycles, with a decrease of 0.6℃ per cycle; denaturation at 94℃ for 20 s, annealing and extension at 55℃ for 60 s, 32 cycles; 37℃ for 1 min, 37℃ for 1 s (scan fluorescence values for genotyping).
[0084] 3) The amplification products were detected using a Bio-RAD CFX96 real-time PCR instrument, and genotyping was performed based on the fluorescence data.
[0085] If the fluorescence signal of the amplified product aggregates near the X-axis to form a FAM fluorescent tag sequence, then the haplotype of the wheat Ta-5B-SNP52 site to be tested is TT homozygous.
[0086] If the fluorescence signal of the amplified product aggregates near the Y-axis to connect to the HEX fluorescent tag sequence, then the haplotype of the wheat Ta-5B-SNP52 site to be tested is CC homozygous.
[0087] III. Identification of Haplotypes at Ta-5B-SNP52 Loci in 90 Natural Populations Using KASP-Ta-5B-SNP52 Markers
[0088] Taking the 90 natural populations in Table 1 as an example, the Ta-5B-SNP52 site haplotype was detected according to the method shown in section II above, and the KASP reaction and data analysis were performed using a Bio-RAD CFX96 real-time PCR instrument.
[0089] Figure 2 The detection results of the KASP-5B-SNP52 marker in 90 natural populations were based on... Figure 2 The genotyping results showed that the genotypes aggregated near the X-axis were linked to the FAM fluorescent tag sequence, and the corresponding haplotype of the tested wheat Ta-5B-SNP52 locus was TT homozygous; the genotypes aggregated on the Y-axis were linked to the HEX fluorescent tag sequence, and the corresponding haplotype of the tested wheat Ta-5B-SNP52 locus was CC homozygous.
[0090] Since wheat is a self-pollinating crop with a low proportion of heterozygous sites in its genome, this experiment does not study the monotypic heterozygosity of the Ta-5B-SNP52 site.
[0091] Example 2: Application of Ta-5B-SNP52 site in detecting lutein content in wheat grains
[0092] The basic information of all Chinese wheat microcore germplasm materials in this embodiment is shown in Table 2 (105 bred varieties and 157 local varieties). They were planted at the Wheat Research Institute of Yaodu District, Linfen City, Shanxi Province in 2019-2020 (19YD), 2020-2021 (20YD), and 2021-2022 (21YD).
[0093] I. Identification of Lutein Content in Seeds
[0094] The lutein content in the seeds of the varieties shown in Table 2 was determined using high performance liquid chromatography (HPLC), following the same method as in Example 1-3. The results are shown in Table 2. At least three replicate measurements were performed for each sample, and the mean value was taken.
[0095] II. KASP-Ta-5B-SNP52 marker for genotyping
[0096] DNA was extracted from 262 Chinese wheat microcore germplasm resources (Table 2) using the CTAB method as templates. Genotyping of the population was performed using the KASP-Ta-5B-SNP52 marker, following the method described in Example 1, Part 2. PCR and genotyping were conducted using a Bio-RAD CFX96 real-time PCR instrument. Genotypes aggregated near the X-axis were associated with FAM fluorescent tag sequences, indicating a TT homozygous haplotype at the corresponding wheat Ta-5B-SNP52 locus. Genotypes aggregated on the Y-axis were associated with HEX fluorescent tag sequences, indicating a CC homozygous haplotype at the corresponding wheat Ta-5B-SNP52 locus.
[0097] The results are shown in Table 2.
[0098] Table 2 lists the names of 262 Chinese wheat microcore germplasm materials.
[0099]
[0100]
[0101]
[0102]
[0103]
[0104]
[0105]
[0106]
[0107]
[0108] Of the 262 wheat materials mentioned above, 125 had the haplotype TT at the Ta-5B-SNP52 site, 113 had the haplotype CC at the Ta-5B-SNP52 site, and 24 had the haplotype CT at the Ta-5B-SNP52 site (discarded).
[0109] The average content of the two types of lutein and their corresponding values were analyzed, and the results are as follows: Figure 3 As shown in Figure A, the average grain lutein content of wheat materials with the haplotype TT at the Ta-5B-SNP52 site was 3.19 μg / g, while the average grain lutein content of wheat materials with the haplotype CC at the Ta-5B-SNP52 site was 2.63 μg / g. The difference was highly significant (P<0.01), indicating that the grain lutein content of the tested wheat materials with the haplotype TT at the Ta-5B-SNP52 site was higher than that of the tested wheat materials with the haplotype CC at the Ta-5B-SNP52 site.
[0110] Example 3: Functional verification of the Ta-5B-SNP52 locus in a genetic population
[0111] Ta-5B-SNP52 showed differences between DH118 (Wang Y, Qiao L, Yang CK, Li XH, Zhao JJ, Wu BB, Zheng XW, Li PB and Zheng J. Identification of genetic loci for flag-leaf-related traits in wheat (Triticum aestivum L.) and their effects on grain yield. Front. Plant Sci. 2022, 13:990287) and Mingxian 169 (ZM009379). DH populations constructed using these two parents were planted at the Wheat Research Institute of Yaodu District, Linfen City, Shanxi Province in 2019-2020 (19YD), 2020-2021 (20YD), and at the Hancun Experimental Base of Linfen City, Shanxi Province in 2020-2021 (20HC).
[0112] The lutein content in the seeds of the DH population was detected using the method described in Example 1-3.
[0113] The population was genotyped using the KASP-Ta-5B-SNP52 marker, following the method described in Example 1. PCR reactions and data analysis were performed using a Bio-RAD CFX96 real-time PCR instrument.
[0114] The results are as follows Figure 3As shown in Figure B, the average lutein content of wheat grains in the Ta-5B-SNP52 haplotype TT was 2.79 μg / g; the average lutein content of wheat grains in the Ta-5B-SNP52 haplotype CC was 2.23 μg / g; the Ta-5B-SNP52 haplotype TT lines were all significantly higher than the Ta-5B-SNP52 haplotype CC lines (P<0.05).
[0115] Example 4: Application of the Ta-5B-SNP52 locus in detecting lutein content in wheat grains of progeny materials.
[0116] The F1 generation of the cross between Jinchun 7 (Wang et al. 2022) and Mingxian 169 was then self-crossed to obtain the F4 generation.
[0117] The lutein content in the seeds of 80 F4 generation strains was detected using the method described in Example 1-3.
[0118] The 80 F4 lines were genotyped using the KASP-Ta-5B-SNP52 marker, following the method described in Example 1. PCR reaction and genotyping were performed using a Bio-RAD CFX96 real-time PCR instrument.
[0119] The results are as follows: Among the 80 F4 generations, 30 lines had the haplotype TT at the Ta-5B-SNP52 locus, 42 lines had the haplotype CC at the Ta-5B-SNP52 locus, and 8 lines had the haplotype CT at the Ta-5B-SNP52 locus (discarded). The average lutein content of wheat grains with the Ta-5B-SNP52 haplotype TT was 2.86 μg / g; the average lutein content of wheat grains with the Ta-5B-SNP52 haplotype CC was 2.48 μg / g. The lines with the Ta-5B-SNP52 haplotype TT had significantly higher lutein content than those with the Ta-5B-SNP52 haplotype CC (P<0.01).
Claims
1. Detection of substances with the Ta-5B-SNP52 haplotype at the SNP locus in the wheat genome in any of the following applications: 1) To identify or assist in the identification of lutein content in wheat grains; 2) Screening or assisting in screening wheat with high lutein content in the grains; 3) Select and breed wheat varieties with high lutein content in their grains; The SNP site Ta-5B-SNP52 is the 52nd position of SEQ ID NO: 4; the haplotype of the SNP site Ta-5B-SNP52 is TT, CC, or CT.
2. The application according to claim 1, characterized in that: The substance used to detect the Ta-5B-SNP52 haplotype of the SNP site in the wheat genome is either A1 or A2. A1) Primer set; A2) PCR reagents or kits containing the complete set of primers described above; The primer set includes primer 1, primer 2 and primer 3; The nucleotide sequence of primer 1 includes the sequence shown in positions 22-40 of SEQ ID NO: 1; The nucleotide sequence of primer 2 includes the sequence shown in positions 22-40 of SEQ ID NO: 2; The nucleotide sequence of primer 3 is SEQ ID NO:
3.
3. The application according to claim 2, characterized in that: The nucleotide sequence of primer 1 is SEQ ID NO: 1; The nucleotide sequence of primer 2 is SEQ ID NO:
2.
4. A method for identifying or assisting in the identification of lutein content in wheat grains using the SNP site Ta-5B-SNP52 as described in claim 1, wherein the method involves detecting whether the haplotype of the SNP site Ta-5B-SNP52 in the wheat genome is TT or CC, and the lutein content of the wheat grains to be tested with the haplotype of Ta-5B-SNP52 site being TT is greater than or candidate to be greater than the lutein content of the wheat grains to be tested with the haplotype of Ta-5B-SNP52 site being CC.
5. A method for breeding wheat with high grain lutein content using the SNP site Ta-5B-SNP52 as described in claim 1, wherein the method involves detecting whether the haplotype of the SNP site Ta-5B-SNP52 in the wheat genome is TT or CC, selecting wheat with the haplotype of the Ta-5B-SNP52 site as TT for breeding, and obtaining the target wheat.
6. The method according to claim 5, characterized in that: The method for detecting whether the haplotype of the SNP site Ta-5B-SNP52 in the wheat genome is TT or CC includes the following steps: using the wheat grain genome to be tested as a template, performing a KASP reaction with the PCR reagent described in claim 2 to obtain the haplotype.
Citation Information
Patent Citations
A common wheat SNP site marker and applications thereof in detection of wheat related characters
CN107916299A
Molecular marker primer group for detecting protein content of wheat grains and application of molecular marker primer group
CN115029472A