Molecular markers for identification of wheat ear length and spikelet density traits and use thereof
By developing the molecular marker Xcau.IndelTaTPR-B1 and its primer combination for wheat spike length and spikelet density traits, we have achieved efficient identification of wheat genotypes, screened high-yielding wheat varieties, solved the problem of insufficient wheat yield, and improved the selection efficiency of wheat breeding.
Patent Information
- Application Number
- CN202410807681.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-06-21
- Publication Date
- 2026-04-24
- Estimated Expiration
- 2044-06-21
AI Technical Summary
Existing technologies are insufficient to effectively improve the morphology of wheat ears, resulting in insufficient wheat yield growth and an inability to meet the food needs of future population growth.
A molecular marker, Xcau.IndelTaTPR-B1, and its primer combination were developed for identifying wheat spike length and spikelet density traits. Wheat genotypes were identified by PCR amplification and electrophoretic analysis, and varieties with short spike length and high spikelet density were screened out.
It provides a high-precision, low-cost molecular-assisted selection tool to help screen out wheat varieties with dense ears and high yields, providing a theoretical basis for wheat breeding and increasing wheat production.
Smart Images

Figure CN118726639B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of wheat breeding technology and relates to molecular markers for identifying wheat spike length and spikelet density traits and their applications. Background Technology
[0002] Common wheat is one of the world's most important staple crops, accounting for nearly 30% of global grain production, providing about 20% of human energy needs, and feeding about 40% of the world's population. With the world's population continuing to grow, projected to reach 9 billion by the middle of this century, to meet global food demand, wheat production should increase from the current 3 tons per hectare to 5 tons per hectare, or 2% annually. China is one of the world's largest wheat producers, and wheat is one of its most important food crops, with its production directly impacting national food security. However, due to factors such as climate change, the growth rate of wheat and other crops' production is far from meeting this target.
[0003] In the last century, the increase in wheat yield was mainly due to the transfer of the dwarf gene (Rht) from Japanese varieties to varieties from other regions, a process known as the "Green Revolution." The reduced plant height significantly improved wheat's resistance to lodging, and coupled with the widespread use of pesticides and fertilizers, this led to a rapid increase in wheat yield. However, in the new century, the potential to further increase wheat yield by utilizing the "Green Revolution" dwarf gene is clearly insufficient. There is a need to focus on more core and effective methods to improve wheat production.
[0004] The three major yield factors of wheat—thousand-grain weight, number of grains per ear, and number of ears per unit area—are all closely related to the ear. Ear development affects the final state of the harvested grains, and improvements in ear morphology directly increase wheat yield. Therefore, ear shape has always been an important selective trait in wheat breeding. Summary of the Invention
[0005] In view of this, the purpose of the present invention is to provide molecular markers for identifying wheat spike length and spikelet density traits and their applications.
[0006] To achieve the above objectives, the present invention provides the following technical solution:
[0007] 1. Molecular markers used for identifying wheat spike length and spikelet density traits, namely Xcau.Indel TaTPR-B1 The differentially identified nucleotide sequence is located between 380 and 411 bp of the TaTPR-B1 gene, whose nucleotide sequence is shown in SEQ ID NO.1.
[0008] As one of the preferred technical solutions, the differential nucleotide sequence identified by the molecular marker is: cggtcggagaccgcatgttcttcgccatgtcc, as shown in SEQ ID NO.2.
[0009] 2. Primer compositions for identifying wheat spike length and spikelet density traits, comprising:
[0010] Upstream primer Xcau.Indel TaTPR-B1 -F: GAGGGAGTGGAAGTGGAACCC, as shown in SEQ ID NO.3;
[0011] Downstream primer Xcau.Indel TaTPR-B1 -R: AGGGGCCGCTGCTGCAGA, as shown in SEQ ID NO.4.
[0012] 3. A kit for identifying wheat spike length and spikelet density traits, comprising the aforementioned primer composition.
[0013] As one of the preferred technical solutions, the kit also contains components required for PCR amplification, such as Taq DNA polymerase, dNTPs, PCR buffer, and Mg. 2+ wait.
[0014] 4. Application of the aforementioned molecular markers, primer combinations or kits in the identification of wheat spike length and spikelet density traits.
[0015] 5. Application of the aforementioned molecular markers, primer compositions or kits in wheat breeding.
[0016] 6. A method for identifying wheat spike length and spikelet density traits, using genomic DNA of the wheat to be tested as a template, performing PCR amplification with the aforementioned primer composition, then separating the PCR products by 10% polyacrylamide gel electrophoresis, and identifying the size of the amplified bands to identify wheat spike length and spikelet density traits.
[0017] As one of the preferred technical solutions, the total volume of the PCR amplification system is 10 μL: 1.0 μL of 100 ng / L template DNA, 5.0 μL of 2×PCR reaction mixture, 2.0 μL of primer composition, and 2.0 μL of double-distilled water; wherein the 2×PCR reaction mixture is Kangrun Biotechnology's 2×Taq premix (dye, for PAGE).
[0018] As one of the preferred technical solutions, the PCR amplification procedure is as follows: First, pre-denaturation is performed at 94℃ for 5 minutes; then, a cycling procedure is performed, including: denaturation at 94℃ for 30 seconds, annealing at 54℃ for 30 seconds, extension at 72℃ for 30 seconds, and the cycle is repeated 35 times; finally, extension is performed at 72℃ for 5 minutes; the PCR product needs to be stored at 4℃.
[0019] 7. A wheat breeding method, which uses the genomic DNA of the wheat to be identified as a template, amplifies it by PCR to obtain PCR products, and then selects the PCR products containing the aforementioned molecular markers as parents for breeding.
[0020] The beneficial effects of this invention are as follows:
[0021] This invention relates to molecular markers for identifying wheat spike length and spikelet density traits and their applications. The invention discloses a variation locus associated with wheat spike length and spikelet density traits, and develops an InDel marker based on this locus. Using this InDel marker, the genotype of the wheat being tested, namely TaTPR-B1, can be determined. KY5214 Genotype (mutation site contains 32 bp bases) or TaTPR-B1 W8762 Genotype (missing 32 bp at the mutation site). Haplotype analysis of 432 wheat samples showed that, based on the genotype of the wheat samples tested, the superior haplotype TaTPR-B1 could be identified. W8762 The wheat plants with this genotype have shorter spike lengths at maturity than those with the TaTPR-B1 genotype. KY5214 The wheat plants had a higher spikelet density than those with the TaTPR-B1 genotype. KY5214 The discovery of wheat plants with different genotypes helps in screening for wheat varieties with short spikelets and high spikelet density, providing a theoretical basis for breeding dense-spike, high-yielding wheat varieties and offering a tool for molecular-assisted selection.
[0022] Conventional PCR based on InDel sequences enables high-precision genotyping and offers advantages such as high yield, low cost, high accuracy, and strong genetic stability. Therefore, conventional PCR based on specific InDel sequences can be used to breed dense-headed, high-yielding wheat varieties, and it holds significant strategic importance for assisted selection in high-yield wheat breeding. Attached Figure Description
[0023] To make the objectives, technical solutions, and beneficial effects of this invention clearer, the following figures are provided for illustration:
[0024] Figure 1 Differential sequence alignment of the TaTPR-B1 gene between wheat lines KY5214 and W8762.
[0025] Figure 2 Xcau.Indel is used as a diagnostic marker. TaTPR-B1 Amplification bands in different wheat varieties.
[0026] Figure 3 Based on the diagnostic marker Xcau.Indel TaTPR-B1 The spike length (A) and spikelet density (B) of 432 different wheat varieties were statistically analyzed. Detailed Implementation
[0027] The preferred embodiments of the present invention will now be described in detail with reference to the accompanying drawings.
[0028] 1) Development of the InDel tag:
[0029] The wheat line W8762 had a shorter mature spike length than the KY5214 line, but their spikelet density was the opposite. Comparison of the TaTPR-B1 gene between the two lines revealed a 32bp sequence difference: the KY5214 TaTPR-B1 mutation site contained 32bp, while the W8762 gene lacked this 32bp mutation site. Figure 1 ).
[0030] Based on the TaTPR-B1 gene sequencing results of KY5214 and W8762, upstream and downstream primers were designed on both sides of the target 32bp differential sequence. Specifically, the marker primers (Indel) were designed in Primer3 (https: / / bioinfo.ut.ee / primer3-0.4.0 / ). TaTPR-B1 -F:GAGGGAGTGGAAGTGGAACCC and Indel TaTPR-B1 -R: AGGGGCCGCTGCTGCAGA), which enables the simultaneous amplification of two types of TaTPR-B1 in KY5214 and W8762.
[0031] 2) Amplification and electrophoresis of molecular markers
[0032] Genomic DNA was extracted from these transgenic wheat plants using the CTAB method.
[0033] Using fresh wheat seedling leaves as material, the main steps are as follows:
[0034] DNA extraction using the CTAB method: Grind wheat leaves and add 600 μL of preheated CTAB extraction buffer. Heat in a 65°C water bath for 30 minutes to lyse the cells. After heating, add an equal volume of a 24:1 (chloroform:isoamyl alcohol, volume ratio) mixture to the sample, gently shake to mix, and allow the sample to separate into layers. Next, centrifuge at 10,000 rpm for 10 minutes to separate the layers. This will cause the DNA to precipitate as isopropanol in the upper layer.
[0035] After discarding the waste liquid, centrifuge at 4°C for 5-10 minutes to remove residual isopropanol. Then, wash the DNA with a 75% (v / v) aqueous ethanol solution and air dry the DNA.
[0036] The formulation of the CTAB extract is as follows: 16.7 g CTAB, 639.1 mL water, 83.5 mL 1 mol / L Tris-HCl (pH = 8.0), 234 mL 5 mol / L NaCl solution, and 33.4 mL 0.5 mol / L EDTA solution (pH = 8.0).
[0037] These steps help extract wheat genomic DNA for subsequent molecular biology experiments or analyses.
[0038] PCR identification is performed, and the specific PCR steps are as follows:
[0039] The amplification system is as follows: Taq Mix: 5.0 μL; DNA template: 2.0 μL; double-distilled water: 1.0 μL; primers: 2.0 μL, totaling 10 μL.
[0040] The amplification program is as follows: 94℃ pre-denaturation for 5 minutes, (94℃ denaturation for 30 seconds, 54℃ annealing for 30 seconds, 72℃ extension for 30 seconds) for 35 cycles, and 72℃ final extension for 5 minutes.
[0041] The PCR products were separated by 10% polyacrylamide gel electrophoresis to identify the differences between the two TaTPR-B1 amplification bands.
[0042] Because the mutation site of the TaTPR-B1 gene in KY5214 contains 32 bp, while the mutation site in the W8762 gene lacks 32 bp, the amplified bands will show a 32 bp difference, meaning the amplified TaTPR-B1 bands will differ by 32 bp. KY5214 The band size is 326bp, labeled with amplified TaTPR-B1. W8762 The band size is 294 bp, which makes it easy to distinguish the two haplotypes of TaTPR-B1. Figure 2 )
[0043] 3) The spike length and spikelet density of 432 different wheat varieties
[0044] Haplotype analysis of 432 wheat samples (Table 1) showed that, based on the genotypes of the wheat samples tested, the superior haplotype TaTPR-B1 could be identified. W8762 The wheat plants with this genotype have shorter spike lengths at maturity than those with the TaTPR-B1 genotype. KY5214 The wheat plants had a higher spikelet density than those with the TaTPR-B1 genotype. KY5214 The discovery of wheat plants with different genotypes helps in screening for wheat varieties with short spikelets and high spikelet density, providing a theoretical basis for breeding dense-spike, high-yielding wheat varieties and offering a tool for molecular-assisted selection.
[0045] 125 samples containing TaTPR-B1 KY5214 Genotype wheat plants and 307 accessions with TaTPR-B1 W8762 Significance statistical analysis (t-test) was performed on the spike length and spikelet density of genotype wheat plants. The results showed that the differences in spike length and spikelet density were both significant (P<0.05), indicating that the TaTPR-B1 genotype was present. W8762 The wheat plants with this genotype have shorter spike lengths at maturity than those with the TaTPR-B1 genotype. KY5214 The wheat plants had a higher spikelet density than those with the TaTPR-B1 genotype. KY5214 Genotype of wheat plant ( Figure 3 ).
[0046] The wheat material of this invention can be obtained from the corresponding breeding unit or from the Wheat Research Center of China Agricultural University.
[0047] Table 1. Statistics on genotypes, spikelet length, and spikelet density of 432 wheat varieties.
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060] Finally, it should be noted that the above preferred embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail through the above preferred embodiments, those skilled in the art should understand that various changes can be made to it in form and detail without departing from the scope defined by the claims of the present invention.
Claims
1. The application of molecular markers, primer compositions for molecular marker identification, or kits containing such primer compositions in the identification of wheat spike length and spikelet density traits, characterized in that, The molecular marker is Xcau.Indel TaTPR-B1 The differentially identified nucleotide sequence is located between 380 and 411 bp of the TaTPR-B1 gene, and the nucleotide sequence of the TaTPR-B1 gene is shown in SEQ ID NO.1; the differentially identified nucleotide sequence by the molecular marker is shown in SEQ ID NO.2; wheat ears lacking SEQ ID NO.2 are shorter and have higher spikelet density; The primer composition is: Upstream primer Xcau.Indel TaTPR-B1 -F: GAGGGAGTGGAAGTGGAACCC, as shown in SEQ ID NO.3; Downstream primer Xcau.Indel TaTPR-B1 -R: AGGGGCCGCTGCTGCAGA, as shown in SEQ ID NO.
4.
2. The application of molecular markers, primer compositions for molecular marker identification, or kits containing such primer compositions in the breeding of wheat varieties with short spikelet length and high spikelet density, characterized in that, The molecular marker is Xcau.Indel TaTPR-B1 The differentially identified nucleotide sequence is located between 380 and 411 bp of the TaTPR-B1 gene, and the nucleotide sequence of the TaTPR-B1 gene is shown in SEQ ID NO.1; the differentially identified nucleotide sequence by the molecular marker is shown in SEQ ID NO.2; wheat ears lacking SEQ ID NO.2 are shorter and have higher spikelet density; The primer composition is: Upstream primer Xcau.Indel TaTPR-B1 -F: GAGGGAGTGGAAGTGGAACCC, as shown in SEQ ID NO.3; Downstream primer Xcau.Indel TaTPR-B1 -R: AGGGGCCGCTGCTGCAGA, as shown in SEQ ID NO.
4.
3. A method for identifying wheat spike length and spikelet density traits, characterized in that, Using genomic DNA from the wheat sample as a template, PCR amplification was performed using a primer combination. The PCR products were then separated by 10% polyacrylamide gel electrophoresis to identify the size of the amplified bands and determine the genotype of the wheat sample, namely TaTPR-B1. KY5214 The genotype has an amplified band size of 326 bp, and its variant site contains 32 bp bases, or TaTPR-B1. W8762 The genotype, with an amplified band size of 294 bp, has a 32 bp missing mutation site, which is used to identify wheat spike length and spikelet density traits, and possesses TaTPR-B1. W8762 The genotype has a short spikelet length and high spikelet density; the 32 bp base is the differential nucleotide sequence of claim 1; The primer composition is: Upstream primer Xcau.Indel TaTPR-B1 -F: GAGGGAGTGGAAGTGGAACCC, as shown in SEQ ID NO.3; Downstream primer Xcau.Indel TaTPR-B1 -R: AGGGGCCGCTGCTGCAGA, as shown in SEQ ID NO.
4.
4. The method according to claim 3, characterized in that, The total volume of the PCR amplification system was 10 μL: 1.0 μL of 100 ng / L template DNA, 5.0 μL of 2×PCR reaction mixture, 2.0 μL of primer combination, and 2.0 μL of double-distilled water.
5. The method according to claim 3, characterized in that, The PCR amplification procedure is as follows: First, pre-denaturation is performed at 94℃ for 5 minutes; then, a cycling procedure is performed, including: denaturation at 94℃ for 30 seconds, annealing at 54℃ for 30 seconds, extension at 72℃ for 30 seconds, for 35 cycles; finally, extension is performed at 72℃ for 5 minutes; the PCR product needs to be stored at 4℃.