A molecular marker related to protein content in millet grains, KASP primer pair and its application

Abstract

The present invention belongs to the technical field of molecular markers and millet genetic breeding, and specifically relates to a molecular marker related to the protein content of millet grains, a KASP primer pair and an application thereof. The molecular marker provided by the present invention is located at 8815143bp on chromosome 3 of the millet genome, and the single nucleotide polymorphism is C / G; when the genotype of millet is CC or CG, it has a high grain protein content trait; when the genotype of millet is GG, it has a low grain protein content trait. The molecular marker described in the present invention is related to the protein content of millet grains, and can distinguish millets with high grain protein content from millets with low grain protein content. It is effective for identifying the protein content trait of millet grains, and can be applied to millet breeding and high-quality genetic improvement application research, providing a new choice for breeding applications to increase the protein content of millet.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular markers and millet genetic breeding, and particularly relates to a molecular marker related to the protein content of millet grains, a KASP primer pair and an application thereof. Background Art

[0002] Protein is an extremely complex nitrogen-containing organic compound. It is the material basis of life phenomena. All life activities are closely related to protein. The protein supply is directly related to people's physical fitness and intellectual level. It is also an important indicator of the degree of development of a country's economy, science and culture. Ensuring the supply of protein and improving the supply level of high-quality protein are one of the main tasks of my country's food plan. With the development of social economy and the improvement of living standards, people pay more and more attention to physical health and food nutrition. Therefore, it is of great significance to cultivate high-protein grain varieties and ensure the increase of protein harvest per unit area.

[0003] Millet, also known as "millet", is an important grain crop. Millet grains are rich in balanced protein, carbohydrates and fat, and also contain a variety of nutrients such as amino acids, phosphorus, iron and vitamins (vitamins A, B, C and D) required by the human body. After millet is shelled, it becomes millet. The protein content in millet is between 7.5% and 17.5%, of which albumin has the highest content, followed by alcohol-soluble protein, globulin, gluten and other proteins. The content of alcohol-soluble protein is about 41% to 77.5%, and the digestibility is 83.4%, which is much higher than rice and wheat. The protein in millet grains has the characteristics of low allergy, which is especially suitable for infants and the elderly. Millet contains amino acids required by the human body, among which the most abundant amino acids are glutamic acid, leucine, alanine, proline and aspartic acid. Lysine is the first limiting amino acid in millet, followed by tryptophan, methionine and cysteine. The content of essential amino acids in millet accounts for 44.70% of the total amino acids, which is higher than the essential amino acid content in the FAO reference protein (33.90%). Therefore, eating millet can prevent protein-energy malnutrition to a certain extent.

[0004] Discovering protein-related gene loci in millet grains and developing related molecular markers can not only provide a scientific basis for in-depth understanding of the nutritional characteristics of millet and improving millet quality and human diet, but also provide a theoretical basis for a deeper interpretation of the molecular genetic mechanism of the expression of quality-related traits in millet grains, and provide a theoretical basis for the use of molecular markers to improve the quality of millet varieties, help select special millet varieties, and promote millet breeding and production. Summary of the invention

[0005] The purpose of the present invention is to provide a molecular marker related to the protein content of millet grains, a KASP primer pair and an application thereof, so as to quickly screen and identify the protein content trait of millet grains and improve the breeding efficiency of millets with high grain protein content.

[0006] The invention provides a molecular marker related to the protein content of millet grains. The molecular marker is located at 8815143 bp on chromosome 3 of the millet genome, and the single nucleotide polymorphism is C / G.

[0007] Preferably, the molecular marker is located at 151 bp of the nucleotide sequence shown in SEQ ID NO.1, and the single nucleotide polymorphism is C / G.

[0008] The present invention also provides a KASP primer pair for identifying the molecular markers described in the above technical solution, comprising a forward primer 1, a forward primer 2 and a reverse primer;

[0009] The forward primer 1 includes a fluorescent label sequence 1 and a detection sequence 1 connected sequentially in the 5'-3' direction; the nucleotide sequence of the detection sequence 1 is shown in SEQ ID NO.2;

[0010] The forward primer 2 includes a fluorescent label sequence 2 and a detection sequence 2 connected sequentially in the 5'-3' direction; the nucleotide sequence of the detection sequence 2 is shown in SEQ ID NO.3;

[0011] The nucleotide sequence of the reverse primer is shown in SEQ ID NO.4;

[0012] The colors generated by the fluorescent tag sequence 1 and the fluorescent tag sequence 2 are different.

[0013] Preferably, the fluorescent label sequence 1 is FAM;

[0014] The fluorescent label sequence 2 is HEX.

[0015] The present invention also provides a kit for identifying the molecular markers described in the above technical solution, wherein the kit comprises the KASP primer pair described in the above technical solution.

[0016] The present invention also provides the use of the molecular marker or the KASP primer pair or the kit in the above technical solution in one or more of the following:

[0017] (1) Identify or assist in identifying the protein content of millet grains;

[0018] (2) distinguish between millet strains or varieties with high grain protein content and millet strains or varieties with low grain protein content;

[0019] (3) Cultivating or assisting in the cultivation of millet plants, strains, lines or varieties with high or low grain protein content;

[0020] (4) Screening or assisting in the screening of millet plants, strains, lines or varieties with high or low grain protein content;

[0021] (5) preparing a product for detecting the protein content trait of millet or millet hybrid progeny;

[0022] (6) preparing a product for distinguishing millet with high grain protein content from millet with low grain protein content;

[0023] (7) preparing products for breeding or assisting breeding of millet plants, strains, lines or varieties with high or low grain protein content traits;

[0024] (8) Prepare products for screening or assisting screening of millet plants, strains, lines or varieties with high or low grain protein content traits.

[0025] The present invention also provides a method for identifying the protein properties of millet grains, comprising the following steps:

[0026] Using the genomic DNA of the millet to be identified as a template, PCR amplification is performed using the KASP primer pair described in the above technical solution to obtain an amplified product;

[0027] Performing fluorescence detection on the amplified product and completing genotyping according to the fluorescence signal value;

[0028] If the genotyping result of the millet to be identified is CC or CG type, the millet to be identified has a high grain protein content trait;

[0029] If the genotyping result of the millet to be identified is GG type, the millet to be identified has a low grain protein content trait.

[0030] Preferably, the genomic DNA comprises leaf genomic DNA.

[0031] Preferably, the PCR amplification system, based on 10 μL, includes: 5 μL of HiGeno 2×Probe MixA solution, 0.14 μL of 100 μmol / L SNPPrimerMix solution, 4-50 ng of genomic DNA, and the balance of sterile water;

[0032] The volume ratio of 100 μmol / L forward primer 1, 100 μmol / L forward primer 2 and 100 μmol / L reverse primer in the SNPPrimerMix solution is 1:1:3.

[0033] Preferably, the PCR amplification program is: pre-denaturation at 95°C for 10 min; denaturation at 95°C for 20 s, extension at 55°C-61°C for 40 s, 10 cycles; denaturation at 95°C for 20 s, extension at 55°C-61°C for 40 s, 31 cycles.

[0034] Beneficial effects:

[0035] The molecular marker provided by the present invention is located at 8815143bp on chromosome 3 of the millet genome, and the single nucleotide polymorphism is C / G; when the genotype of millet is CC or CG, it has a high grain protein content trait; when the genotype of millet is GG, it has a low grain protein content trait. The molecular marker of the present invention is related to the protein content of millet grains, and can distinguish millets with high grain protein content from millets with low grain protein content.

[0036] The present invention develops a KASP primer pair based on the above molecular markers, which can select the protein content related to millet grains. Only simple genomic DNA extraction, PCR amplification, and KASP gene typing detection are required to complete rapid and high-throughput detection of samples, distinguish between millets with high grain protein content and millets with low grain protein content, and is effective in identifying the protein content trait of millet grains. It can be applied to millet breeding and high-quality genetic improvement application research, providing a new choice for breeding applications to increase the protein content of millet. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required to be used in the embodiments are briefly introduced below.

[0038] Figure 1 This is a genotyping diagram of different millet germplasms using the molecular markers of Example 1; wherein, the small circle in the oval circle 1 represents the millet germplasm with a high grain protein content of the genotype CC (a total of 28 test samples), the small circle in the oval circle 2 represents the template-free control NTC, the small circle in the oval circle 3 represents the millet germplasm with a low grain protein of the genotype GG (a total of 83 test samples), and the small circle in the oval circle 4 represents the millet germplasm with a high grain protein content of the genotype CG (a total of 3 test samples);

[0039] Figure 2 The statistical results of KASP genotyping and crude protein content; ** indicates statistically significant differences. DETAILED DESCRIPTION

[0040] The present invention provides a molecular marker related to the protein content of millet grains, wherein the molecular marker is located at 8815143 bp on chromosome 3 of the millet genome, and the single nucleotide polymorphism is C / G. In the present invention, the molecular marker is preferably located at 151 bp of the nucleotide sequence shown in SEQ ID NO.1, and the single nucleotide polymorphism is C / G. The nucleotide sequence shown in SEQ ID NO.1 of the present invention is specifically: 5'-TCCGGCCCGATCCTGCCCCTTGGCCACTTGAGATTATTACGCGCTAAGAA GCTTGACCCGGCTGCGTCAACGAAGAAGAAAGGCCAGCTAGATCAGAGCCGAGTGCGTGGCTGCGTCCATGGCCCCGCGGCGGCCCCAACCTAGGACGTAYGCGTGGTGGTTTAGCCGAGGACCACCCTAACCCGGCTAACCGTCGTCGATCCTTGCATGGATGGATCCTCCTCAAGTTAATTTTGTAGCTTATCCCGGCAAGGGGGCAAGTTGCAACTGCGCGACACTGTTTGGGGAATGAATGGCAGCC 3'; wherein, Y is a polymorphic site and the single nucleotide polymorphism is C / G.

[0041] The molecular marker provided by the present invention is located at 8815143bp on chromosome 3 of the millet genome, and the single nucleotide polymorphism is C / G; when the genotype of millet is CC or CG, it has a high grain protein content trait; when the genotype of millet is GG, it has a low grain protein content trait. The molecular marker of the present invention is related to the protein content of millet grains, and can distinguish millets with high grain protein content from millets with low grain protein content.

[0042] The present invention also provides a KASP primer pair for identifying the molecular marker described in the above technical solution, comprising a forward primer 1, a forward primer 2 and a reverse primer; the 5'-3' direction of the forward primer 1 comprises a fluorescent label sequence 1 and a detection sequence 1 connected in sequence; the nucleotide sequence of the detection sequence 1 is shown in SEQ ID NO.2; the 5'-3' direction of the forward primer 2 comprises a fluorescent label sequence 2 and a detection sequence 2 connected in sequence; the nucleotide sequence of the detection sequence 2 is shown in SEQID NO.3; the nucleotide sequence of the reverse primer is shown in SEQ ID NO.4; the colors generated by the fluorescent label sequence 1 and the fluorescent label sequence 2 are different.

[0043] In the present invention, the fluorescent label sequence 1 is preferably FAM; the fluorescent label sequence 2 is preferably HEX. The nucleotide sequence of the detection sequence 1 of the present invention is preferably as shown in SEQ ID NO.5; the nucleotide sequence of the detection sequence 1 is preferably as shown in SEQ ID NO.6.

[0044] The nucleotide sequences of SEQ ID NO.2 to 6 of the present invention are as follows:

[0045] SEQ ID NO.2: 5'-CTCGGCTAACCACCACGCC-3';

[0046] SEQ ID NO.3: 5'-CTCGGCTAACCACCACGCG-3';

[0047] SEQ ID NO.4: 5'-ACGAAGAAGAAAGGCCAGCTAGA-3';

[0048] SEQ ID NO.5:5'- GAAGGTGACCAAGTTCATGCT CTCGGCTAAACCACC ACGCC-3'; the underlined part is the FAM fluorescent tag sequence);

[0049] SEQ ID NO.6:5'- GAAGGTCGGAGTCAACGGATT CTCGGCTAAACCACC ACGCG-3'; the underlined part is the HEX fluorescent tag sequence)-3'.

[0050] The present invention also provides a kit for identifying the molecular markers described in the above technical solution, the kit comprising the KASP primer pair described in the above technical solution. The kit of the present invention preferably also includes other reagents for KASP detection, including but not limited to HiGeno 2×Probe MixA solution (Thermo Fisher Scientific Inc.) and / or sterile water.

[0051] The present invention develops KASP primer pairs and kits based on the molecular markers, which can select millet grain protein content-related factors, and can complete rapid and high-throughput detection of samples through simple genomic DNA extraction, PCR amplification, and KASP gene typing detection, thereby distinguishing millets with high grain protein content and millets with low grain protein content. The invention is effective in identifying the trait of millet grain protein content, and can be applied to millet breeding and high-quality genetic improvement application research, thereby providing a new option for breeding applications for increasing millet protein content.

[0052] In view of the effects of the molecular markers or the KASP primer pairs or the kit provided by the present invention, the use of the molecular markers or the KASP primer pairs or the kit in one or more of the following also falls within the protection scope of the present invention: (1) identifying or assisting in identifying the protein content of millet grains; (2) distinguishing millet strains or varieties with high grain protein content and millet strains or varieties with low grain protein content; (3) cultivating or assisting in cultivating millet individual plants, strains, strains or varieties with high or low grain protein content traits; (4) screening or assisting in screening millet strains with high or low grain protein content traits. (5) Preparation of products for detecting the grain protein content trait of millet or millet hybrid offspring; (6) Preparation of products for distinguishing millet with high grain protein content from millet with low grain protein content; (7) Preparation of products for cultivating or assisting in cultivating millet plants, lines, strains or varieties with high or low grain protein content; (8) Preparation of products for screening or assisting in screening millet plants, lines, strains or varieties with high or low grain protein content.

[0053] The present invention also provides a method for identifying the protein properties of millet grains, comprising the following steps:

[0054] Using the genomic DNA of the millet to be identified as a template, PCR amplification is performed using the KASP primer pair described in the above technical solution to obtain an amplified product;

[0055] Performing fluorescence detection on the amplified product and completing genotyping according to the fluorescence signal value;

[0056] If the genotyping result of the millet to be identified is CC or CG type, the millet to be identified has a high grain protein content trait;

[0057] If the genotyping result of the millet to be identified is GG type, the millet to be identified has a low grain protein content trait.

[0058] The present invention uses the genomic DNA of the millet to be identified as a template, and uses the KASP primer pair described in the above technical solution to perform PCR amplification to obtain an amplified product. In the present invention, the genomic DNA preferably includes leaf genomic DNA. The present invention has no strict requirements on the method for obtaining the genomic DNA, and conventional methods in the art can be used, such as CTAB (cetyltrimethylammonium bromide) extraction method.

[0059] In the present invention, the PCR amplification system is preferably based on 10 μL, preferably including: 5 μL of HiGeno 2×Probe MixA solution, 0.14 μL of 100 μmol / L SNP Primer Mix solution, 4-50 ng of genomic DNA and the remainder of sterile water. The volume ratio of forward primer 1, forward primer 2 and reverse primer in the SNP PrimerMix solution of the present invention is preferably 1:1:3; the independent concentrations of the forward primer 1, forward primer 2 and reverse primer are preferably 100 μmol / L, respectively. The PCR amplification program of the present invention is preferably: pre-denaturation at 95°C for 10 minutes; denaturation at 95°C for 20 seconds, extension at 55°C-61°C for 40 seconds, 10 cycles; denaturation at 95°C for 20 seconds, extension at 55°C for 40 seconds, 31 cycles.

[0060] After obtaining the amplified product, the present invention performs fluorescence detection on the amplified product, and completes genotyping according to the fluorescence signal value; if the genotyping result of the millet to be identified is CC or CG type, the millet to be identified has a high grain protein content trait; if the genotyping result of the millet to be identified is GG type, the millet to be identified has a low grain protein content trait. The fluorescence detection of the present invention preferably uses a fluorescence quantitative analyzer (ABI Co.USA) and Taqman Genotyper Software software.

[0061] The method provided by the present invention is simple, can quickly and high-throughput detect the genotype of the millet to be identified, determine the protein content trait of the millet grain, can be applied to millet breeding and high-quality genetic improvement application research, and provides a new option for breeding applications to increase the protein content of millet.

[0062] To further illustrate the present invention, a molecular marker related to the protein content of millet grains, a KASP primer pair and its application provided by the present invention are described in detail below in conjunction with the accompanying drawings and examples, but they should not be construed as limiting the scope of protection of the present invention.

[0063] Example 1

[0064] The seeds of 114 RIL population lines constructed with Jingu 21 and GBS as parents were used as experimental materials.

[0065] (1) Protein determination

[0066] After the experimental materials matured, the grains of different strains were used as samples, and their protein content was measured using a near-infrared quality analyzer. Specifically, mature millet ears were collected from the field, dried in the shade for 3 to 5 days, the grains were removed from the ears, and the husks were removed with a rice husker to remove impurities and broken grains. The millet with full grains and uniform size was selected using a 6SXZ-68 color sorter. The millet grains were ground into powder using a vibrating ball mill, 10 g was weighed, and passed through a 100-mesh sieve for later use. 3 g of millet powder sample was placed in a sample box, compacted and flattened, and then the protein content in millet was determined using a NIRSTMDS2500 desktop near-infrared quality analyzer produced in Denmark at a wavelength range of 1100 to 2498 nm. Each sample was loaded and scanned three times to eliminate the influence of factors such as sample particle size and inconsistent uniformity on the spectrum. Finally, the data read by the instrument were exported for analysis. The measurement results (average of 3 repetitions) are shown in Table 1.

[0067] Table 1 Statistical results of strain names and grain protein content of 114 millet RIL populations

[0068]

[0069]

[0070] (2) Simplifying genome sequencing

[0071] Young, fresh and healthy leaves of mature plants of 114 strains in the parent and RIL populations (more than 5 leaves of plants were collected from each strain as mixed samples) were extracted using the CTAB method. DNA quality was tested by 1% agarose gel electrophoresis, and qualified samples were sent to Shenzhen Huada Agricultural Application Research Institute for simplified genome sequencing. After data quality testing, sequencing data filtering, alignment of reads with the reference genome, and population variation detection, the window sliding method was used to select 15 to 20 markers as a window, determine the genotype of each window and the exchange site of each progeny material, and construct the parental genotype map of each progeny material. The genetic distance of all BIN markers was calculated using the MSTmap (http: / / mstmap.org / ) software using the kosambi algorithm.

[0072] (3) QTL positioning

[0073] QTL positioning and effect analysis were performed using the complete interval mapping method in QTL Icimapping 4.2. The LOD threshold was 2.5 and the mapping step was set to 0.1 cM. QTL naming convention: Q+English abbreviation of the trait+number. Four QTLs (unmarked) significantly associated with protein content were identified, mainly distributed on chromosomes 1, 2, 3, and 8, as shown in Table 2.

[0074] Table 2 QTL mapping results of protein content in RIL population 4.2.

[0075]

[0076] (4) Development of molecular markers

[0077] By searching for SNP sites in the scaffold_3_bin91 and scaffold_3_bin93 marker genomic segments and comparing the genomic sequences of the QTL segments of the two parents, it was found that there was a SNP variation at 8815143bp on chromosome 3 of the millet genome. Sequences of 150bp in length were selected in the upstream and downstream directions of the site to obtain a 301bp sequence. The 301bp nucleotide sequence is shown in SEQ ID NO.1, and the 151st nucleotide is C or G, corresponding to 8815143bp on chromosome 3 of the millet genome, where the nucleotide is C or G.

[0078] (5) For the molecular marker in step (4), KASP primers were designed on the PolyMarker website according to the KASP design principle to obtain two forward primers KASP527509-F1 and KASP527509-F2 and one reverse primer KASP527509-R, whose nucleotide sequences are as follows:

[0079] KASP8815143-F1: 5'-CTCGGCTAACCACCACGCC-3' (SEQ ID No. 2);

[0080] KASP8815143-F2: 5'-CTCGGCTAACCACCACGCG-3' (SEQ ID No. 3);

[0081] KASP8815143-R: 5'-ACGAAGAAGAAAGGCCAGCTAGA-3' (SEQ ID NO.4);

[0082] The above KASP primers were designed based on the genotype variation of high protein content and low protein content strains at the position of 8815143bp on chromosome 3, wherein the high protein genotype is CC or CG, and the low protein genotype is GG.

[0083] The FAM fluorescent linker sequence was connected to the 5' end of the KASP8815143-F1 primer, and the HEX fluorescent linker sequence was connected to the 5' end of the KASP8815143-F2 primer to obtain forward primer 1 and forward primer 2. The primer sequences after connecting the fluorescent linker are as follows:

[0084] Forward Primer 1: 5'- GAAGGTGACCAAGTTCATGCT CTCGGCTAAACCACCAC GCC-3' (SEQ ID NO. 5, wherein the underlined portion is the FAM fluorescent tag sequence);

[0085] Forward Primer 2: 5'- GAAGGTCGGAGTCAACGGATT CTCGGCTAAACCACCAC GCG-3' (SEQ ID NO. 6, wherein the underlined portion is the HEX fluorescent tag sequence);

[0086] The forward primer 1, forward primer 2 and reverse primer KASP527509-R were used as a KASP primer pair for molecular marker detection.

[0087] Example 2

[0088] Genotyping and protein content identification

[0089] (1) The leaves of 114 RIL population strains in Example 1 were used as experimental materials, and the genomic DNA of the leaves of the experimental materials was extracted using the CTAB (cetyltrimethylammonium bromide) method.

[0090] (2) using the genomic DNA from step (1) and ddH2O (negative control) as templates, respectively, and performing PCR amplification using the KASP primer pair obtained in Example 1 to obtain an amplified product; wherein,

[0091] The reaction system for PCR amplification is as follows: 10 μL, including: 5 μL of HiGeno 2×Probe Mix A solution, 0.14 μL of 100 μmol / L SNP Primer Mix solution (100 μmol / L forward primer 1, 100 μmol / L forward primer 2 and 100 μmol / L reverse primer, a primer mixture prepared in a volume ratio of 1:1:3), 4-50 ng of DNA sample, and made up to 10 μL with sterile water.

[0092] The PCR amplification procedure is as follows: the first stage is pre-denaturation at 95°C for 10 min; the second stage is denaturation at 95°C for 20 s, annealing / extension at 55°C-61°C for 40 s, for a total of 10 cycles; the third stage is denaturation at 95°C for 20 s, annealing / extension at 55°C for 40 s, for a total of 31 cycles.

[0093] (3) After amplification, KASP detection was performed based on the operating instructions of the AQP genotyping system (purchased from Beijing Jiacheng Biotechnology Co., Ltd.), and the PCR program on the ABI7500 qPCR instrument was set to 55°C for 30 seconds. The result file was exported, and the genotype was further determined based on the sample cluster. The result was analyzed on the Taqman Genotyper Software software to obtain the relative fluorescence values ​​corresponding to HEX and FAM of each PCR reaction well (the FAM fluorescent label sequence was observed at an excitation light wavelength of 485nm and an emission light wavelength of 520nm, and the HEX fluorescent label sequence was observed at an excitation light wavelength of 528nm and an emission light wavelength of 560nm). The samples were typed and classified according to the relative fluorescence values. The results are as follows: Figures 1-2 And as shown in Table 3.

[0094] Table 3 Protein content and genotyping results of 114 millet RIL populations

[0095]

[0096]

[0097] according to Figures 1-2 As shown in Table 3, there are 3 genotypes at this locus. The average protein content of the 114 materials tested is 11.50%, of which 28 CC materials were detected, with an average protein content of 12.38%, 83 GG materials, with an average protein content of 11.18%, and 3 CG materials, with an average protein content of 12.36%. That is, 31 high-protein millets were detected, and the actual trait consistency of the actual tested materials reached 80.65%, and 83 low-protein millets, with an actual trait consistency of 72.30%. This shows that the molecular marker can be used to conduct KASP experiments on the tested materials to effectively detect their genotypes, thereby completing the identification of germplasm.

[0098] (4) Combined with the conclusion of QTL positioning in step (3) of Example 1, the scaffold_3_bin91B marker (i.e., the molecular marker developed in step (4) of Example 1) was added, and the complete interval mapping method in QTL Icimapping 4.2. was used for QTL positioning and effect analysis. The LOD threshold was 2.5, and the mapping step size was set to 0.1 cM. The results are shown in Table 4.

[0099] Table 4 QTL mapping 4.2. QTL mapping results of protein content in RIL population (markers added)

[0100]

[0101] It can be seen from Table 4 that the molecular marker provided by the present invention has a genetic linkage relationship with the protein content of millet grains and can be used as an effective molecular marker for identifying protein content.

[0102] Based on the above content, it can be seen that the technical solution provided by the present invention can be related to the protein content of millet grains, can distinguish millets with high grain protein content from millets with low grain protein content, and is effective in identifying the protein content trait of millet grains, and can be applied to millet breeding and high-quality genetic improvement application research.

[0103] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. Use of reagents for detecting molecular markers in one or more of the following: (1) Identify or assist in identifying the protein content of millet grains; (2) Distinguish between millets with high grain protein content and millets with low grain protein content; (3) Breeding or assisting in breeding millets with high or low grain protein content; (4) Screening or assisting in the screening of millets with high or low grain protein content; (5) Preparation of products for detecting protein content of millet grains; (6) preparing a product for distinguishing millet with high grain protein content from millet with low grain protein content; (7) Preparation of products for breeding or assisting breeding of millet with high or low grain protein content traits; (8) preparing products for selecting or assisting in selecting millets having a high or low grain protein content trait; The millet variety is a strain of a RIL population constructed with Jingu 21 and GBS as parents; The molecular marker is located at 8815143bp on chromosome 3 of the millet genome, and the single nucleotide polymorphism is C / G; when the millet genotype is CC or CG, it has a high grain protein content trait; when the millet genotype is GG, it has a low grain protein content trait; The molecular marker is located at 151 bp of the nucleotide sequence shown in SEQ ID NO.1, and the single nucleotide polymorphism is C / G.

2. A KASP primer pair for detecting molecular markers, characterized in that: comprising forward primer 1, forward primer 2 and reverse primer; The forward primer 1 includes a fluorescent label sequence 1 and a detection sequence 1 connected sequentially in the 5'-3' direction; the nucleotide sequence of the detection sequence 1 is shown in SEQ ID NO.2; The forward primer 2 includes a fluorescent label sequence 2 and a detection sequence 2 connected sequentially in the 5'-3' direction; the nucleotide sequence of the detection sequence 2 is shown in SEQ ID NO.3; The nucleotide sequence of the reverse primer is shown in SEQ ID NO.4; The colors produced by the fluorescent label sequence 1 and the fluorescent label sequence 2 are different; The molecular marker is located at 8815143bp on chromosome 3 of the foxtail millet genome, and the single nucleotide polymorphism is C / G.

3. The KASP primer pair according to claim 2, characterized in that: The fluorescent label sequence 1 is FAM; The fluorescent label sequence 2 is HEX.

4. A kit for detecting molecular markers, characterized in that: The kit comprises the KASP primer pair according to claim 2 or 3.

5. Use of the KASP primer pair according to claim 2 or 3 or the kit according to claim 4 in one or more of the following: (1) Identify or assist in identifying the protein content of millet grains; (2) Distinguish between millets with high grain protein content and millets with low grain protein content; (3) Breeding or assisting in breeding millets with high or low grain protein content; (4) Screening or assisting in the screening of millets with high or low grain protein content; (5) Preparation of products for detecting protein content of millet grains; (6) preparing a product for distinguishing millet with high grain protein content from millet with low grain protein content; (7) Preparation of products for breeding or assisting breeding of millet with high or low grain protein content traits; (8) preparing products for selecting or assisting in selecting millets having a high or low grain protein content trait; The millet variety is a strain of a RIL population constructed with Jingu 21 and GBS as parents; The detected molecular marker is located at 8815143bp on chromosome 3 of the millet genome, and the single nucleotide polymorphism is C / G. When the millet genotype is CC or CG, it has a high grain protein content trait; when the millet genotype is GG, it has a low grain protein content trait; The molecular marker is located at 151 bp of the nucleotide sequence shown in SEQ ID NO.1, and the single nucleotide polymorphism is C / G.

6. A method for identifying the protein properties of millet grains, characterized in that: The steps include: Using the genomic DNA of the millet to be identified as a template, PCR amplification is performed using the KASP primer pair described in claim 2 or 3 to obtain an amplified product; Performing fluorescence detection on the amplified product and completing genotyping according to the relative fluorescence signal value; The detected molecular marker is located at 8815143bp on chromosome 3 of the millet genome, and the single nucleotide polymorphism is C / G. If the genotyping result of the millet to be identified is CC or CG type, the millet to be identified has a high grain protein content trait; The molecular marker is located at 151 bp of the nucleotide sequence shown in SEQ ID NO.1, and the single nucleotide polymorphism is C / G; If the genotyping result of the millet to be identified is GG type, the millet to be identified has a low grain protein content trait; The millet to be identified is a strain of a RIL population constructed with Jingu 21 and GBS as parents.

7. The method according to claim 6, characterized in that The genomic DNA includes leaf genomic DNA.

8. The method according to claim 6 or 7, characterized in that: The PCR amplification system, based on 10 μL, includes: 5 μL of HiGeno 2×Probe MixA solution, 0.14 μL of 100 μmol / L SNP Primer Mix solution, 4-50 ng of genomic DNA, and the balance of sterile water; The volume ratio of 100 μmol / L forward primer 1, 100 μmol / L forward primer 2 and 100 μmol / L reverse primer in the SNP Primer Mix solution is 1:1:

3.

9. The method according to claim 8, characterized in that The PCR amplification program is: pre-denaturation at 95°C for 10 min; denaturation at 95°C for 20 s, extension at 55°C-61°C for 40 s, 10 cycles; denaturation at 95°C for 20 s, extension at 55°C-61°C for 40 s, 31 cycles.

Images