Construction of Escherichia coli Nissle 1917 with high-yield L-ornithine and its probiotic function
By modifying E. coli Nissle 1917, optimizing the metabolic pathway and transport pathway of L-ornithine, the problems of long fermentation cycle and insufficient safety of L-ornithine in the prior art were solved, and high yield and biosafety L-ornithine production were achieved.
Patent Information
- Application Number
- CN202410729588.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-06-06
- Publication Date
- 2025-06-24
- Estimated Expiration
- 2044-06-06
AI Technical Summary
In the prior art, the fermentation cycle of L-ornithine is relatively long, and E. coli MG1655 produces endotoxins, which is not suitable for use in the food and pharmaceutical industries.
By using E. coli Nissle 1917 as the chassis cell, the feedback repression is relieved, the branch metabolic flow is reduced, the L-ornithine accumulation is enhanced, and the ornithine-arginine circulation pathway is introduced to overexpress key enzymes and transporters to optimize the production of L-ornithine.
The fermentation cycle has been shortened, the maximum output of L-ornithine reaches 14.2g/L, and the strain is safer and suitable for use in the food and pharmaceutical industries.
Smart Images

Figure CN118755648B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the construction of Escherichia coli Nissle 1917 with high-yield L-ornithine and its probiotic function, belonging to the field of biotechnology. Background Art
[0002] E.coil Nissle 1917 (EcN) is a probiotic Escherichia coli, which has been widely used in the prevention of infectious diarrhea and immunomodulation since its discovery in 1917. The main probiotic mechanisms are competitive inhibition, production of antibacterial substances, improvement of mucosal barrier, and immunomodulation. ECN is currently widely used to express therapeutic proteins. With the continuous improvement of Escherichia coli transformation technology, the understanding of EcN strains has been further deepened, and the application scope has also been broadened.
[0003] The synthesis methods of L-ornithine include chemical methods and biological methods. Chemical methods have problems such as complex reactions, low yields, and severe racemization. In contrast, the biological method for preparing L-ornithine has the advantages of relatively simple production processes and environmental friendliness. In the biological method, current strategies mainly focus on using Corynebacterium glutamicum to ferment and produce L-ornithine. For example, Zhang et al. (Metabolic engineering of Corynebacterium glutamicum S9114 to enhance the production of l-ornithine driven by glucose and xylose) obtained recombinant Corynebacterium glutamicum through genetic engineering means. Compared with the original strain, the L-ornithine yield only increased by 25%, reaching 43.6 g / L, and its fermentation time was more than 60 h, which was not conducive to industrial production applications. In the research with Escherichia coli as the host, existing research mainly focuses on using Escherichia coli MG1655 or BL21 as the original strain. For example, the Chinese patent with the publication number CN116162581A records that the yield of L-ornithine reached 92.14 g / L after 48 h of fermentation using Escherichia coli MG1655. On the one hand, its fermentation time is still relatively long. On the other hand, Escherichia coli MG1655 will produce endotoxins, and the method of using it to produce L-ornithine is obviously not conducive to applications in the food and pharmaceutical industries. Summary of the Invention
[0004] [Technical Problem]
[0005] The technical problem to be solved by the present invention is to provide an Escherichia coli strain for producing L-ornithine with a short fermentation period and biosafety.
[0006] [Technical Solution]
[0007] To solve the above problems, the present invention uses Escherichia coli Nissle 1917 as the chassis cell, enhances the accumulation of L-ornithine in Escherichia coli by relieving feedback repression and reducing the metabolic flux of the branched pathway, and preliminarily constructs a modified strain of L-ornithine. The key enzymes of the metabolic pathway are overexpressed using an endogenously highly expressed promoter to enhance pathway metabolism. The ornithine-arginine cycle pathway is introduced, and the glucose transporter and L-ornithine transporter are overexpressed to optimize the yield of L-ornithine, and the related probiotic functions of the strain are verified.
[0008] The first object of the present invention is to provide a genetically engineered bacterium, which uses Escherichia coli Nissle 1917 as the starting strain, and knocks out the following genes on the genome of the starting strain: the ornithine carbamoyltransferase encoding genes argF-1 and argF-2, the repressor encoding gene argR, the L-arginine decarboxylase gene adiA, the L-arginine decarboxylase gene speA, the L-ornithine decarboxylase gene speF, the L-ornithine decarboxylase gene speC, the arginine N-succinyltransferase gene astA, the L-glutamate decarboxylase genes gadA and gadB, the glutamine synthetase encoding gene glnA, and the aminotransferase encoding gene ilvE;
[0009] The expression of the N-acetylglutamate synthase encoding gene argA is initiated by the C1 promoter; the nucleotide sequence of the C1 promoter is as shown in SEQ ID NO.1;
[0010] The bifunctional ornithine acetyltransferase ArgJ, acetyltransferase cg3035, glucose transporter Ptsg, L-ornithine transporter LysE, and valine transporter LysO are overexpressed.
[0011] In one embodiment, the genes argF-1, argF-2, argR, adiA, speA, speF, speC, astA, gadA, gadB, glnA, ilvE, argA have the nucleotide sequences shown in NZ_CP022686.1: 3301914…3302918, 3306280..3307284, 2116545..2117015, 3159100..3161367, 1703274..1705250, 4242979..4245177, 1726274..1728409, 306723..307757, 2413531..2414931, 79471..80871, 2842648..2844057, 2714253..2715182, 1581375…1582706, respectively;
[0012] The N-acetylglutamate synthase ArgJ, acetyltransferase cg3035, glucose transport and absorption protein Ptsg, L-ornithine transporter LysE, and valine transporter LysO respectively have the amino acid sequences shown by NCBI accession numbers WP_003947122.1, AJE67343.1, WP_000475719.1, AGN22026.1, and WP_000491135.1.
[0013] In one embodiment, the overexpression is to integrate the N-acetylglutamate synthase ArgJ, acetyltransferase cg3035, glucose transport and absorption protein Ptsg, L-ornithine transporter LysE, and valine transporter LysO into the cybc, yghD, ilvG, ycbj, and ilvC gene loci on the genome of the starting strain respectively, while knocking out the genes at the corresponding loci.
[0014] In one embodiment, the cybC, yghD, ilvG, ycbJ, and ilvC genes respectively have the nucleotide sequences shown by NZ_CP022686.1: 3286696..3287082, 1825674..1826210, 2712327..2713973, 4473302…4474195, 2719681…2721156).
[0015] The NZ_CP022686.1 represents the NCBI accession number of the genome where the gene is located, and the numbers represent the start position and end position of the gene on the genome.
[0016] The present invention also provides a microbial inoculant, and the inoculant contains the above-mentioned genetically engineered bacterium.
[0017] In one embodiment, the content of the genetically engineered bacterium in the inoculant is not less than 5×10 9 CFU·mL -1 or 5×10 9 CFU·g -1 .
[0018] The present invention also provides a method for producing L-ornithine, and the method includes fermenting and producing L-ornithine by using the above-mentioned genetically engineered bacterium.
[0019] In one embodiment, the method includes the following steps:
[0020] (1) Activate the genetically engineered bacterium by streaking on a plate, and inoculate it into a seed medium to obtain a seed solution;
[0021] (2) Transfer the seed solution obtained in step (1) to a fermentation medium and ferment to produce L-ornithine.
[0022] In one embodiment, the plate streaking activation condition in step (1) is to culture at 30°C to 40°C for 12 h to 14 h.
[0023] In one embodiment, the preparation condition of the seed culture solution in step (1) is 30°C to 40°C, culture for 6 to 8 h, and the seed culture solution is obtained.
[0024] In one embodiment, the transfer amount of the seed culture solution in step (2) is 3% to 9% (v / v).
[0025] In one embodiment, the fermentation condition in step (2) is to culture at 30°C to 40°C for 12 to 48 h.
[0026] The present invention also provides the application of the above-mentioned genetically engineered bacterium or the above method in the preparation of L-ornithine or products containing L-ornithine.
[0027] The present invention also provides the application of the above-mentioned genetically engineered bacterium or the above bacterium agent in the preparation of drugs for treating diseases related to liver or intestinal injury.
[0028] In one embodiment, the diseases related to liver or intestinal injury include but are not limited to alcoholic fatty liver, liver cirrhosis, and colitis.
[0029] The present invention also provides the application of the above-mentioned genetically engineered bacterium or the above bacterium agent in the preparation of foods that help regulate the intestinal flora or have an auxiliary protective effect on chemical liver injury.
[0030] Compared with the prior art, the present invention has the following beneficial effects:
[0031] (1) Compared with the original starting strain EcN (without L-ornithine production), the highest L-ornithine yield of the final recombinant bacterium CEcN constructed in the present invention reached 14.2 g / L after 25 h of fermentation in the tank, which was significantly improved compared with the original starting strain, and the fermentation time of the strain of the present invention was significantly lower than that of the prior art.
[0032] (2) The present invention uses Escherichia coli Nissle1917 as the starting strain. Escherichia coli Nissle1917 lacks the pathogenic factors commonly present in its homologous pathogenic strains and does not carry virulence factors. Therefore, the engineered bacterium provided by the present invention is more conducive to industrial applications in the food and pharmaceutical fields.
[0033] (3) Compared with the original starting strain EcN, the recombinant strain CEcN provided by the present invention can significantly reduce the values of liver AST and ALT in alcohol-consuming mice. In addition, compared with the wild strain, the recombinant strain CEcN shows obvious enhancement of intestinal colonization and an increase in the abundance of intestinal beneficial microorganisms. And it can more effectively reduce liver lipid levels and inhibit the hypertrophy of intestinal goblet cells caused by alcohol stimulation, showing a significant protective effect on the liver and intestine. Description of the Drawings
[0034] Figure 1 : Verification results of gene knockout of argF-1, argF-2, argR, adiA, speA, speF, speC, astA, gadA, gadB, argR, glnA, and ilvE; among them, lanes 1-4 respectively represent the sizes of the argF-1 gene before and after knockout, and the sizes of the argF-2 gene before and after knockout; lanes 5-18 respectively represent the sizes of the adiA gene before and after knockout; the sizes of the speA gene before and after knockout; the sizes of the speF gene before and after knockout; the sizes of the speC gene before and after knockout; the sizes of the astA gene before and after knockout; the sizes of the gadA gene before and after knockout; the sizes of the gadB gene before and after knockout; lanes 19-20 respectively represent the sizes of the argR gene before and after knockout; lanes 21-22 respectively represent the sizes of the glnA gene before and after knockout; lanes 23-24 respectively represent the sizes of the ilvE gene after and before knockout.
[0035] Figure 2 : Shake flask fermentation results of the recombinant strains; among them, 2A shows the shake flask fermentation results of EcN, E-1, E-2, and E-2'; 2B shows the shake flask fermentation results of E-1 to E-12.
[0036] Figure 3 : Verification results of the integration of key genes argA, argJ, cg3035, ptsg, and lysE; among them, in 3A, lanes 1-5 and 6 are the verification bands before and after replacing the promoter of argA respectively; in 3B, lanes 1-2 respectively represent the verification bands before and after the integration of argJ; lanes 3-4 respectively represent the verification bands before and after the integration of cg3035; in 3C, lanes 1-2 respectively represent the verification bands before and after the integration of ptsg in E-16(1); lanes 3-4 respectively represent the verification bands before and after the integration of ptsg in E-16(2); in 3D, lanes 1-2 respectively represent the verification bands before and after the integration of lysE; in 3E, lanes 1-2 respectively represent the verification bands before and after the integration of lysO in B18(1); lanes 3-4 respectively represent the verification bands before and after the integration of lysO in B18(2).
[0037] Figure 4 : Shake flask fermentation results of the recombinant strains E-13 to E-18.
[0038] Figure 5 : Fermentation verification results of recombinant strain CEcN in 5L tank;
[0039] Figure 6 : Schematic diagram of experimental protocol for verifying the probiotic function of L-ornithine recombinant EcN strain;
[0040] Figure 7 : AST test results of different groups;
[0041] Figure 8 : ALT test results of different groups;
[0042] Figure 9 : 16s sequencing results of cecal contents, where A and B represent the relative abundance of Escherichia coli and the bar chart of species distribution respectively;
[0043] Figure 10 : Verification and comparison results of liver sections of different groups, where A, B, C, and D represent the verification and comparison results of liver sections of the blank group, blank + alcohol group, original strain + alcohol group, and modified strain + alcohol group respectively;
[0044] Figure 11 : Verification and comparison results of intestinal sections of different groups, where A, B, C, and D represent the verification and comparison results of intestinal sections of the blank group, blank + alcohol group, original strain + alcohol group, and modified strain + alcohol group respectively;
[0045] Figure 12 : Verification at the plasmid level of the effect of overexpression of carbon source absorption-related genes glkp, pfkA, and ptsg on L-ornithine production. Specific implementation manners
[0046] The present invention will be further described below in conjunction with specific embodiments, so that those skilled in the art can better understand the present invention and be able to implement it, but the exemplified embodiments are not intended to limit the present invention.
[0047] Unless otherwise specified, the experimental methods used in the following embodiments are all conventional methods. The materials, reagents, etc. used in the following embodiments can be obtained from commercial channels unless otherwise specified. For the quantitative experiments in the following embodiments, three repeated experiments are set, and the results are averaged.
[0048] The host used for constructing recombinant plasmids in the following embodiments is Escherichia coli Nissle 1917, purchased from Benna Biology, and the pCas (pRedCas9) and pXMJ19 plasmids are purchased from the BioVector plasmid vector strain cell gene preservation center. The host used for the expression vector in the following embodiments is Escherichia coli Nissle 1917.
[0049] In the specification of the present invention, the gene nucleotide sequence is represented as "GenBank accession number: starting position... ending position", for example, "NZ_CP022686.1: 3159100... 3161367", where "NZ_CP022686.1" represents the NCBI accession number of the genome where the gene is located, "3159100" represents the starting position of the gene on the genome, and "3161367" represents the ending position of the gene on the genome.
[0050] The preparation of Escherichia coli competent cells and the chemical transformation method involved in the following examples are as follows:
[0051] To prepare Escherichia coli chemically competent cells, use the Competent Cell Preparation Kit from TakaRa. Refer to the instruction manual for detailed operations. Transform Nissle1917 by heat shock at 42°C, and obtain positive transformants through screening on antibiotic-resistant plates. Extract plasmids for PCR verification and send them to Genewiz for sequencing verification.
[0052] The method for extracting related plasmids involved in the following examples:
[0053] When extracting plasmids from the modified strain of Escherichia coli, centrifuge the bacterial liquid at an appropriate concentration and remove the supernatant. Then use the Jierui Mini Plasmid Extraction Kit for extraction. Refer to the instruction manual for detailed operations.
[0054] The PCR amplification system in the following examples is as follows: 1.0 μL of forward primer, 1.0 μL of reverse primer, 1.0 μL of template, 25 μL of DNA polymerase, and 22 μL of nuclease-free water. The PCR amplification program is as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s; the annealing temperature is generally set at 58 - 60°C for 30 - 60 s; the extension time at 72°C is set according to the amplification of 1500 bp gene per minute; the denaturation to extension program is repeated for 30 cycles; extension at 72°C for another 5 min; and preservation at 4°C.
[0055] The preparation of Escherichia coli electrocompetent cells involved in the following examples: Dip the inoculation loop into the bacterial liquid in the frozen tube, streak and activate it on the LB solid plate, and place it in a 37°C incubator for 12 - 14 h of activation culture. Pick a single colony from the fresh plate and inoculate it into the LB liquid medium, and place it in a 37°C, 220 rpm gyratory shaker for 12 - 14 h. Transfer it to the competent medium according to an inoculation amount of 1 - 2% (v / v), and place it in a 37°C, 220 rpm gyratory shaker for culture. Track and measure OD 600 , and when OD 600 reaches approximately 0.9, immediately place the bacterial liquid in an ice bath. After 15 min, use a refrigerated centrifuge at 4°C, 6000 r·min -1Centrifuge for 10 min to collect the bacterial cells, then add 2 ml of pre-cooled 10% glycerol to wash the cells. Gently pipette to suspend the bacterial cells, centrifuge again to collect the bacterial cells, and repeat the washing 3 times. Finally, suspend the cells with an appropriate amount of 10% glycerol, dispense 80 μl of the cells into each 1.5 ml centrifuge tube, which can be directly used for electroporation or stored in a -70 °C refrigerator.
[0056] The media involved in the following examples:
[0057] LB medium (g·L -1 ): NaCl 10, peptone 10, yeast extract 5;
[0058] LB solid medium (g·L -1 ): NaCl 10, peptone 10, yeast extract 5, agar powder 20;
[0059] Flask fermentation medium (g·L -1 ): Glucose 20, peptone 3, yeast extract 5, MgSO4 1.5, KH2PO4 3.0, NH4Cl 1.0, arginine 0.5, vitamin B 0.002.
[0060] Seed medium (g·L -1 ): Glucose 20, peptone 3, yeast extract 5, MgSO4 1.5, KH2PO4 3.0, NH4Cl 1.0, arginine 0.5, vitamin B 0.002.
[0061] Fermentation medium (fermenter) (g·L -1 ): Glucose 20, peptone 3, yeast extract 5, betaine 2, citric acid 2, MgSO4 1.5, KH2PO4 3.0, NH4Cl 1.0, arginine 0.5, vitamin B 0.002, ferrous sulfate 0.002, manganese chloride 0.002.
[0062] L-ornithine fermentation method: Streak and activate the frozen tube bacterial solution on an LB slant medium, culture overnight at 37 °C. After secondary activation of the slant medium, wash the bacteria with normal saline, and transfer them with an inoculation amount of 3% to 30 mL of flask fermentation medium, and culture on a reciprocating shaker at 37 °C and 220 r·min -1 for 48 h.
[0063] The detection methods involved in the following examples are as follows:
[0064] Ornithine detection uses an Agilent C18, 5 μm, 4.6 × 250 mm chromatographic column; the flow rate is 1.0 mL·min 1; Column temperature: 40 °C; Detection wavelength: 338 nm; Mobile phase: Phase A: 8.0 g of sodium acetate (13.3 g of sodium acetate trihydrate) is dissolved in 1000 mL of water, 225 μL of triethylamine is added, the pH is adjusted to 7.20 ± 0.05 with 5% acetic acid, and finally 5 mL of tetrahydrofuran is added and mixed; Phase B: Weigh 6.0 g of sodium acetate and dissolve it in 200 mL of water, adjust the pH to 7.20 ± 0.05 with 5% acetic acid, add this solution to 400 mL of HPLC-grade methanol and 400 mL of HPLC-grade acetonitrile, and mix.
[0065] Example 1: Preliminary construction of L-ornithine modified strain
[0066] The sgRNAs used in this example are shown in Table 1.
[0067] The specific steps are as follows:
[0068] 1. Block the L-ornithine metabolic pathway
[0069] L-ornithine is an intermediate in the L-arginine metabolic pathway and is converted to L-citrulline under the action of ornithine carbamoyltransferase encoded by the argF gene. There are two argF in EcN, namely argF-1 and argF-2. The nucleotide sequences of genes argF-1 and argF-2 are shown as NZ_CP022686.1: 3301914…3302918 and 3306280…3307284 respectively, where NZ_CP022686.1 is the accession number of the EcN strain genome on NCBI (https: / / www.ncbi.nlm.nih.gov / nuccore / NZ_CP022686.1?report=graph), and 3301914…3302918 and 3306280..3307284 respectively represent the positions of genes argF-1 and argF-2 on the genome.
[0070] Homologous arms of 500 bp upstream and downstream of argF-1 and argF-2 were synthesized by gene synthesis respectively, and the upstream and downstream fragments were connected by overlap extension PCR to obtain the homologous arm fragments for knockout.
[0071] The 20 nt sequences after the SpeI restriction site of the PGRB plasmid (SEQ ID NO.2) were replaced with sgRNA-1 (targeting argF-1) and sgRNA-2 (targeting argF-2) respectively to obtain plasmids PGRB-sgRNA-1 and PGRB-sgRNA-2.
[0072] The original strain EcN was used as the starting strain, and the plasmid pRedCas9 was transformed into EcN to obtain EcN / pCas. The homologous arm used to knock out argF-1 and the plasmid PGRB-sgRNA-1 were transformed into EcN / pCas, and the gene argF-1 was knocked out using sgRNA-1. IPTG was added, and the plasmid pRedCas9 was eliminated by culturing at 37°C overnight, and the plasmid PGRB-sgRNA-1 was eliminated by culturing at 42°C overnight. Finally, the gene knockout strain was obtained, and the obtained strain was named E-1.
[0073] Similarly, strain E-1 was used as the starting strain, and sgRNA-2 was used to knock out gene argF-2 to obtain strain E-2.
[0074] 2. Remove feedback inhibition
[0075] The repressor protein ArgR feedback represses the gene encoding the main L-ornithine synthase, thereby inhibiting the accumulation of L-ornithine. The nucleotide sequence of the gene argR is shown in NZ_CP022686.1: 2116545..2117015.
[0076] The gene knockout step refers to step 1 above, except that 500 bp upstream and downstream of the corresponding gene are synthesized and connected to construct knockout homology arms. At the same time, strain E-2 is used as the starting strain, and sgRNA-3 is used to knock out the gene argR to obtain strain E-3.
[0077] 3. Knockout of the competitive pathway gene for L-ornithine synthesis
[0078] In the L-ornithine branch pathway, genes adiA, speA, speF, speC, astA, gadA, and gadB encode L-arginine decarboxylase, L-arginine decarboxylase, L-ornithine decarboxylase, L-ornithine decarboxylase, arginine N-succinyltransferase, L-glutamate decarboxylase, and L-glutamate decarboxylase, respectively, and are competitive branch genes in L-ornithine synthesis. The nucleotide sequences of genes adiA, speA, speF, speC, astA, gadA, and gadB are shown in NZ_CP022686.1: 3159100...3161367, 1703274...1705250, 4242979...4245177, 1726274...1728409, 306723...307757, 2413531...2414931, 79471...80871.
[0079] The gene knockout procedure refers to the above-mentioned step 1, with the difference that the corresponding 500 bp upstream and downstream of the gene is synthesized and ligated to construct a knockout homologous arm. Meanwhile, using strain E-3 as the starting strain, the adiA gene is knocked out with sgRNA-4 to obtain strain E-4.
[0080] Starting from strain E-4, the speA gene is knocked out with sgRNA-5 to obtain strain E-5.
[0081] Starting from strain E-5, the speF gene is knocked out with sgRNA-6 to obtain strain E-6.
[0082] Starting from strain E-6, the speC gene is knocked out with sgRNA-7 to obtain strain E-7.
[0083] Starting from strain E-7, the astA gene is knocked out with sgRNA-8 to obtain strain E-8.
[0084] Starting from strain E-8, the gadA gene is knocked out with sgRNA-9 to obtain strain E-9.
[0085] Starting from strain E-9, the gadB gene is knocked out with sgRNA-10 to obtain strain E-10.
[0086] The PCR verification results of the above gene knockout are shown in Figure 1 。
[0087] 4. Transcriptome data analysis for further modification of the metabolic pathway
[0088] Samples are taken from the fermentation of the original strain and the engineered strain E-10, and transcriptome data is obtained for analysis and comparison. The results show that the transcriptional levels of the knocked-out genes decrease significantly in the early stage of fermentation and are basically 0, further verifying the successful construction of strains E1 to E10. In addition, the data shows that the transcriptional level of glutamine synthetase increases significantly, which may promote the production of by-product glutamine and compete for glutamate, the precursor of L-ornithine synthesis. In addition, the transcriptional level of the key gene ilvE for valine synthesis also increases significantly, probably because a large amount of oxygen is consumed during the logarithmic growth phase of the strain, promoting the production of by-product valine; therefore, based on E-10, the glutamine synthetase-encoding gene glnA and the aminotransferase-encoding gene ilvE are knocked out.
[0089] The nucleotide sequences of the genes glnA and ilvE are shown as NZ_CP022686.1: 2842648..2844057 and 2714253..2715182 respectively.
[0090] The gene knockout procedure refers to the above-mentioned step 1, with the difference that starting from strain E-10, the glnA gene was knocked out using sgRNA-11 to obtain strain E-11.
[0091] Starting from strain E-11, the ilvE gene was knocked out using sgRNA-12 to obtain strain E-12.
[0092] 5. Shake flask fermentation of engineered strains E-1 to E-12
[0093] To understand the effect of knocking out genes related to the branched metabolic pathway on the performance of Escherichia coli EcN in fermenting L-ornithine, the L-ornithine production ability of strains E-1 to E-12 was determined by shake flask fermentation, and the starting strain WT was used as a control strain for shake flask fermentation. The results are as Figure 2 shown in Table 2. The fermentation results of the original starting strain (EcN) showed that there was no accumulation of L-ornithine in EcN. Compared with the original starting strain, the shake flask fermentation yield of the recombinant strains was significantly improved, and the recombinant strain E-12 reached 4.2 g / L.
[0094] Table 1 sgRNA sequences
[0095] Name 5’-3’ sgRNA-1 AATCTTTGTCACAAAGGTGG sgRNA-2 ATAAATCTTTGTCACAAAGG sgRNA-3 AGAAGAGAAATTTAGCTCCC sgRNA-4 ACGCTTTCACACACATAACG sgRNA-5 CGCCGCGTTCAAACGTGCGA sgRNA-6 GCTGCGTGGTAAAACAGTCC sgRNA-7 GGATACCAGTTCACTACTGG sgRNA-8 CGAAAGCGTGGCTTCATTGG sgRNA-9 GTGAATCGAGTAGTTCTGAG sgRNA-10 CGAAAATGTCCACAAATTGA sgRNA-11 ACGGGTTAGCCGCCGGGTCC sgRNA-12 GGTTCGCTGGGAAGACGCGA
[0096] Table 2 Strain genotypes and L-ornithine yields
[0097]
[0098]
[0099] Comparative Example 1: Weakening the expression of argF-1 and argF-2 by promoter replacement
[0100] Existing research shows (Development of a nonauxotrophic L-homoserine hyperproducer in Escherichia coli by systems metabolic engineering, DOI: 10.1016 / j.ymben.2022.08.003) that the P filc promoter can effectively weaken the metabolic flux in Escherichia coli W3110. Therefore, an attempt was made to replace the natural promoter of argF in EcN with P filc to reduce the degradation of L-ornithine.
[0101] The specific steps refer to Example 1. Homologous arms of the natural promoter of argF (300 bp upstream of argF) were synthesized by gene synthesis and ligated with P filcBy overlapping extension ligation, homologous arm fragments were obtained. Using the original strain EcN as the starting strain, the promoter sequence of argF-1 was replaced with sgRNA-1, and the obtained strain was named E-1'.
[0102] Using E-1' as the starting strain, the promoter sequence of argF-2 was replaced with sgRNA-2, and the obtained strain was named E-2'.
[0103] The production of L-ornithine was detected by fermentation. L-ornithine was not detected in E-1', and the L-ornithine production of E-2' was significantly lower than that of strain E-2( Figure 2 ). The results showed that replacing the W3110-derived promoter P filc to reduce the expression level of the argF-1 gene could not increase the production of L-ornithine, and simultaneously reducing the argF-1 and argF-2 genes had limited effect on increasing the production of L-ornithine.
[0104] Example 2: Overexpression and integration of key genes to construct a genetically engineered strain with high-yield L-ornithine
[0105] The specific steps are as follows:
[0106] The sgRNAs used in this example are shown in Table 3.
[0107] The nucleotide sequences of the following cybC, yghD, ilvG, ycbJ, pflB, ybgS, ilvC genes are as shown in the nucleotide sequences of NZ_CP022686.1: 3286696..3287082, 1825674..1826210, 2712327..2713973, 4473302..4474195, 4452823..4455105, 4290579..4290959, 2719681..2721156.
[0108] The following gene knockout / knock-in methods refer to Example 1 / Comparative Example 1, except that 500 bp fragments upstream and downstream of the corresponding knockout / knock-in (integration) sites were synthesized and ligated to form knockout homologous arms, or ligated with the target fragment (fragment to be knocked in) to form knock-in homologous arms. The sgRNA in plasmid PGRB was replaced with the corresponding sgRNA to target the corresponding gene.
[0109] The following gene integration verification PCR diagrams are as Figure 3 shown.
[0110] 1. Increase the expression level of the key enzyme-encoding genes for L-ornithine in Escherichia coli
[0111] The enzyme cg3035 has the amino acid sequence shown by the NCBI accession number AJE67343.1. The bifunctional ornithine acetyltransferase ArgJ has the amino acid sequence shown by the NCBI accession number WP_003947122.1. The nucleotide sequences of the corresponding cg3035 gene and argJ gene are shown by CP010451:1531257…1532423 and NC_021352.1:1658508…1659674 respectively. The nucleotide sequence of the argA gene is shown by NZ_CP022686.1:1581375…1582706.
[0112] Starting from strain E-12, the promoter of the argA gene (the non-coding region upstream of argA, a total of 231 bp) was replaced with the C1 promoter using sgRNA-13. The sequence of the C1 promoter is shown by SEQ ID NO.1, and strain E-13 was obtained.
[0113] Starting from strain E-13, the cg3035 gene was integrated using sgRNA-14 to obtain strain E-14, and the integration site was cybC.
[0114] Starting from strain E-14, the argJ gene was integrated using sgRNA-15 to obtain strain E-15, and the integration site was yghD.
[0115] 2. Integrate the gene ptsg for enhancing glucose absorption and utilization
[0116] The protein Ptsg has the amino acid sequence shown by the NCBI accession number WP_000475719.1. The nucleotide sequence of the corresponding gene ptsg is shown by NZ_CP022686.1:2783302...2784810.
[0117] Starting from strain E-15, the ptsg gene was integrated using sgRNA-16(1) to obtain strain E-16(1), and the integration site was pflB.
[0118] The flask fermentation yield of strain E-16(1) was 5.9 g / L, which was only increased by 3.5% compared with E-15. The improvement amplitude of gene integration was much lower than that of overexpression of the ptsg plasmid (Comparative Example 2), but the genomic integration position was adjusted accordingly.
[0119] Starting from strain E-15, the ptsg gene was integrated using sgRNA-16(2) to obtain strain E-16(2), and the integration site was ilvG.
[0120] The flask fermentation yield of strain E-16(2) was 6.2 g / L, which was 8.77% higher than that of E-15. Finally, the ilvG integration site was selected, and strain E-16(2) was used as the intermediate strain E-16 for transformation.
[0121] 3. Screening and overexpression of transporters
[0122] Protein LysE has the amino acid sequence shown by the NCBI accession number AGN22026.1. The nucleotide sequence of the corresponding gene lysE is as shown in NC_021352.1: 1520197…1520907.
[0123] Starting from strain E-16, the lysE gene was integrated using sgRNA-17 to obtain strain E-17, and the integration site was ycbJ.
[0124] The L-ornithine yields of strains E-13 to E-17 were verified by fermentation (the fermentation method was the same as in Example 1), and the results were as Figure 4 shown in Table 4. Compared with E-12, the L-ornithine yield of strain E-17 increased by 60%, but the improvement effect compared with E-16 was very limited. The results showed that the above metabolic transformation could effectively enhance the accumulation of L-ornithine, and the introduction of the cyclic pathway from Corynebacterium glutamicum could greatly improve the synthesis of L-ornithine. The overexpression of the lysE gene had a certain positive effect, but it was not significant.
[0125] In view of the insignificant effect of the transporter from Corynebacterium glutamicum, referring to the transcriptome data obtained in Example 1, four transporters with significantly increased transcriptional levels were screened: compared with the starting strain, the transcriptional levels of the four genes efeO, artJ, lysO, and tcyJ increased by more than 5 times. EfeO, ArtJ, LysO, and TcyJ were reported as inactive ferrous ion, arginine, valine, and cystine transporters respectively. On the one hand, the overexpression of these genes plays an important role in the generation of intermediate metabolites of the metabolic pathway. On the other hand, these transporters may also play a role in transporting ornithine simultaneously.
[0126] The nucleotide sequences of the genes efeO, artJ, lysO, and tcyJ are as shown in NZ_CP022686.1: 4566006…4567133, 4404631…4405362, 4418680…4419579, 515253...516053 respectively.
[0127] Using the pXMJ19 plasmid as an expression vector, overexpression verification of related genes was carried out. The above genes were constructed into the multiple cloning sites of the pXMJ19 plasmid through gene synthesis, and plasmids P19-efeO, P19-artJ, P19-lysO, and P19-tcyJ were constructed. They were introduced into strain E-17 to construct strains ECN-efeO, ECN-artJ, ECN-lysO, and ECN-tcyJ respectively. The shake flask fermentation results showed that the strains ECN-efeO, ECN-artJ, ECN-lysO, and ECN-tcyJ increased by 2.98%, 5.97%, 25.37%, and -2.98% respectively compared with E-17. Considering comprehensively, the lysO gene was selected for genome integration.
[0128] Starting from strain E-17, the lysO gene was integrated using sgRNA-18(1) to obtain strain E-18(1), and the integration site was ybgS.
[0129] The shake flask fermentation liquid culture results showed that the biomass of E-18(1) in liquid culture decreased significantly, and the OD 600 was 20.14, only 65% of that of E-17, and the yield was 4.7 g / L.
[0130] Changing the integration site, starting from strain E-17, the lysO gene was integrated using sgRNA-18(2) to obtain strain E-18(2), and the integration site was ilvC. The fermentation verification of the L-ornithine yield (the fermentation method was the same as in Example 1) was 7.6 g / L. Compared with E-17, the biomass OD 600 of strain E-18(2) did not decrease significantly, and the L-ornithine yield increased by 13.4%. The integration of the lysO gene had an obvious effect on increasing the yield. Strain E-18(2) was used as the constructed E-18 strain.
[0131] Table 3 sgRNA sequences
[0132]
[0133]
[0134] Table 4 Strain genotypes and L-ornithine yields
[0135]
[0136] 4. 5 L fermenter for L-ornithine recombinant strains
[0137] Fermentation method in a 5L fermenter: Inoculate the recombinant strain CEcN into an LB slant seed medium and culture it at 37°C for 12 h. After secondary activation of the slant medium, wash the bacteria with normal saline and inoculate them into a 5L fermenter at an inoculation amount of 5-8%. During the whole fermentation process, control the residual sugar to be less than 1 g / L and maintain the pH value at 7.0.
[0138] The results are as Figure 5 shown. According to the fermentation results, it can be analyzed that: from 0 to 25 h, the accumulation amount of L-ornithine continuously increases with the increase of biomass and reaches the highest yield at about 25 h, which is 14.2 g / L L-ornithine. The sugar-acid ratio in the 5L tank fermentation is 0.22 g / g glucose, and the productivity is 0.54 g / L / h. During the next 10 hours, the biomass and the accumulation amount of L-ornithine remain relatively stable.
[0139] Comparative Example 2: Verification of the effect of carbon source absorption-related genes on L-ornithine production at the plasmid level
[0140] Using the EcN genome as a template, amplify the genes glk (encoding glucokinase), pfkA (encoding 6-phosphofructokinase), and ptsg (encoding glucose-specific transport membrane permease) with primers P1 / P2, P3 / P4, and P5 / P6 (the primers are shown in Table 5), and construct them into the multiple cloning site of plasmid pXMJ19 to obtain plasmids pXMJ19-glk, pXMJ19-pfkA, and pXMJ19-ptsg.
[0141] Transform the above plasmids into strain E-15 respectively to obtain strains E-13-glk, E-13-pfkA, and E-13-ptsg, and verify the L-ornithine production of the strains by fermentation. The results are as Figure 12 shown. Compared with the starting strain E-15, the L-ornithine production of E-15-pfkA decreased significantly. The above results indicate that the overexpression of carbon source absorption-related genes does not necessarily improve the L-ornithine production.
[0142] Table 5 Primers used and their sequences
[0143]
[0144]
[0145] Example 3: Verification of the probiotic function of the transformed strain
[0146] The specific steps are as follows:
[0147] 1. Group and raise animals
[0148] Functional verification was carried out on the constructed L-ornithine modified strain CEcN (i.e., the final strain E-18 constructed above, which was called CEcN in all subsequent probiotic function verification experiments). The experiment verified the effects of recombinant EcN and its metabolite L-ornithine on the liver and intestine by administering two EcN strains to C57BL / 6J mice: the wild-type EcN original strain WT and the EcN engineered strain CEcN, so as to determine that the strain could protect the liver and intestine under the condition of acute alcohol stimulation.
[0149] The specific experimental protocol is as follows:
[0150] (1) Randomly group according to the experimental procedure (as Figure 6 shown) (the specific grouping information is shown in Table 6). After the mice were housed for 7 days to adapt, the experiment began. During the experiment, all mice were fed with standard feed and provided with sterile drinking water for free drinking;
[0151] (2) Observe and record the physical and mental states of the mice every day, and collect fecal samples from the mice on the 0th day, 7th day, and 14th day. On the 14th day, give wine (56% vol.) at a dose of 6 mg / g body weight.
[0152] (3) After the mice were fasted for 10 hours without water deprivation, blood was collected from the orbital cavity after anesthesia. The anesthetic was 100 mg / ml chloral hydrate, 0.1 mL per mouse. The blood collection volume was 0.8 - 1.2 mL per mouse. After the blood was allowed to stand for half an hour to clot, it was temporarily stored in a refrigerator at 4°C. The upper serum was taken after centrifugation and layering. The largest lobe of the liver was removed, and the terminal part of the colon was intercepted, packaged, and fixed in sections after being soaked in formalin.
[0153] Table 6 Animal grouping and specific experimental steps
[0154]
[0155] 2. Transaminase detection
[0156] Use a biochemical analyzer to detect the contents of alanine transaminase (ALT) and aspartate transaminase (AST) in the serum collected in the above step (3).
[0157] The results are as Figure 7 、 8As shown, intragastric administration of the EcN strain led to an increase in ALT and AST within the normal range. After a single large dose of alcohol was given, the values of AST and ALT showed abnormal increases, indicating that the liver cells were damaged to a certain extent. However, intragastric administration of the strain could significantly reduce the values of AST and ALT, indicating that the unmodified EcN strain itself has a certain protective effect on the liver and intestine. Moreover, the modified strain CEcN showed a more obvious protective effect on this basis. The AST value in the recombinant bacteria + alcohol group basically returned to the normal value range (existing studies have shown that the normal value range of AST is 139.4 ± 15.36, and the normal value range of ALT is 40.68 ± 9).
[0158] 3. Colonization of the EcN strain in mice
[0159] To verify the colonization effect of probiotics, the relative abundance of Escherichia coli in the colonic contents of mice in each experimental group was detected. As Figure 9 shown in A (where EC represents the modified strain CEcN), the EcN strain introduced by intragastric administration significantly increased the abundance of Escherichia coli, and the modified strain CEcN showed an enhanced abundance of Escherichia coli compared with the wild strain WT. In addition, after intragastric administration of alcohol, the strain CEcN also showed an enhanced abundance of Escherichia coli compared with the wild strain WT. The above results strongly prove that the EcN strain successfully colonized in the mouse intestine, and the colonization effect of the modified strain CEcN is better than that of the wild strain.
[0160] Furthermore, by analyzing the differences in the distribution of the top 30 species at different taxonomic levels (phylum, class, order, family, genus, species) among different groups, the probiotic effects of probiotics were verified. The results are as Figure 9 shown in B ( Figure 9In group B (S1: NC14, S2: NC14 + Alcohol, S3: WT14, S4: WT14 + Alcohol, S5: EM14, S6: EM14 + Alcohol), compared with the blank group, the recombinant bacteria group significantly up-regulated the abundance of Lactobacillus Muribaculaceae, which is a part of the intestinal microbial community and plays an important role in maintaining intestinal health. Existing research (Muribaculaceae Genomes Assembled from Metagenomes Suggest Genetic Drivers of Differential Response to Acarbose Treatment in Mice, DOI: 10.1128 / msphere.00851-21) shows that Muribaculaceae strains have a certain effect on alleviating some intestinal diseases, such as inflammatory bowel disease, irritable bowel syndrome, etc. They can reduce intestinal inflammation, improve intestinal function, and improve the quality of life of patients.
[0161] 4. Liver and intestine sampling and sectioning
[0162] The liver and colon samples collected in step (3) above were subjected to HE staining to observe the protective effect of the strains on the liver and intestine.
[0163] The results of HE staining (hematoxylin-eosin staining method) of the liver in the blank group are as Figure 10 shown in A, with densely arranged cells and plump cell bodies. Under the condition of drinking (control + alcohol group), as Figure 10 shown in B, the liver lipid level increased, and intragastric administration of the original EcN bacteria slightly alleviated this situation (original bacteria + alcohol group, Figure 10 C), but the alleviating effect was not obvious. Compared with the original EcN bacteria, intragastric administration of the modified bacteria CEcN could significantly reduce the liver lipid level (recombinant bacteria + alcohol group, Figure 10 D).
[0164] After drinking, the gastrointestinal tract is the most burdened tissue among all tissues. Alcohol stimulation can cause the hypertrophy of intestinal goblet cells. The HE staining results show that compared with the blank group ( Figure 11 A), under the condition of drinking (control + alcohol group, Figure 11 B), goblet cell hypertrophy was significantly shown, and this situation was not significantly alleviated in the original bacteria + alcohol group ( Figure 11 C). However, the hypertrophy of intestinal goblet cells caused by alcohol stimulation was effectively inhibited in the recombinant bacteria + alcohol group ( Figure 11 D).
[0165] In summary, the engineered strain can effectively reduce the negative impacts on organs such as the liver and intestine, providing a new strategy for treating and preventing the negative impacts of alcohol.
[0166] Although the present invention has been disclosed above with the preferred embodiments, it is not intended to limit the present invention. Any person familiar with this technology can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the protection scope of the present invention should be defined by the claims.
Claims
1. A genetically engineered bacterium, characterized in that: The genetically engineered bacteria used Escherichia coli Nissle 1917 as the starting strain, and the following genes on the genome of the starting strain were knocked out: ornithine carbamoyltransferase encoding gene argF-1 and argF-2 , repressor protein encoding genes argR , L-arginine decarboxylase gene adiA , L-arginine decarboxylase gene speA , L-ornithine decarboxylase gene f , L-ornithine decarboxylase gene speC , arginine N-succinyltransferase gene astA , L-glutamate decarboxylase gene gadA , L-glutamate decarboxylase gene gadB , glutamine synthetase encoding gene gL and aminotransferase encoding genes ilvE ; The C1 promoter drives the gene encoding N-acetylglutamate synthetase argA The nucleotide sequence of the C1 promoter is shown in SEQ ID NO.1; The bifunctional ornithine acetyltransferase ArgJ, acetyltransferase cg3035, glucose transporter uptake protein Ptsg, L-ornithine transporter LysE, and valine transporter LysO were overexpressed; The gene argF-1, argF-2, argR , adiA , speA , f , speC , astA , gadA , gadB , glnA、ilvE、 argA Respectively having the nucleotide sequences shown in NZ_CP022686.1: 3301914…3302918, 3306280…3307284, 2116545…2117015, 3159100…3161367, 1703274…1705250, 4242979…4245177, 1726274…1728409, 306723…307757, 2413531…2414931, 79471…80871, 2842648…2844057, 2714253…2715182, 1581375…1582706; The N-acetylglutamate synthetase ArgJ, acetyltransferase cg3035, glucose transport and absorption protein Ptsg, L-ornithine transporter LysE, and valine transporter LysO have the amino acid sequences shown in NCBI accession numbers WP_003947122.1, AJE67343.1, WP_000475719.1, AGN22026.1, and WP_000491135.1, respectively; The overexpression is to integrate the coding genes of N-acetylglutamate synthetase ArgJ, acetyltransferase Cg3035, glucose transporter and absorber Ptsg, L-ornithine transporter LysE, and valine transporter LysO into the genome of the starting strain. cybc, yghD, ilvG , Yj Y , ilvC Gene loci and knock out the genes at the corresponding loci at the same time.
2. A bacterial agent containing the genetically engineered bacteria according to claim 1.
3. The bacterial agent according to claim 2, characterized in that The content of the genetically engineered bacteria in the bacterial agent is not less than 5×10 9 CFU / mL or 5×10 9 CFU / g.
4. A method for producing L-ornithine, characterized in that: The method comprises using the genetically engineered bacteria of claim 1 to ferment and produce L-ornithine.
5. The method according to claim 4, characterized in that The method comprises the following steps: (1) streaking a plate to activate the genetically engineered bacteria, and inoculating it into a seed culture medium to obtain a seed solution; (2) Transferring the seed solution obtained in step (1) to a fermentation medium for fermentation to produce L-ornithine.
6. Use of the genetically engineered bacteria according to claim 1, or the bacterial agent according to claim 2 or 3, or the method according to claim 4 or 5 in the preparation of L-ornithine or a product containing L-ornithine.
7. Use of the genetically engineered bacteria according to claim 1, or the bacterial agent according to claim 2 or 3, in the preparation of a medicine for treating liver or intestinal damage-related diseases; the liver or intestinal damage-related diseases include alcoholic fatty liver, cirrhosis or colitis.
Citation Information
Patent Citations
Genetically engineered bacterium for producing L-ornithine as well as construction method and application of genetically engineered bacterium
CN116162581A
Construction and application method for L-ornithine synthesis bacteria
CN104031933A
Method for synthesizing L-ornithine in corynebacterium crenatum
CN108642100A