Molecular marker 1769 and its application in identifying sex-reversed pseudomale individuals in the Northeast Forest Frog.

By using DNA molecular marker technology and bioinformatics analysis, we can quickly identify sex-reversed pseudo-male individuals of the Northeast Forest Frog, solving the problems of long time consumption and poor stability of traditional methods, increasing the proportion of females in the breeding population and improving economic benefits.

CN122303445APending Publication Date: 2026-06-30NORTHEAST AGRICULTURAL UNIVERSITY +1
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-05-07
Publication Date
2026-06-30

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively identify sex-reversed pseudo-male individuals in the Northeast Forest Frog, resulting in an excessively high proportion of males in the breeding population, which affects economic benefits. Furthermore, traditional detection methods are time-consuming, use highly toxic reagents, and have poor stability.

Method used

Using DNA molecular marker technology, PCR amplification and agarose gel electrophoresis detection, combined with second-generation NGS error correction and bioinformatics analysis, specific primers were designed to rapidly identify sex-reversed pseudomale individuals of the Northeast Forest Frog.

Benefits of technology

This method enables rapid, safe, and accurate identification of sex-reversed pseudo-male individuals in the Northeast Forest Frog, increasing the proportion of females, improving the economic benefits of aquaculture, and reducing the impact of external interference on the detection process.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
Patent Text Reader

Abstract

This invention relates to molecular marker 1769 and its application in the identification of sex-reversed pseudomale individuals in the Northeast Forest Frog (Rana davidii), and pertains to the field of molecular markers. To address the current difficulty in identifying sex-reversed pseudomale individuals in the Northeast Forest Frog, this invention extracts the genome from the muscle tissue of the left hind limb of the Northeast Forest Frog. Using the extracted genomic DNA as a template, PCR amplification is performed using primer pairs containing the sequences shown in SEQ ID NO:1 and SEQ ID NO:2. The PCR amplification products are detected by electrophoresis on a 3% agarose gel. Phenotypic male individuals exhibiting the 1769 bp band corresponding to the nucleotide sequence shown in SEQ ID NO:3 are genetically male Northeast Forest Frogs, i.e., true males. Phenotypic male individuals lacking the band corresponding to the nucleotide sequence shown in SEQ ID NO:3 are pseudomale individuals who have undergone sex reversal from genetically female to phenotypically male. Phenotypic female individuals lacking the band corresponding to the nucleotide sequence shown in SEQ ID NO:3 are female individuals.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular markers, specifically to molecular marker 1769 and its application in the identification of sex-reversed pseudo-male individuals in the Northeast Forest Frog. Background Technology

[0002] Northeast Forest Frog ( Rana Dybowskii It belongs to the class Amphibian, order Anura, family Ranidae, genus Rhabditis. Rana The economic value of the Northeast Forest Frog mainly lies in the oviducts of the female frogs. According to the Chinese Pharmacopoeia, the oviducts of the Northeast Forest Frog can be dried to obtain frog oil. Frog oil is sweet, salty, and neutral in nature, and enters the lung and kidney meridians. It has the effects of tonifying the kidney and replenishing essence, nourishing yin and moistening the lungs. It is used for weakness after illness, fatigue, palpitations, insomnia, night sweats, tuberculosis, and hemoptysis.

[0003] In the farming of Northeast Forest Frogs, the excessively high proportion of males in the breeding population seriously affects the economic benefits of Northeast Forest Frog farming. Sex differentiation in Northeast Forest Frogs is determined by genetic factors and modified by environmental factors, and is completed before the end of metamorphosis, after which the individual's physiological sex no longer changes. Because environmental factors modify sex differentiation in Northeast Forest Frogs, individuals with inconsistent genetic and physiological sex (i.e., sex-reversed individuals) can occur. In natural populations, only individuals with genetically female traits undergoing sex reversal to phenotypically male traits (i.e., pseudo-males) exist. Sex-reversed individuals in animals play a very important role in parthenogenesis and have been successfully applied to the parthenogenesis of all-male tilapia and highly female tongue sole. If sex-reversed pseudo-males in Northeast Forest Frogs can be identified, they can be used as pseudo-male paternal parents and mated with normal females to obtain a genetically all-female breeding population (e.g.,...). Figure 1 As shown in the figure, this is expected to improve the economic benefits of Northeast forest frog farming.

[0004] The physiological sex of the Northeast Forest Frog can be identified by external morphological observation. However, since heteromorphic sex chromosomes were not observed in the karyotype analysis of the Northeast Forest Frog, the genetic sex of the Northeast Forest Frog cannot be identified, and thus sex-reversed individuals cannot be successfully obtained.

[0005] DNA molecular markers are effective carriers for identifying sex reversal in *Rhizophora stylosa*. Therefore, obtaining a DNA molecular marker capable of identifying sex reversal pseudo-male individuals in *Rhizophora stylosa* is one of the key technologies for constructing all-female or highly female aquaculture populations. However, current methods for identifying sex reversal pseudo-male individuals in *Rhizophora stylosa* face numerous problems, such as poor stability, long detection time, and the high toxicity of the required reagent, polyacrylamide. Summary of the Invention

[0006] The purpose of this invention is to address the problems existing in the above-mentioned technologies by providing a rapid, safe, and effective DNA molecular marker and method for identifying sex-reversed pseudomale individuals of the Northeast Forest Frog. Using the technical solution of this invention, sex-reversed pseudomale individuals of the Northeast Forest Frog can be identified conveniently and effectively.

[0007] The object of the present invention is achieved by means of the following steps:

[0008] (1) Extract genomic DNA from the muscle tissue of the Northeast Forest Frog.

[0009] (2) PCR amplification reaction was performed using the extracted genomic DNA as a template. The upstream primer used in the PCR amplification reaction was the sequence shown in SEQ ID NO:1, i.e.:

[0010] 5'-TGGGAATCATAGAGCGAGAC-3', the downstream primer is the sequence shown in SEQ ID NO:2, namely: 5'-CCAGCGACCGTATTAGAG-3'.

[0011] (3) The PCR amplification products were detected by electrophoresis using a 3% agarose gel. The results showed a band corresponding to the nucleotide sequence shown in SEQ ID NO: 3, i.e. Figure 2 The individuals with the bands shown in the box are genetically male Northeast Forest Frogs, and the individuals lacking the band corresponding to the nucleotide sequence shown in SEQ ID NO: 3 are genetically female Northeast Forest Frogs.

[0012] (4) The genetic male-specific band was recovered, purified, and sequenced to identify it as a sex-specific molecular marker for the Northeast Forest Frog, namely SEQ ID NO: 3. The molecular marker is represented by the nucleotide sequence shown in SEQ ID NO: 3. AGGATCACTAAAGGAATTTTTTTTTTTAGCTAAATAGCTTCCTTTACCTTACTGCAGTACTGGTATCATGTCCTTATTGTTTGTTTTTGCTTTGAAGTTGCTGTAATTCTGCTCTGATCTCCACACTTTCTGCTTGTCTGTTTCCTTATAACCACAGTGCTGGGAGCTTTCTCACGGTGGTCTGAGCTGTCATTACTGTGTGTCTAAAACTTCCCAGAACCAATCAGATTCAT TTTAAAAAACAAAACACTGCCCTGGATTTGTTTGTTTTTGTTCTGTGTTTCTATTTCTACTTCACAGAAACATGAAGCCAGTTCAAAAGTGAAACTAACCTGCAGGCACATTATGATTGATTTTTATCTATTTTTAATCATTTTGAAAAGAAAGCAGTTAACCTTTATGTATCTATACCCTGTAAACAGTCATTTCAGCAAAACATATTTTTTTCCTTTAGTGACCCTTTAA Beneficial effects of the present invention

[0013] Identifying sex-reversed pseudomales in the Northeast Forest Frog (Rana davidii) is extremely difficult in the absence of whole-genome data and heteromorphic sex chromosomes. DNA molecular markers are an effective method for identifying sex reversal in species. This invention filters and quality-controls HiFi sequencing results, uses next-generation NGS error correction, assembles the genomes of male contigs, and aligns female HiFi data to the male contig genomes. Regions showing sexual differences between males and females are screened, and primers are designed based on specific fragments. Primers are also designed based on male-specific sequence fragments, and primers are screened and validated to obtain DNA molecular markers for identifying sex-reversed pseudomales in the Northeast Forest Frog.

[0014] The economic value of the Northeast Forest Frog mainly lies in its female oviducts, requiring a large number of female frogs to provide them. However, the current frog farming industry has an excessively high male ratio, necessitating sex control of the farming population. Mating sex-reversed pseudo-male individuals of the Northeast Forest Frog with normal females can produce a genetically exclusively female farming population, potentially increasing the female ratio and thus improving the economic benefits of frog farming.

[0015] However, the TRAP-PCR method currently used for genetic sex identification in the Northeast Forest Frog is time-consuming, cumbersome, uses highly toxic reagents, and its results are greatly affected by experimental conditions, exhibiting poor stability and numerous limitations. The bioinformatics analysis and verification method used in this invention provides higher accuracy, more stable results, and is less susceptible to external interference in identifying sex-reversed pseudo-male individuals in the Northeast Forest Frog.

[0016] This invention provides a DNA molecular marker for identifying sex-reversed pseudomale individuals of the Northeast Forest Frog (Rana davidii), enabling rapid, safe, and efficient identification of genetically female Northeast Forest Frog individuals with a phenotype reversal towards males. Through this invention, we obtained pseudomale individuals with sex reversal exhibiting a deletion of the nucleotide sequence corresponding to SEQ ID NO: 3, i.e., individuals that are physiologically male but genetically female. Attached Figure Description

[0017] Figure 1 This is a schematic diagram of the pairing of a female frog and a pseudo-male according to the present invention.

[0018] Figure 2 This is a graph showing the 3% agarose gel electrophoresis results of the PCR amplification products of this invention. Detailed Implementation

[0019] The present invention will be further described below with reference to embodiments.

[0020] Depend on Figure 2 It can be seen that lane 6 is a 2000bp marker; lanes 1-5 are physiological male Northeast Forest Frogs, lanes 7-9 are physiological female Northeast Forest Frogs; and lanes 10 and 11 are pseudo-male Northeast Forest Frogs.

[0021] The specific operations for implementing this invention are as follows:

[0022] 1. Extraction of genome from muscle tissue of the Northeast Forest Frog.

[0023] (1) Collect male individuals of Northeast Forest Frog. Place the Northeast Forest Frogs in the Lesser Khingan Mountains of Heilongjiang Province in an enamel basin, rinse them twice with distilled water, cut off the muscle of the left hind limb, put it into a 1.5ml centrifuge tube, add 75% ethanol, and store at -20℃ for later use.

[0024] (2) Experimental reagents

[0025] Tris-saturated phenol, anhydrous ethanol, 70% ethanol;

[0026] Digestive fluid: composed of pH 8.0 Tris-HCl 100 mmol / L, pH 8.0 EDTA 5 mmol / L, 200 mmol / L NaCl, 0.2% SDS, and 0.1 mg / mL proteinase K;

[0027] TE buffer: composed of 10 mmol / L Tris-HCl and 1 mmol / L EDTA, pH 8.0;

[0028] Phenol / chloroform / isoamyl alcohol mixture: The volume ratio of phenol, chloroform, and isoamyl alcohol is 25:24:1;

[0029] Chloroform / isoamyl alcohol mixture: chloroform to isoamyl alcohol volume ratio is 24:1;

[0030] (3) Experimental steps

[0031] a. Take an appropriate amount of sample, let the ethanol dry on filter paper, place it in a 1.5ml EP tube, and cut the sample into small pieces with small scissors. Place the EP tube horizontally until the ethanol in the sample has completely evaporated;

[0032] b. Add 500 μl of lysis buffer to the EP tube, cap it, and seal it with sealing film;

[0033] c. Digest overnight in a water bath shaker at 140 rpm and 55°C;

[0034] d. After complete lysis, remove the EP tube, let it stand at room temperature, add an equal volume of Tris-saturated phenol, and invert the tube for 10 minutes.

[0035] e. Centrifuge at 12000 rpm for 10 min, carefully aspirate the supernatant and place it into a new EP tube;

[0036] f. Add an equal volume of phenol:chloroform:isoamyl alcohol mixture, with a volume ratio of phenol:chloroform:isoamyl alcohol of 25:24:1, and mix thoroughly by inverting for 10 min;

[0037] g. Centrifuge at 12000 rpm for 10 min, carefully aspirate the supernatant and place it into a new EP tube;

[0038] h. Add an equal volume of chloroform:isoamyl alcohol mixture, with a volume ratio of chloroform to isoamyl alcohol of 24:1, and mix thoroughly by inverting for 10 min;

[0039] i. Centrifuge at 10000 rpm for 10 min, carefully aspirate the supernatant and place it into a new EP tube;

[0040] j. Add 2 volumes of anhydrous ethanol pre-cooled to -20°C, shake horizontally about 30 times, and you will see flocculent DNA precipitate;

[0041] k. Centrifuge at 10000 rpm for 10 min, discard the supernatant, and retain the DNA precipitate;

[0042] 1. Add 1 ml of 70% cold ethanol, rinse for 10 seconds, centrifuge at 8000 rpm for 5 minutes, discard the ethanol, and allow to air dry.

[0043] m. Add 100 μl of TE solution and place in a 55℃ water bath for 3-4 h to dissolve the DNA;

[0044] n. The extracted DNA is stored in a refrigerator at 4°C.

[0045] (4) DNA purity detection and quantification

[0046] Take 1 μl of genomic DNA and perform electrophoresis on a 1.2% agarose gel, stain with gel-red, and check the DNA quality under ultraviolet light.

[0047] Take 1 μl of sample and dilute it at a ratio of 1:100. Use a UV spectrophotometer to measure the absorbance of the DNA sample at 260 nm and 280 nm, respectively, and calculate the concentration and purity of the DNA. After the DNA concentration is determined, take a certain amount of solution and quantitatively dilute it with TE buffer to 50 ng / μl, and store it at -80℃ for later use.

[0048] 2. HIFI library construction and sequencing

[0049] Each sample used 1 microgram of DNA as input material, and a sequencing library was constructed using barcodes. PacBio single-molecule real-time (SMRT) libraries were prepared using the SMRTbell express template preparation kit 2.0 (Pacific Biosciences, Menlo Park, CA, USA) and sequenced on the PacBio Revio platform. The generated reads were filtered using SMRT Link software to generate ccs.bam files, and then transformed and filtered using PacBio's official CCS software (default parameters: minimum of 3 cycles, minimum length of 10, and accuracy of ≥0.99), ultimately yielding HiFiReads.

[0050] After the sequencing results were filtered and quality controlled, second-generation NGS was used for error correction. The male contig genome was assembled and the female HiFi data was aligned to the male contig genome. Regions with differences between males and females were screened, and primers were designed based on specific fragments. Primers were designed based on male-specific sequence fragments, and primers were screened and verified to obtain specific primers.

[0051] 3. Perform PCR amplification using the extracted genomic DNA as a template;

[0052] In the PCR method for identifying sex-reversed pseudomale individuals of the Northeast Forest Frog, the upstream primer sequence is 5'-TGTGAACCCTAACAATGAACT-3' as shown in SEQ ID NO:1, and the downstream primer sequence is 5'-GTAAGAAACCCTTTGCTCCTC-3' as shown in SEQ ID NO:2.

[0053] The amplification reaction system consisted of 20 μl of the following components: 2 μl of 10×Buffer (Tris-HCl 200 mM, pH 8.4; KCl 500 mM), 0.4 μl of dNTP (2.5 mM), 0.2 μl of Taq polymerase (5 U / μl), 13.4 μl of sterile deionized water, 1 μl of upstream primer (10 pm / pl), 1 μl of downstream primer (10 pm / pl), and 2 μl of template (50 ng / μl).

[0054] The amplification reaction conditions were: 95℃ for 5 min, 1 cycle; 95℃ for 20 s, 57.5℃ for 30 s, 72℃ for 2 min, 35 cycles; 72℃ for 7 min, 1 cycle, and stored at 4℃.

[0055] 4. Detection of PCR amplification products by 3% agarose gel electrophoresis

[0056] (1) Preparation by agarose gel electrophoresis

[0057] a. To prepare a 3% agarose gel, add 3g of agarose to 100ml of 3% agarose gel and dissolve it in a conical flask with TAE buffer.

[0058] b. Gently shake the conical flask to initially disperse the agarose in the buffer solution (avoid clumping).

[0059] Place the conical flask in the microwave and heat on medium-high for 2-3 minutes (remove and shake once halfway through to prevent bumping). Continue heating until the solution is completely clear and transparent.

[0060] c. Cool the dissolved agarose solution to 50-60℃.

[0061] d. Add nucleic acid dye (EB) (in direct proportion to the amount of TAE, i.e., 30 ml TAE to 3 μl EB), and gently invert to mix.

[0062] e. Place the glue tray on a horizontal surface and insert the glue comb. Ensure the tray is a certain distance from the bottom of the comb to prevent sample leakage.

[0063] f. Slowly pour the agarose solution into the tray, avoiding the formation of air bubbles. Cool for 20-30 minutes, until the gel is completely set.

[0064] (2) Electrophoresis

[0065] a. Take an appropriate amount of loading buffer electrophoresis dye onto a disposable glove, take 1 μl of sample solution, mix it with the dye, and add it to the sample well.

[0066] b. Add 2 μl of marker.

[0067] c. Spot the sample well towards the negative electrode. Set the voltage to 120V and stop when the sample reaches the middle. Take a sample from the gel and inspect it. Scan and record the image, then screen for sex-specific bands.

[0068] (3) Identification of sex-reversed pseudomale individuals

[0069] Depend on Figure 2 It can be seen that phenotypic male individuals possessing the band corresponding to the nucleotide sequence shown in SEQ ID NO: 3 are genetically male Northeast Forest Frogs, i.e., true males. Phenotypic male individuals lacking the band corresponding to the nucleotide sequence shown in SEQ ID NO: 3 are pseudo-males that have undergone sex reversal from genetically female to phenotypic male; phenotypic female individuals lacking the band corresponding to the nucleotide sequence shown in SEQ ID NO: 3 are females.

[0070] 5. Purification, recovery, and sequencing of PCR products.

[0071] (1) Purification and recovery of the target fragment

[0072] The PCR products with sex-specific bands were subjected to 3% agarose gel electrophoresis again at a voltage of 120V for 40 min to 1 h.

[0073] Under UV light, cut the agarose gel containing the target DNA and blot the surface of the gel dry with a paper towel. At this stage, it is important to remove as much gel as possible that does not contain the target DNA to minimize the gel volume and improve DNA recovery. Avoid prolonged exposure of the DNA to UV light during gel cutting to prevent DNA damage. Then, follow the instructions in the OMEGA Gel Extraction Kit manual to purify and recover the PCR products.

[0074] Specifically as follows:

[0075] a. Weigh the gel strip in a clean 1.5ml microcentrifuge tube to determine its volume. Assuming the gel density is 1g / ml, its volume can be calculated as follows: if the mass of the gel strip is 0.3g, then its volume is 0.3ml. Add an equal volume of binding buffer (XP2). Incubate the mixture at 50℃~55℃ for 7 minutes or until the gel is completely dissolved, shaking or vortexing the centrifuge tube every 2~3 minutes during this process.

[0076] After the gel is completely dissolved, observe the pH of the mixture. If the pH exceeds 8.0, the DNA recovery rate will be significantly reduced. Specifically, if the mixture turns orange or red, indicating a higher pH, add 5 μl of 5M sodium acetate (pH 5.2) to lower the pH. The adjusted mixture should then turn pale yellow.

[0077] b. Place the DNA Mini Column into the standard 2ml collection tube.

[0078] c. Add 700 μl of the mixture to the centrifuge column and centrifuge at 10000 xg for 1 min at room temperature.

[0079] d. Discard the centrifuged liquid and load the centrifuge column into the previously used collection tube. If the solution volume is greater than 700 μl, load the centrifuge column and centrifuge in 700 μl increments. The total DNA yield of each centrifuge column is 25 μg. If a yield greater than the upper limit of 25 μg is desired, aliquot the sample into an appropriate number of centrifuge columns.

[0080] e. Add 300 μl of binding buffer to the centrifuge column and centrifuge at 10,000 xg for 1 min at room temperature to rinse the column. Discard the centrifuged liquid and reuse the collection tube.

[0081] f. Add 700 μl of SPW Wash Buffer diluted with anhydrous ethanol to rinse the centrifuge column. Centrifuge at 10000 xg for 1 min at room temperature.

[0082] Note: SPW cleaning concentrate must be diluted with anhydrous ethanol before use, at a ratio of 100 ml anhydrous ethanol to 25 ml of cleaning concentrate. If the SPW cleaning solution has been refrigerated, it must be brought to room temperature before use.

[0083] g. Optional suggestion: Repeat step 8 with an additional 700 μl of SPW rinsing solution.

[0084] For any subsequent procedures, if the process is sensitive to salt, a second cleaning operation should be performed.

[0085] h. Discard the centrifuged liquid, centrifuge the empty column at ≥13000 xg for 2 minutes to remove the matrix from the column. Removing the ethanol from the column is crucial and should not be omitted.

[0086] i. Place the centrifuge column in a clean 1.5 ml microcentrifuge tube. Add 15–30 μl of elution buffer directly to the column substrate and incubate at room temperature for 1 min. Centrifuge at 13000 x g for 1 min to elute the DNA. This will yield approximately 70% DNA. A second elution may be performed to obtain a lower concentration of residual DNA.

[0087] The efficiency of DNA elution in a centrifuge column depends on the pH of the elution buffer. If using deionized water to elute DNA, ensure the pH is around 8.0.

[0088] j. DNA recovery yield and quality: The absorbance of the sample at 260 nm and 280 nm was measured.

[0089] (2) Ligation of PCR products

[0090] Cloning reaction system: PCR Product, 0.5~4μl; pEASY®-T1 Simple Cloning Vector, 1μl.

[0091] Mix gently and react at room temperature (30°C) for 10 minutes. After the reaction is complete, place the centrifuge tube on ice.

[0092] (3) Transformation of the linker products

[0093] a. Add the ligation product to 50 μl of Trans1-T1 competent cells. When the competent cells are just thawed, add the ligation product, gently tumble to mix, and incubate on ice for 20-30 minutes.

[0094] b. Heat shock in a 42°C water bath for 30 seconds, then immediately place on ice for 2 minutes.

[0095] c. Add 250 μl of LB liquid medium equilibrated to room temperature, and incubate at 200 rpm and 37°C for 1 hour.

[0096] d. Spread 200 μl of bacterial culture evenly onto an LB agar plate containing 60 μg / mL ampicillin and incubate overnight at 37 °C. To obtain more clones, centrifuge the bacterial culture from the previous step at 1500 xg for 1 minute, discard some of the supernatant, retain 100-150 μl, gently tap the suspended bacterial cells, and spread the entire bacterial culture onto a plate.

[0097] e. Select white clones and inoculate them into 1 ml LB / Amp liquid medium, and incubate at 200 rpm and 37°C for about 6 hours.

[0098] (4) Sequence determination and splicing comparison of PCR cloning products

[0099] Take 100 μl of single-clone bacterial culture, add it to a 1.5 ml EP tube, seal with sealing film, and send it to Jilin Kumei Biotechnology Co., Ltd. for sequencing. Sequence analysis was performed using DNAMAN Version 5.2.2 software, yielding sequence SEQ ID NO: 3.

[0100] AGGATCACTAAAGGAATTTTTTTTTTTAGCTAAATAGCTTCCTTTACCTTACTGCAGTACTGGTATCATGTCCTTATTGTTTGTTTTTGCTTTGAAGTTGCTGTAATTCTGCTCTGATCTCCACACTTTCTGCTTGTCTGTTTCCTTATAACCACAGTGCTGGGAGCTTTCTCACGGTGGTCTGAGCTGTCATTACTGTGTGTCTAAAACTTCCCAGAACCAATCAGATTCATT TTAAAAAACAAAACACTGCCCTGGATTTGTTTGTTTTTGTTCTGTGTTTCTATTTCTACTTCACAGAAACATGAAGCCAGTTCAAAAGTGAAACTAACCTGCAGGCACATTATGATTGATTTTTATCTATTTTTAATCATTTTGAAAAGAAAGCAGTTAACCTTTATGTATCTATACCGTAAACAGTCATTTCAGCAAAACATATTTTTTTCCTTTAGTGACCCTTTAA.

Claims

1. A molecular marker 1769 related to identification of sex-reversed pseudo-male individuals of Rana dybowskii and application, characterized in that Follow these steps: (1) Genomic DNA was extracted from the muscle tissue of the Northeast Forest Frog. (2) PCR amplification reaction was performed using the extracted genomic DNA as a template. The upstream primer used for PCR amplification reaction was the sequence shown in SEQ ID NO: 1, namely 5'-TGGGAATCATAGAGCGAGAC-3', and the downstream primer was the sequence shown in SEQ ID NO: 2, namely 5'-CCAGCGACCGTATTAGAG-3'. (3) The PCR amplification products were detected by electrophoresis using a 3% agarose gel. Phenotypic male individuals with the 1769bp band corresponding to the nucleotide sequence shown in SEQ ID NO: 3 were genetically male Northeast Forest Frogs, i.e., true males. Phenotypic male individuals lacking the band corresponding to the nucleotide sequence shown in SEQ ID NO: 3 were pseudo-males, representing a sex reversal from genetically female to phenotypically male. Phenotypic female individuals lacking the band corresponding to the nucleotide sequence shown in SEQ ID NO: 3 were females. (4) The genetic male-specific band was recovered, purified, and sequenced to identify it as a DNA molecular marker for identifying sex-reversed pseudo-male individuals of the Northeast Forest Frog, namely SEQ ID NO:

3. The molecular marker is represented by the nucleotide sequence shown in SEQ ID NO:

3. AGGATCACTAAAGGAATTTTTTTTTTTAGCTAAATAGCTTCCTTTACCTTACTGCAGTACTGGTATCATGTCCTTATTGTTTGTTTTTGCTTTGAAGTTGCTGTAATTCTGCTCTGATCTCCACACTTTCTGCTTGTCTGTTTCCTTATAACCACAGTGCTGGGAGCTTTCTCACGGTGGTCTGAGCTGTCATTACTGTGTGTCTAAAACTTCCCAGAACCAATCAGATTCAT TTTAAAAAACAAAACACTGCCCTGGATTTGTTTGTTTTTGTTCTGTGTTTCTATTTCTACTTCACAGAAACATGAAGCCAGTTCAAAAGTGAAACTAACCTGCAGGCACATTATGATTGATTTTTATCTATTTTTAATCATTTTGAAAAGAAAGCAGTTAACCTTTATGTATCTATACCCTGTAAACAGTCATTTCAGCAAAACATATTTTTTTCCTTTAGTGACCCTTTAA Phenotypic males exhibiting the 1769 bp band corresponding to the nucleotide sequence shown in SEQ ID NO: 3 are genetically male Northeast Forest Frogs, i.e., true males. Phenotypic males lacking the band corresponding to the nucleotide sequence shown in SEQ ID NO: 3 are pseudo-males, representing sex reversal from genetically female to phenotypically male. Phenotypic females lacking the band corresponding to the nucleotide sequence shown in SEQ ID NO: 3 are females.

2. The molecular marker 1769 and its application related to the identification of sex-reversed pseudo-male individuals in the Northeast Forest Frog as described in claim 1, characterized in that, The primer pair has the nucleotide sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2: SEQ ID NO:1 TGGGAATCATAGAGCGAGAC SEQ ID NO 2: CCAGCGACCGTATTAGAG.

3. The molecular marker 1769 and its application related to the identification of sex-reversed pseudo-male individuals in the Northeast Forest Frog as described in claim 1, characterized in that, Using the primers described above, PCR amplification was performed on the genome of the *Rhizophora stylosa* to be tested (SEQ ID NO: 1-SEQ ID NO: 2). When a 1769 bp band was present in the amplification product, it indicated that the genomic DNA of the *Rhizophora stylosa* to be tested contained the nucleotide sequence shown in SEQ ID NO: 3, and the *Rhizophora stylosa* to be tested was determined to be a non-sex-reversed individual. When no amplified fragment was found, it indicated that the genomic DNA of the phenotypically male *Rhizophora stylosa* to be tested did not contain the nucleotide sequence shown in SEQ ID NO: 3, and the *Rhizophora stylosa* to be tested was determined to be a sex-reversed pseudo-male individual.

4. The molecular marker 1769 and its application related to the identification of sex-reversed pseudo-male individuals in the Northeast Forest Frog as described in claim 1, characterized in that, When analyzing PCR amplification products, it is preferable to detect the amplification products by 3% agarose gel electrophoresis.

5. The molecular marker 1769 and its application related to the identification of sex-reversed pseudo-male individuals in the Northeast Forest Frog as described in claim 1, characterized in that, When analyzing PCR amplification products, the electrophoresis voltage is 120V and the electrophoresis time is 10~14h.

6. The molecular marker 1769 and its application related to the identification of sex-reversed pseudo-male individuals in the Northeast Forest Frog as described in claim 1, characterized in that, During amplification, the reaction system consisted of 20 μl of the following components: 2 μl of 10×Buffer (Tris-HCl 200 mM, pH 8.4; KCl 500 mM), 0.4 μl of dNTP (2.5 mM), 0.2 μl of Taq polymerase (5 U / μl), 13.4 μl of sterile deionized water, 1 μl of upstream primer (10 pm / pl), 1 μl of downstream primer (10 pm / pl), and 2 μl of template (50 ng / μl).

7. The molecular marker 1769 and its application related to the identification of sex-reversed pseudo-male individuals in the Northeast Forest Frog as described in claim 1, characterized in that, During amplification, the reaction conditions were as follows: 95℃ for 5 min, 1 cycle; 95℃ for 20 s, 57.5℃ for 30 s, 72℃ for 2 min, 35 cycles; 72℃ for 7 min, 1 cycle, and stored at 4℃.

8. The molecular marker 1769 and its application related to the identification of sex-reversed pseudo-male individuals in the Northeast Forest Frog as described in claim 1, characterized in that, This kit is used to prepare a test kit for identifying sex-reversed pseudo-male individuals of the male Northeast Forest Frog (Frog spp.) with the desired phenotype.

9. The molecular marker 1769 and its application related to the identification of sex-reversed pseudo-male individuals in the Northeast Forest Frog as described in claim 1, characterized in that, The molecular markers used in the steps of claim 1 are represented by the nucleotide sequence shown in SEQ ID NO: 3 to identify whether the male Northeast Forest Frog of the test phenotype has undergone sex reversal, so as to obtain pseudo-male individuals, which are used as paternal parents to mate with normal females and ovulate, thereby obtaining a high female ratio offspring population.