Recombinant plasmid, construction method and prokaryotic expression method of μ-conotoxin peptide

Abstract

The present invention discloses a recombinant plasmid, a construction method and a prokaryotic expression method of μ-conotoxin peptide. A construction method of a recombinant plasmid for prokaryotic expression of μ-conotoxin peptide comprises the following steps: 1) modifying the amino acid sequence of μ-conotoxin peptide; 2) codon optimizing the modified amino acid sequence to obtain an optimized base sequence; 3) performing gene synthesis according to the base sequence and cloning it into a vector to obtain a synthetic plasmid; 4) transforming the synthetic plasmid through Escherichia coli to obtain a transformed plasmid; 5) amplifying the transformed plasmid through a first primer, a second primer and a third primer to obtain an amplified target product; 6) homologously recombine the linearized synthetic plasmid and the amplified target product to obtain a homologous recombination product; transforming the homologous recombination product into Escherichia coli to obtain a recombinant plasmid. The recombinant plasmid of the present invention is conducive to the prokaryotic expression of μ-conotoxin peptide.

Description

Technical Field

[0001] The invention relates to a recombinant plasmid, a construction method and a prokaryotic expression method of a μ-conotoxin peptide, and in particular to a recombinant plasmid for prokaryotic expression of a μ-conotoxin peptide and a construction method thereof, and a prokaryotic expression method of a μ-conotoxin peptide. Background Art

[0002] Conotoxin (CTX) originates from the venom tubes and venom glands of the marine gastropod invertebrate Conus. There are many species of these Conus, and the composition of their toxins varies by species and region, but in general they are composed of a variety of active polypeptides and are mixed toxins. Conotoxins are mainly composed of 7-40 amino acid residues, are rich in cysteine, and have a highly conserved disulfide bond backbone structure. These polypeptides have highly specific activity on calcium and sodium channels and nervous system receptors, and are one of the known biological neurotoxin peptides with the smallest nucleic acid number.

[0003] μ-conotoxin can act on various subtypes of sodium channels. It can not only be used to study the structure and distribution of sodium channels, but also has great potential in developing blockers of different subtypes of voltage-gated sodium ion channels. It has been reported that biological conotoxin peptides have shown extremely specific and efficient performance in the field of anti-wrinkle skin care. They achieve anti-aging and wrinkle reduction effects by simulating or promoting the effects of endogenous active substances in the skin, such as promoting collagen synthesis, inhibiting free radical generation, regulating cell proliferation and differentiation, etc. The core advantage of this polypeptide is that it can highly specifically recognize and act on the voltage-gated sodium ion channel Nav1.4 on the skeletal muscle cell membrane. This channel plays a vital role in regulating muscle contraction and relaxation.

[0004] At present, the synthesis methods of peptides are mainly divided into two categories: chemical methods and biological methods. The chemical method is to synthesize large peptides by gradually reacting small molecule amino acids; among them, Fmoc solid phase synthesis method and Boc solid phase synthesis method are more common synthesis methods. The biological method is to synthesize peptides using biotechnology means, such as genetic recombination technology, fermentation technology and other methods.

[0005] CN116836255A discloses a chemical synthesis preparation method of μ-conotoxin peptide, comprising the following steps: the first step, using solid phase synthesis technology to sequentially couple side chain protected amino acid residues or side chain unprotected amino acid residues to prepare μ-conotoxin peptide resin, then removing the resin and amino acid residue side chain protecting groups to prepare μ-conotoxin peptide main chain linear peptide; the second step, sequentially oxidizing the Cys residues of the μ-conotoxin peptide main chain linear peptide with DMSO and iodine solution, pairing into rings, and obtaining μ-conotoxin crude peptide; the third step, using high performance liquid chromatography, purifying the μ-conotoxin crude peptide through two purifications and one salt conversion to obtain μ-conotoxin peptide refined product. The linking reagent used in the solid phase synthesis of the patent document may have toxic residues, which may have a potential impact on the quality of the polypeptide. In addition, the intermediate miscellaneous peptides on the solid phase carrier may be difficult to completely separate, thereby affecting the quality of the final product. In addition, the chemical synthesis method requires a large amount of chemical reagents, which is not conducive to environmental protection.

[0006] CN116355932A discloses a method for preparing μ-conotoxin, comprising the following steps: introducing a recombinant vector including a GST tag encoding gene, an enterokinase recognition sequence encoding gene and a μ-conotoxin encoding gene into an expression system for biological expression, and purifying, cutting and separating the expression product in sequence. Although the patent document uses a GST tag to achieve the expression of a polypeptide, the disadvantage is that the molecular weight of the tag is too large, and after adding the remaining auxiliary proteins, the proportion of the polypeptide in the fusion protein is extremely low, resulting in a reduced yield. And when the protein is insoluble, it is difficult to purify the inclusion body protein by a denaturing method.

[0007] CN117343947A discloses a method for preparing a recombinant μ-conotoxin CnIIIC small molecule peptide, wherein a recombinant μ-conotoxin CnIIIC small molecule peptide is prepared by introducing a recombinant vector into an expression system for biological expression, wherein the recombinant vector sequentially includes a SUMO protein tag encoding gene and a μ-conotoxin CnIIIC encoding gene. The patent document uses a SUMO tag to construct a fusion protein expression vector. First, the SUMO protease cuts by recognizing the spatial structure of the SUMO tag, and the cutting efficiency is easily affected by the different properties of the amino acid residues near the recognition site. Moreover, the SUMO tag is often used in conjunction with other tags for purification. At this time, the 11kda SUMO tag can only be used in conjunction with a small molecular weight purification tag to ensure the yield of the target protein in the fusion protein. More importantly, SUMO is a ubiquitin-like modified protein that can be highly specifically recognized by the SUMO protease, and most eukaryotic cells have SUMO protease, which is very easy to degrade the SUMO tag. Therefore, generally, the SUMO tag cannot be used for the expression of eukaryotic cells, and also affects the subsequent experiments such as direct activity determination of the fusion protein in vitro. Summary of the invention

[0008] One object of the present invention is to provide a method for constructing a recombinant plasmid for prokaryotic expression of μ-conotoxin peptide. The obtained recombinant plasmid is conducive to the prokaryotic expression of μ-conotoxin peptide and is conducive to increasing the yield of μ-conotoxin peptide. Another object of the present invention is to provide a recombinant plasmid obtained according to the construction method of the recombinant plasmid as described above. Another object of the present invention is to provide a method for prokaryotic expression of μ-conotoxin peptide.

[0009] The present invention adopts the following technical solutions to achieve the above-mentioned purpose.

[0010] In one aspect, the present invention provides a method for constructing a recombinant plasmid for prokaryotic expression of μ-conotoxin peptide, comprising the following steps:

[0011] 1) modifying the amino acid sequence of μ-conotoxin peptide, wherein the modified amino acid sequence is shown in SEQ ID NO: 1;

[0012] 2) codon-optimizing the modified amino acid sequence to obtain an optimized base sequence, which is shown in SEQ ID NO: 2;

[0013] 3) Performing gene synthesis according to the base sequence obtained in step 2) and cloning it into a vector to obtain a synthetic plasmid;

[0014] 4) Transforming the synthetic plasmid obtained in step 3) by Escherichia coli to obtain a transformation plasmid;

[0015] 5) amplifying the transformation plasmid obtained in step 4) by using a first primer, a second primer and a third primer to obtain an amplified target product; wherein the sequence of the first primer is shown in SEQ ID NO:3, the sequence of the second primer is shown in SEQ ID NO:4, and the sequence of the third primer is shown in SEQ ID NO:5;

[0016] 6) Performing homologous recombination on the linearized synthetic plasmid and the amplified target product obtained in step 5) to obtain a homologous recombination product; transforming the homologous recombination product into Escherichia coli to obtain a recombinant plasmid.

[0017] According to the construction method of the present invention, preferably, in step 1), modifying the amino acid sequence of the μ-conotoxin peptide comprises: retaining the segment that interacts with Nav1.4, and changing the remaining amino acids to arginine.

[0018] According to the construction method of the present invention, preferably, in step 3), the vector is pET-32a(+).

[0019] According to the construction method of the present invention, preferably, in step 4), the synthetic plasmid is transformed through Escherichia coli competent cells DH5α using a heat shock method.

[0020] According to the construction method of the present invention, preferably, in step 5), the transformation plasmid is amplified by the first primer and the third primer to obtain an amplified product; the amplified product is further amplified by the second primer and the third primer to obtain an amplified target product.

[0021] According to the construction method of the present invention, preferably, in step 6), the linearized synthetic plasmid is obtained by double enzyme digestion of the synthetic plasmid.

[0022] On the other hand, the present invention also provides a recombinant plasmid for prokaryotic expression of μ-conotoxin peptide, which is obtained according to the construction method described above.

[0023] In another aspect, the present invention also provides a prokaryotic expression method of μ-conotoxin peptide, comprising the following steps:

[0024] (a) transferring the recombinant plasmid described above into Escherichia coli, culturing, inducing expression, and obtaining a fusion protein;

[0025] (b) Purifying the fusion protein, enzymatically digesting it, ultrafiltering it, concentrating it, and performing chromatography separation to obtain the μ-conotoxin peptide.

[0026] According to the prokaryotic expression method of the present invention, preferably, in step (a), the recombinant plasmid is transferred into Escherichia coli competent cells Shuffle T7, cultured, and induced to express to obtain the fusion protein.

[0027] According to the prokaryotic expression method of the present invention, preferably, in step (b), the fusion protein is purified by a nickel chromatography column to obtain a purified eluate; the purified eluate is enzymatically digested and then ultrafiltered, the ultrafiltrate is concentrated, and the concentrated solution is separated by molecular sieve chromatography to obtain the μ-conotoxin peptide.

[0028] The recombinant plasmid of the present invention is conducive to the prokaryotic expression of μ-conotoxin peptide. The prokaryotic expression method of μ-conotoxin peptide of the present invention is conducive to improving the yield of μ-conotoxin peptide. According to the preferred technical scheme of the present invention, the present invention is easier to perform prokaryotic expression by modifying the amino acid sequence of μ-conotoxin peptide and optimizing codons; the present invention adopts specific primers to amplify and introduce enterokinase cleavage sites, and the combination with S tag is conducive to tracing. The present invention transfers the homologous recombination product into the Escherichia coli competent cell Shuffle T7, and the fusion protein has no redundant amino acids after enterokinase cleavage, and the expressed recombinant protein is easy to purify and has high yield. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 It is the sequencing result of the recombinant plasmid of the present invention and the main element diagram of the gene map. Figure 1 In the assay, F1 is the first primer, F2 is the second primer, and R is the third primer.

[0030] Figure 2 It is the agarose gel identification result of the amplified target product of the present invention. Figure 2 In the figure, target product 1 refers to the amplified target product. Double-enzyme digestion product 2 refers to the linearized synthetic plasmid.

[0031] Figure 3 This is the electrophoresis result of the fusion protein of the present invention. Figure 3 In the figure, Eμ whole cells refers to the whole cell solution of the fusion protein, Eμ supernatant refers to the supernatant containing the fusion protein after centrifugation, and Eμ precipitate refers to the precipitate corresponding to the supernatant; the arrow points to the target fusion protein. DETAILED DESCRIPTION

[0032] The present invention is further described below in conjunction with specific embodiments, but the protection scope of the present invention is not limited thereto.

[0033] Recombinant plasmid and construction method

[0034] The present invention provides a recombinant plasmid for prokaryotic expression of μ-conotoxin peptide, and the construction method of the recombinant plasmid comprises the following steps:

[0035] 1) modifying the amino acid sequence of μ-conotoxin peptide, wherein the modified amino acid sequence is shown in SEQ ID NO: 1;

[0036] 2) codon-optimizing the modified amino acid sequence to obtain an optimized base sequence, the base sequence of which is shown in SEQ ID NO: 2;

[0037] 3) Performing gene synthesis according to the base sequence obtained in step 2) and cloning it into a vector to obtain a synthetic plasmid;

[0038] 4) Transforming the synthetic plasmid obtained in step 3) by Escherichia coli to obtain a transformation plasmid;

[0039] 5) amplifying the transformation plasmid obtained in step 4) by using a first primer, a second primer and a third primer to obtain an amplified target product; wherein the sequence of the first primer is shown in SEQ ID NO:3, the sequence of the second primer is shown in SEQ ID NO:4, and the sequence of the third primer is shown in SEQ ID NO:5;

[0040] 6) The linearized synthetic plasmid and the amplified target product obtained in step 5) are homologously recombined to obtain a homologous recombination product; the homologous recombination product is transformed into Escherichia coli to obtain a recombinant plasmid. The recombinant plasmid obtained in this way is conducive to increasing the yield of the obtained μ-conotoxin peptide.

[0041] In step 1), the amino acid sequence of the μ-conotoxin peptide is modified by retaining the segment that interacts with Nav1.4 and changing the remaining amino acids to arginine. This is conducive to the prokaryotic expression of the μ-conotoxin peptide and increases the yield. The modified amino acid sequence is RGCCNRRRRCSSKWCRDHRRCC (as shown in SEQ ID NO: 1).

[0042] For μ-conotoxin peptide, the polypeptide has a small molecular weight, is rich in disulfide bonds and is very easy to form inclusion bodies and is easily degraded. Therefore, direct prokaryotic expression will result in a low yield.

[0043] In the prior art, the amino acid sequence of μ-conotoxin peptide is generally obtained directly from the database without modification. The inventors of the present application have found through extensive research that the amino acid sequence of μ-conotoxin peptide can be modified, retaining the segment that interacts with Nav1.4 and changing the remaining amino acids to arginine, thereby facilitating the prokaryotic expression of μ-conotoxin peptide and increasing the yield.

[0044] In the present invention, a stop codon is added at the end of the modified amino acid sequence.

[0045] In step 2), the modified amino acid sequence is codon-optimized for E. coli preference.

[0046] In step 3), the optimized base sequence obtained can be entrusted to a company for gene synthesis. The synthesized gene is cloned into a vector. The vector can be pET-32a (+). In the present invention, the synthetic plasmid can be recorded as pET-32a-μ.

[0047] In step 4), the transformation is performed by heat shock method. Common Escherichia coli can be used. For example, Escherichia coli competent cells DH5α and DH10B can be used, preferably Escherichia coli competent cells DH5α. These Escherichia coli are commercially available products, so no additional preservation evidence and genetic resource registration information are required.

[0048] In step 5), the transformation plasmid is amplified by the first primer and the third primer to obtain an amplified product; the amplified product is amplified by the second primer and the third primer to obtain the amplified target product. The present invention designs a first primer with a protease series, a second primer with a homology arm, and a third primer with a homology arm for the transformation plasmid. The 5′→3′ sequences of these three primers are shown in SEQ ID NO:3, SEQ ID NO:4, and SEQ ID NO:5, respectively. The primers used in the present invention are specific primers, which are conducive to the prokaryotic expression of μ-conotoxin peptide and increase its yield. The primers used in the present invention are not conventionally selected.

[0049] According to one embodiment of the present invention, the transformation plasmid, the first primer, the third primer, and 2× Phanta MaxMaster Mix (Dye Plus) are mixed and ddH 2 O The volume of the mixture is supplemented to a predetermined volume to obtain a first mixture; then the first mixture is pre-denatured, denatured, annealed, extended, and the process of denaturation, annealing, and extension is repeated multiple times, and then the total extension is performed; purification is performed to obtain an amplified product. The amplified product, the second primer, the third primer, and 2 × Phanta Max Master Mix (Dye Plus) are mixed and ddH 2 O The volume of the mixture is supplemented to a predetermined volume to obtain a second mixture; the second mixture is then pre-denatured, denatured, annealed, and then extended, and the process of denaturation, annealing and extension is repeated multiple times, followed by total extension; purification is performed to obtain the amplified target product.

[0050] Wherein, the temperature of the pre-denaturation can be 92-97°C, for example, 95°C, and the time of the pre-denaturation can be 2.5-3.5min, for example, 3min. The temperature of the denaturation can be 92-97°C, for example, 95°C, and the time of the denaturation can be 12-18s, for example, 15s. The temperature of the annealing can be 50-60°C, for example, 56°C. The time of the annealing can be 12-18s, for example, 15s. The temperature during the extension can be 65-75°C, for example, 72°C. The time of the extension can be 1.5-3min, for example, 2min. The number of repetitions of the process of denaturation, annealing and extension can be 15-40 times, for example, 35 times. The temperature during the total extension can be 65-75°C, for example, 72°C. The total extension time can be 2-4min, such as 3min.

[0051] In this step, the purification method can be carried out according to the TAKARA purification kit (9761).

[0052] In step 6), the linearized synthetic plasmid is obtained by double restriction digestion of the synthetic plasmid.

[0053] The homologous recombination product is transformed into Escherichia coli to obtain a recombinant plasmid; wherein, Escherichia coli competent cells DH5α and DH10B can be used, preferably Escherichia coli competent cells DH5α.

[0054] The recombinant plasmid obtained by the invention is conducive to the prokaryotic expression of the μ-conotoxin peptide, so that the μ-conotoxin peptide has good biological activity and the yield of the μ-conotoxin peptide is increased.

[0055] Prokaryotic expression method of μ-conotoxin peptide

[0056] The present invention also provides a prokaryotic expression method of μ-conotoxin peptide, comprising the following steps:

[0057] (a) transferring the recombinant plasmid described above into Escherichia coli, culturing, inducing expression, and obtaining a fusion protein;

[0058] (b) Purifying the fusion protein, enzymatically digesting it, ultrafiltering it, concentrating it, and separating it by chromatography to obtain the μ-conotoxin peptide, which is beneficial to obtaining the μ-conotoxin peptide with good biological activity and improving its yield.

[0059] In step (a), the recombinant plasmid is transferred into the competent E. coli cell Shuffle T7, cultured, induced to express, and obtain the fusion protein. The present invention finds that the use of the competent E. coli cell Shuffle T7 is more conducive to increasing the yield of μ-conotoxin peptide.

[0060] In the present invention, the culture and expression induction methods may be those known in the art.

[0061] In certain embodiments, the recombinant plasmid is transferred into the competent cell Shuffle T7 of Escherichia coli, and a single bacterium is picked and cultured overnight in LB liquid medium containing ampicillin resistance. The overnight cultured bacterial liquid is inoculated into the liquid LB medium containing resistance according to the proportion for expansion culture, cultured at 37°C for 4-5h, and rapidly cooled when the OD=0.6-0.8 is monitored, and IPTG is added. Culture at about 16°C overnight. Centrifuge at 4°C to collect the induced expression bacteria to prevent protein denaturation or degradation. After washing the bacteria twice with PBS, resuspend the bacteria with PBS, and the resuspension concentration is controlled between 6% and 8%. Use an ultrasonic crusher to crush the bacteria. During the crushing process, the sample needs to be kept in an ice-water mixture to control the temperature and prevent protein carbonization. According to the concentration and crushing effect of the bacteria, the crushing time, power and amplitude are adjusted in time to crush the bacteria until the bacteria are clear. The crushed sample is centrifuged to collect the soluble protein in the whole bacteria, supernatant, and urea-dissolved precipitate. Among them, the soluble protein in the supernatant was used as the target fusion protein.

[0062] In step (b), the fusion protein in the supernatant is purified by a nickel chromatography column to obtain a purified eluate; the purified eluate is enzymatically digested and then ultrafiltered, the ultrafiltrate is concentrated, and the concentrated solution is separated by molecular sieve chromatography to obtain the μ-conotoxin peptide.

[0063] The method of purification using nickel chromatography column can be those known in the art. In the present invention, imidazole buffer is used for gradient elution. The flow rate is 12-16 ml / h, such as 15 ml / h.

[0064] The present invention does not use SUMO tag, but uses Trx-S tag-His as the tag of fusion protein. The present invention believes that Trx is used to promote dissolution, and S tag is used as a small molecular weight tag, which can be traced by specific antibodies, so that downstream experiments can be carried out more smoothly, and the research in the drug-making process can be promoted. In addition, the introduced enterokinase site does not have redundant amino acids, and the expressed recombinant protein is easy to purify, has a moderate molecular weight, and has a high yield.

[0065] The average molecular weight of the μ-conotoxin peptide obtained by the invention is about 2794 g / mol.

[0066] The present invention is further described below by means of specific examples. The mass spectrometry analysis was performed using Electrospray Ionization Mass Spectrometry (ESI-MS) (Waters Xevo TQD, Milford, MA, USA).

[0067] Example 1 - Construction of recombinant plasmid

[0068] 1) The amino acid sequence of μ-conotoxin peptide was modified, and the modified amino acid sequence was RGCCNRRRRCSSKWCRDHRRCC (as shown in SEQ ID NO: 1), and a stop codon was added at the end.

[0069] 2) The modified amino acid sequence was codon optimized, and the preference of Escherichia coli was taken into consideration during the optimization to obtain an optimized base sequence, the base sequence of which was CGTGGTTGTTGTAATCGTCGTCGCCGTTGTAGCAGTAAATGGTGTCGTGATCATCGTCGTTGCTGCTAA (as shown in SEQ ID NO: 2).

[0070] 3) Submit the base sequence to Wuhan Jinkairui Biological Company for gene synthesis and clone into the vector pET-32a (+). The 5' end of the gene insertion restriction site is Kpn I, and the 3' end is Xho I. The synthetic plasmid is obtained. It is recorded as pET-32a-μ.

[0071] 4) The synthetic plasmid was transformed with E. coli competent cells DH5α to obtain the transformation plasmid. The specific steps include: evenly mix 10μl pET-32a-μ and DH5α on ice, let stand for 40min, heat shock in a 42℃ water bath for 45s and then quickly ice bath for 3min, add 900μl LB medium, shake at 37℃ for 1h, centrifuge at 5000rpm for 10min, discard 900μl supernatant, mix the remaining 100μl by pipetting, and then spread it on a solid LB culture dish with ampicillin resistance, invert and culture overnight for 14h, and several single colonies will form on the culture dish. Pick a single colony into 30ml liquid LB culture medium containing ampicillin resistance, culture at 37℃ for 12h, and then extract the plasmid. The above experiments were all carried out in a sterile environment, and the shaking speed was set to 220rpm.

[0072] The steps of plasmid extraction according to the method indicated by DC 201 of Novizan Company are as follows: centrifuge the bacterial solution at 10000rpm for 1min. Discard the culture medium and repeat the operation with pure water to wash the bacteria. Add 250μl Buffer P1 to the centrifuge tube with bacterial sediment and vortex to mix, add 250μl Buffer P2, gently invert upside down to mix, add 350μl Buffer P3, immediately and gently invert upside down to neutralize Buffer P2, and centrifuge at 12000rpm for 10min. Pass the supernatant through the adsorption column, add 600μl Buffer PW2, and add 100μl Elution Buffer to elute to obtain the transformed plasmid.

[0073] 5) Mix 2 μl of the obtained transformation plasmid, 2 μl of the first primer (2 μM), 2 μl of the third primer (2 μM), and 12.5 μl of 2 × PhantaMax Master Mix (Dye Plus) and add ddH 2 O to make the volume of the mixture 20 μl. Then pre-denature at 95°C for 3 min, continue to denature at 95°C for 15 s, then cool to 52°C for 15 s, extend at 72°C for 2 min, repeat the denaturation, annealing and extension cycle 35 times, and then perform a total extension at 72°C for 3 min, and then purify according to the TAKARA purification kit (9761). Obtain the amplified product.

[0074] Mix 2 μl of amplified product, 2 μl of second primer (2 μM), 2 μl of third primer (2 μM), and 12.5 μl of 2 × Phanta Max Master Mix (Dye Plus) and add ddH 2O to make the volume of the mixture 20 μl. Then pre-denature at 95°C for 3 min, continue to denature at 95°C for 15 s, then cool to 52°C for 15 s, extend at 72°C for 2 min, repeat the denaturation, annealing and extension cycle 35 times, and then perform a total extension at 72°C for 3 min, and then purify according to the TAKARA purification kit (9761). The amplified target product was obtained.

[0075] The purification method is as follows: add 100 μl of Buffer DC to the total extension reaction solution and mix evenly, transfer the solution to the adsorption column, centrifuge for 1 min, repeat the operation once, and discard the filtrate. Add 700 μl of Buffer WB to rinse the adsorption membrane twice and centrifuge for 30 seconds. Add 30 μl of sterile water to the center of the adsorption membrane to elute the target product. Centrifuge at room temperature using 12000 rpm.

[0076] Among them, the sequence of the first primer is shown as SEQ ID NO:3, the sequence of the second primer is shown as SEQ ID NO:4, and the sequence of the third primer is shown as SEQ ID NO:5.

[0077] 6) Mix 1.5 μg of pET-32a-μ plasmid, 1 μl of Kpn I and Xho I, and 2 μl of 1×M Buffer, add sterile water to the system to 20 μl, and cut at 37°C for 4 hours. Then purify the enzymatic reaction solution according to the above purification method to obtain a linearized synthetic plasmid.

[0078] The linearized synthetic plasmid and the amplified target product were homologously recombined, including the following steps: 80 ng of the linearized synthetic plasmid was input, 76 ng of the inserted fragment (the fragment refers to the amplified target product obtained above), then 2 μl of Exnase II and 4 μl of 5 × CE II Buffer were added, mixed evenly, and then ddH 2 O The volume of the reaction system was supplemented to 20 μl and reacted at 37°C for 30 min to obtain homologous recombination products.

[0079] The homologous recombination product was transformed into the competent E. coli cell DH5α according to the transformation method described in step 4), and the recombinant plasmid was extracted and sequenced to obtain the recombinant plasmid, which was recorded as pET-32a-Eμ.

[0080] Sequencing results and major elements in the gene map such as Figure 1 The linearized synthetic plasmid and the amplified target product were identified by agarose gel. Figure 2 .

[0081] Example 2-Prokaryotic Expression of μ-Conotoxin Peptide

[0082] The recombinant plasmid (pET-32a-Eμ) obtained in Example 1 was transferred into the competent cell Shuffle T7 of Escherichia coli according to the transformation method described in step 4), and a single bacterium was picked and cultured overnight in LB liquid medium containing ampicillin resistance. The overnight cultured bacterial solution was inoculated into the liquid LB medium containing resistance at a ratio of 1:100 for expansion culture, cultured at 37°C for 4h, and rapidly cooled when OD=0.6-0.8 was monitored, and IPTG at a concentration of 1M was added. 16°C, 120rpm overnight culture for 24h. Centrifuge at 7500rpm for 10min at 4°C, collect the induced expression bacteria, and prevent protein denaturation or degradation. After washing the bacteria twice with PBS, resuspend the bacteria with PBS, and the resuspension concentration is controlled between 6% and 8%. Use an ultrasonic disruptor to disrupt the bacteria. During the disruption process, the sample needs to be kept in an ice-water mixture to control the temperature and prevent protein carbonization.

[0083] According to the concentration and disruption effect of the bacteria, the disruption time, power and amplitude are adjusted in time to disrupt the bacteria until they are clear. The disrupted samples are centrifuged to collect the whole bacteria, supernatant and soluble protein in the precipitate after urea dissolution.

[0084] The soluble proteins in the whole bacteria, supernatant, and urea-dissolved precipitate were analyzed separately. The analysis method is as follows: take 24 μl of the above soluble protein, mix 6 μl of loading buffer (containing SDS and reducing agent) 6× loading buffer, boil the protein at 95℃ for 10 minutes, and perform 12% SDS-PAGE to detect the expression after cooling to room temperature. Wash and assemble the glass plates, fill them with water and let them stand to check for leakage. According to the recommended method of the kit, quickly mix the lower layer of gel and inject it between the glass plates, seal it with 300 μl of isopropanol and flatten the gel surface, wash off the isopropanol after the lower layer of gel solidifies, inject the upper layer of gel, insert the hole comb, and use it after the gel solidifies. Carefully add the treated sample to the sample well of the gel. Install the electrophoresis tank, add electrophoresis buffer, connect the electrophoresis instrument, and set the voltage of 240V for electrophoresis. After the electrophoresis is completed, take out the gel for staining, use the Coomassie brilliant blue staining method, recover the staining solution after staining for 3 hours, and use the decolorizing solution to remove the background color until the protein bands are clearly visible. The decolorizing solution contains 40% ethanol, 10% acetic acid and 50% distilled water. After decolorization, clear protein bands can be seen. In Shuffle T7, overnight culture at 16°C, 0.5mM IPTG, 120rpm for 24h can obtain better supernatant soluble expression, such as Figure 3 .

[0085] The fusion protein in the supernatant was purified by Ni chromatography column. The specific steps are as follows: Load Ni-NTA resin into a suitable chromatography column and balance it with NTA-0 Buffer with 10 times the volume of NTA. Slowly add the prepared supernatant to the chromatography column, and control the flow rate at about 15ml / hour. Use 5 times the volume of NTA-0 Buffer for washing, and control the flow rate at about 30ml / h to wash and remove unbound impurities. Use different concentrations of imidazole buffer (NTA-0, NTA-10, NTA-20, NTA-50, NTA-100, NTA-200, NTA-500 Buffer) for gradient elution. The imidazole concentration is gradually increased to competitively elute the target protein from the Ni-NTA resin. The flow rate is controlled at about 15ml / h, and the eluate is collected. The protein in the eluate was analyzed by SDS-PAGE electrophoresis to determine the purity and content of the fusion protein and obtain a high concentration of Trx-S tag-E-μ. Enterokinase digestion was performed to cut off Trx-Stag-E (same meaning as Trx-S tag-His) at the end of DDDDK, and the μ-conotoxin peptide was obtained by molecular sieve chromatography after ultrafiltration and concentration.

[0086] Among them, through mass spectrometry analysis, the average molecular weight of the obtained μ-conotoxin peptide was 2794.26 g / mol.

[0087] Among them, the electrophoresis analysis results show that there are about 165 mg of fusion protein in every 1000 mL of eluate. Compared with the prior art, the yield is improved.

[0088] In addition, the present application also found that if the E. coli competent cells Shuffle T7 are replaced with E. coli competent cells BL21 (DE3) or Rosetta (DE3), the yield of the fusion protein will be reduced, and accordingly, the yield of the μ-conotoxin peptide will also be reduced.

[0089] The present invention is not limited to the above-mentioned embodiments. Without departing from the essential content of the present invention, any deformation, improvement and substitution that can be thought of by those skilled in the art shall fall within the scope of the present invention.

Claims

1. A method for increasing the yield of μ-conotoxin peptide, characterized in that: The following steps are involved: 1) The amino acid sequence of μ-conotoxin peptide is modified, including: retaining the segment that interacts with Nav1.4, and the modified amino acid sequence is shown in SEQ ID NO: 1; 2) codon-optimizing the modified amino acid sequence to obtain an optimized base sequence, which is shown in SEQ ID NO: 2; 3) Performing gene synthesis according to the base sequence obtained in step 2) and cloning it into a vector to obtain a synthetic plasmid; 4) Transforming the synthetic plasmid obtained in step 3) by Escherichia coli to obtain a transformation plasmid; 5) amplifying the transformation plasmid obtained in step 4) by using a first primer, a second primer and a third primer to obtain an amplified target product; wherein the sequence of the first primer is shown in SEQ ID NO:3, the sequence of the second primer is shown in SEQ ID NO:4, and the sequence of the third primer is shown in SEQ ID NO:5; 6) homologously recombine the linearized synthetic plasmid and the amplified target product obtained in step 5) to obtain a homologous recombination product; transform the homologous recombination product into Escherichia coli to obtain a recombinant plasmid; 7) The recombinant plasmid is transferred into the competent E. coli cell Shuffle T7, cultured, induced to express, and obtain the fusion protein; 8) Purifying the fusion protein, enzymatically digesting, ultrafiltering, concentrating, and chromatographically separating to obtain μ-conotoxin peptide.

2. The method according to claim 1, characterized in that In step 8), the fusion protein is purified by a nickel chromatography column to obtain a purified eluate; the purified eluate is enzymatically digested and then ultrafiltered, the ultrafiltrate is concentrated, and the concentrated solution is separated by molecular sieve chromatography to obtain the μ-conotoxin peptide.

3. The method according to claim 1, characterized in that In step 3), the vector is pET-32a(+).

4. The method according to claim 1, characterized in that: In step 4), the synthesized plasmid is transformed through Escherichia coli competent cells DH5α using the heat shock method.

5. The method according to claim 1, characterized in that In step 5), the transformed plasmid is amplified by the first primer and the third primer to obtain an amplified product; the amplified product is further amplified by the second primer and the third primer to obtain an amplified target product.

6. The method according to claim 1, characterized in that In step 6), the linearized synthetic plasmid is obtained by double enzyme digestion of the synthetic plasmid.

Images