An Acetohydroxyacid Synthase Mutant and Its Application

Abstract

The present invention discloses an acetohydroxyacid synthase mutant and its application. By mutating the 74th and / or 375th positions of the amino acid sequence of the acetohydroxyacid synthase of wild-type Escherichia coli ATCC8739 to G74K and V375R, an acetohydroxyacid synthase mutant with enhanced affinity for the substrate 2-ketobutyric acid is obtained. Using threonine as the substrate, the engineered bacteria containing this mutant are used for the synthesis of L-isoleucine, and the yield of L-isoleucine is increased by 50%, providing an effective way for the industrialization of fermentative production of L-isoleucine.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and particularly relates to an acetohydroxyacid synthase mutant and its application. Background Art

[0002] L-isoleucine is a branched-chain amino acid (BCAA) and one of the eight essential amino acids in the human body. As an additive, L-isoleucine is widely used in many fields such as medicine, cosmetics, food, etc., and has important application value, and the market demand is still increasing continuously. At present, L-isoleucine is mainly produced by fermentation method, and Corynebacterium glutamicum and Escherichia coli are the main strains for its industrial production.

[0003] Escherichia coli can directly use L-threonine as a substrate to biosynthesize L-isoleucine. In this synthesis pathway, threonine generates an intermediate product 2-ketobutyric acid under the action of threonine deaminase. At the same time, glucose is metabolized through the glycolysis pathway to generate pyruvate; 2-ketobutyric acid and pyruvate generate 2-acetyl-2-hydroxybutyric acid under the action of acetohydroxyacid synthase (AHAS), and then L-isoleucine is obtained through multiple steps of reaction. However, during the biosynthesis of L-isoleucine, the AHAS enzyme has catalytic effects on both intermediate metabolites pyruvate and 2-ketobutyric acid. It catalyzes two reactions. The first is to use 1 mol of pyruvate and 1 mol of 2-ketobutyric acid as substrates to catalyze the formation of 1 mol of 2-acetyl-2-hydroxybutyric acid, which is the precursor of L-isoleucine; the second is to use 2 mol of pyruvate as a substrate to catalyze the formation of 1 mol of 2-acetyl-lactic acid, which is the precursor of L-leucine and L-valine. There is a competitive relationship in the selection between the AHAS enzyme for pyruvate and 2-ketobutyric acid, and the process of AHAS catalyzing 2-ketobutyric acid to generate 2-acetyl-2-hydroxybutyric acid is limited by the substrate selectivity difference. Therefore, modifying AHAS to enhance its affinity for 2-ketobutyric acid is one of the key steps to solve the low yield of L-isoleucine and is of great significance for enhancing the market competitiveness of products.

[0004] In Escherichia coli, AHAS has three pairs of isoenzymes: AHAS I, II, and III, encoded by ilvBN, ilvGM, and ilvIH, respectively. Each isoenzyme consists of two subunits, the large subunit responsible for catalysis and the small subunit responsible for multivalent regulation of the three branched-chain amino acids. These three pairs of isoenzymes have different preferences for the synthesis of different branched-chain amino acids. AHAS I, encoded by ilvBN, has a stronger preference for the synthesis of L-leucine and L-valine; AHAS III, encoded by ilvIH, has a stronger preference for the synthesis of L-isoleucine; and the specific preferences of AHAS II, encoded by ilvGM, for the synthesis of different branched-chain amino acids are still unclear. Through rational design and modification based on the structure of AHAS II, it is hoped that an acetohydroxyacid synthase mutant with enhanced affinity for the substrate 2-ketobutyrate can be developed, thereby providing an effective approach for the industrial production of isoleucine via fermentation. Summary of the Invention

[0005] The purpose of the present invention is to enhance the affinity of acetohydroxy acid synthase AHAS II with the selective substrate 2-ketobutyrate by mutating the gene ilvGM encoding the enzyme, thereby increasing the yield of L-isoleucine.

[0006] To achieve the above object, the present invention provides the following technical solutions:

[0007] In a first aspect, the present invention provides an acetohydroxyacid synthase mutant comprising a G74K or V375R mutation at position 74 and / or position 375 of the amino acid sequence of a wild-type acetohydroxyacid synthase; the wild-type acetohydroxyacid synthase is AHAS II, whose amino acid sequence is shown in Sequence Table 1. Through site-specific mutations, an acetohydroxyacid synthase mutant with enhanced affinity for 2-ketobutyrate is obtained.

[0008] In one embodiment, the glycine at position 74 of the amino acid sequence of acetohydroxyacid synthase is mutated to lysine; the amino acid sequence is shown in Sequence Table 2.

[0009] In one embodiment, the valine at position 375 of the amino acid sequence of acetohydroxyacid synthase is mutated to arginine; the amino acid sequence is shown in Sequence Table 3.

[0010] In one embodiment, the glycine at position 74 of the amino acid sequence of acetohydroxyacid synthase is mutated to lysine, and the valine at position 375 is mutated to arginine; the amino acid sequence is shown in Sequence Table 4.

[0011] In a second aspect, the present invention provides a nucleic acid molecule encoding an acetohydroxy acid synthase mutant, wherein the nucleic acid molecule contains different genetic modification sites, including a nucleic acid encoding an AHAS II having enhanced affinity for the selective substrate 2-ketobutyrate.

[0012] The nucleotide sequence encoding wild-type acetohydroxyacid synthase AHAS II is shown in Sequence Listing 5 and is the nucleotide sequence of the wild-type ilvGM gene.

[0013] In one embodiment, the AHAS II substantially encoding an enhanced affinity for the alternative substrate 2-ketobutyrate is encoded by the engineered ilvGM gene. In the present invention, the ilvGM gene has been mutagenized compared to the wild type to enhance its affinity for 2-ketobutyrate and weaken its affinity for pyruvate. The mutagenized nucleotide sequences are shown in Sequence Listings 6-8, respectively.

[0014] In a third aspect, the present invention provides a recombinant vector strain of the ilvGM gene, and the plasmid of the strain contains the mutant ilvGM gene.

[0015] In one embodiment, for the recombinant vector strain of the gene, the mutant nucleotide sequence is constructed into the puc19 cloning vector by methods such as primer design, circular PCR, and homologous recombination, and introduced into DH5α competent cells.

[0016] In a fourth aspect, the present invention also provides a genetically engineered bacterium containing an acetohydroxyacid synthase mutant.

[0017] In one embodiment, the ilvGM gene of the present invention is incorporated into the chromosome of the host bacterium by means such as PCR, transduction, and homologous recombination to construct a genetically engineered bacterium containing the engineered ilvGM gene. Additionally, strong promoters such as AP1, M93, and lpp can be added in front of the mutant ilvGM gene to effectively enhance the endogenous expression of the mutant ilvGM gene.

[0018] In one embodiment, for the constructed genetically engineered bacterium with the mutant ilvGM gene, the flask fermentation yield of L-isoleucine is increased by about 25-40% compared to the strain with the wild-type ilvGM gene;

[0019] In one embodiment, for the constructed genetically engineered bacterium with the mutant ilvGM gene, the 5L tank fermentation yield of L-isoleucine is increased by about 35-50% compared to the strain with the wild-type ilvGM gene.

[0020] In a fifth aspect, the constructed genetically engineered bacterium is used for the fermentation production of L-isoleucine.

[0021] Beneficial effects: Based on molecular docking and kinetic simulations, the present invention provides an acetohydroxyacid synthase mutant that enhances the affinity for the substrate 2-ketobutyric acid. By mutating the encoding gene ilvGM of acetohydroxyacid synthase AHASII, its affinity for the selective substrate 2-ketobutyric acid is enhanced, and its affinity for pyruvic acid is reduced, thereby increasing the yield of L-isoleucine. Brief Description of the Drawings

[0022] Figure 1 Schematic diagram of the structural simulation of acetohydroxyacid synthase and the substrate;

[0023] Figure 2 Yields of different ilvGM gene mutant strains in shake flask fermentation for the production of L-isoleucine;

[0024] Figure 3 Fermentation process curve of strain IU-010 in a 5 L tank. Detailed Embodiments

[0025] The present invention is further illustrated by the following embodiments, but any embodiment or combination thereof should not be construed as limiting the scope or implementation manner of the present invention. The scope of the present invention is defined by the appended claims. Combining this specification and general common knowledge in the art, those of ordinary skill in the art can clearly understand the scope defined by the claims. Without departing from the spirit and scope of the present invention, those skilled in the art can make any modifications or changes to the technical solutions of the present invention, and such modifications and changes are also included within the scope of the present invention.

[0026] Unless otherwise specified, the experimental methods used in the following embodiments are all conventional methods, such as those described in "Molecular Cloning: A Laboratory Manual" written by J. Sambrook et al.; unless otherwise specified, the reagents and materials used can be purchased from the market.

[0027] In some embodiments, the host cell can be Escherichia coli, Corynebacterium glutamicum, Bacillus subtilis, Pichia pastoris, or Saccharomyces cerevisiae, etc.

[0028] In the embodiments of the present invention, the composition of the LB liquid medium is: 10 g / L peptone, 5 g / L yeast extract, 10 g / L sodium chloride.

[0029] Example 1: Bioinformatics Structural Simulation of the ilvGM Gene - AutoDockVina Molecular Docking

[0030] AHAS II is encoded by the ilvGM gene, which consists of ilvG encoding the large subunit unit (catalytic subunit) and ilvM encoding the small subunit unit (regulatory subunit). Among them, in the AutoDockVina software, 2-ketobutyric acid and pyruvic acid were used as substrates for molecular docking with AHAS II, and the template was the acetohydroxyacid synthase AHAS III from yeast (PDB ID: 6BD9). Figure 1 It is a schematic diagram of the structure simulation of acetohydroxyacid synthase and substrates. All amino acids around the substrate binding site were selected for molecular dynamics simulation, and alanine scanning was performed with two different substrates as ligands (mutating all amino acids to alanine). The amino acids with altered affinity for 2-ketobutyric acid are as follows: G24, G74, F109, K159, D275, R276, W464; the amino acids with altered affinity for pyruvic acid are as follows: G24, G76, F109, K159, D275, V375, M460, V461. It is speculated that these amino acids are the key amino acids for the interaction between AHAS II and the substrates. Single-point saturation mutagenesis simulation experiments were performed on these amino acids with the two substrates respectively to analyze the affinity between the ilvGM gene mutants and the substrates. The results are shown in Table 1.

[0031] Table 1. Analysis of the affinity between ilvGM gene mutants and substrates

[0032]

[0033] Among them, ilvGM G74 and V375 form hydrogen bonds with both 2-ketobutyric acid and pyruvic acid and are key residues in the active pocket. The results show that the affinities of the two mutations G74K and V375R for the substrate 2-ketobutyric acid are -1.32 kcal / mol and 0.4 kcal / mol respectively, and the affinities of the two mutations G74K and V375R for the substrate pyruvic acid are 0.14 kcal / mol and 6.05 kcal / mol respectively, all showing an increase in the affinity for the substrate 2-ketobutyric acid and a decrease in the affinity for pyruvic acid. These sites can be used for the subsequent transformation of engineering bacteria.

[0034] Example 2: Construction of ilvGM gene mutant cloning strains

[0035] 1. Design primers for cloning strains

[0036] According to the mutation types, appropriate primers were designed for the ilvGM G74K, V375R, and G74K / V375R mutations respectively to introduce the mutation points, as shown in Table 2 below:

[0037] Table 2. Design of primers for ilvGM cloning strain mutations

[0038] Primer Name Sequence (5’→3’) WT-up GACCATGATTACGCCAAGCTTATGAATGGCGCACAGTGGG WT-up AAAACGACGGCCAGTGAATTCTCAGGCGCGGATTTGTTG G74K-up AAGGCAACCAACCTGATAACCGGGC G74K-down CGGACCAGACGTGGCGATACATAC V375R-up CGGGGGCAGCACCAGATGTGG V375R-down ATCTGTGGTCACGACGCAATCC

[0039] 2. Construct the IU-001 cloned strain

[0040] Extract the genome of wild-type Escherichia coli ATCC 8739 (purchased from the American Type Culture Collection). Using this genome as a template, with WT-up and WT-down as primers, perform PCR amplification using DNA polymerase to obtain the ilvGM wild-type gene fragment. Then carry out a homologous recombination reaction with the puc19 plasmid vector, transform it into DH5α competent cells, plate and culture, pick monoclonal colonies for further culture, send the bacterial liquid for sequencing verification, and name the successfully constructed wild-type ilvGM cloned strain IU-001.

[0041] 3. Construct the IU-002 cloned strain

[0042] (1) Inoculate 5 μl of the IU-001 bacterial liquid into 5 mL of LB liquid medium and culture it overnight. Use a plasmid extraction kit to extract the plasmid of the IU-001 cloned strain, named P-IU-001.

[0043] (2) Using plasmid P-IU-001 as a template, with G74K-up and G74K-down as primers, perform PCR amplification using DNA polymerase to obtain the linearized plasmid puc19-ilvGM-G74K.

[0044] (3) PCR amplification system (total volume 50 μL): PrimeSTAR Max Premix (2×) 25 μL, template 10 ng, G74K-up 1.5 μL, G74K-down 1.5 μL, supplement with ddH2O to 50 μL.

[0045] (4) PCR amplification program: Pre-denature at 98°C for 5 min; denature at 98°C for 10 s, anneal at 62°C for 15 s, extend at 72°C for 1 min 10 s, cycle 32 times; final extension at 72°C for 5 min, store at 4°C.

[0046] (5) Add 2 μL of Thermo Scientific DpnI enzyme to the above 50 μL PCR reaction product, react at 37°C for 1 h to digest the template plasmid P-IU-001; then perform agarose gel electrophoresis on the digestion product, and recover the target fragment (linearized plasmid puc19-ilvGM-G74K) from the gel.

[0047] (6) The TaKaRa MutanBEST Kit (purchased from Baoruiyi Biotechnology Co., Ltd.) was used for end smoothing and 5'-end phosphorylation reactions. Reaction system: 4.25 μL of the target fragment, 0.5 μL of 10× blunting kination buffer, and 0.25 μL of blunting kination enzyme mix. Mix well, react in a water bath at 37°C for 10 - 15 min, then react in a water bath at 70°C for 5 - 10 min to inactivate the enzyme.

[0048] (7) Ligation: Take 5 μL of the above reaction solution into a centrifuge tube, add 5 μL of ligation enzyme Solution I, mix gently, and ligate at 16°C for 1 h to obtain the circular plasmid puc19-ilvGM-G74K.

[0049] (8) Transformation: Transform all 10 μL of the circular plasmid puc19-ilvGM-G74K into 100 μL of DH5α competent cells. Spread the transformation solution on an LB solid medium containing 100 μg / mL Amp for screening. Pick monoclonal colonies and continue culturing. Send the bacterial liquid for sequencing verification. Name the successfully constructed mutant ilvGM-G74K clone strain IU-002, extract the corresponding strain plasmid, and name it P-IU-002.

[0050] 4. Construction of the IU-003 clone strain: Using the construction method of the IU-002 clone strain, with plasmid P-IU-001 as the template, V375R-up and V375R-down as primers, use DNA polymerase for PCR amplification to obtain the linearized plasmid puc19-ilvGM-V375R; then through template digestion, ligation, and transformation, obtain the IU-003 clone strain, extract the corresponding strain plasmid, and name it P-IU-003.

[0051] 5. Construction of the IU-004 clone strain: Using the construction method of the IU-002 clone strain, with plasmid P-IU-002 as the template, V375R-up and V375R-down as primers, use DNA polymerase for PCR amplification to obtain the linearized plasmid puc19-ilvGM-G74K / V375R; then through template digestion, ligation, and transformation, obtain the IU-004 clone strain, extract the corresponding strain plasmid, and name it P-IU-004.

[0052] The clone strains constructed in the present invention are shown in Table 3:

[0053] Table 3 Construction of ilvGM clone strains

[0054] Strain Related Characteristics Source IU-001 DH5α / puc19-ilvGM-WT Constructed by the present invention IU-002 DH5α / puc19-ilvGM-G74K Constructed by the present invention IU-003 DH5α / puc19-ilvGM-V375R Constructed by the present invention IU-004 DH5α / puc19-ilvGM-G74K / V375R Constructed by the present invention

[0055] Example 3: Construction of ilvGM gene mutant engineering bacteria

[0056] The ilvGM gene mutant engineering bacteria constructed in the present invention can use threonine as a precursor to synthesize isoleucine. The present invention uses Escherichia coli CGMCC No. 19458 as the initial bacterium, referring to the Sval065 strain in Chinese Patent CN202010401422.5. This strain contains the wild-type ilvA gene, and the threonine dehydrogenase tdh has been knocked out, that is, the metabolic pathway of glycine, a by-product of threonine synthesis, and a mutant of acetohydroxyacid synthase AHAS II encoded by the ilvGM-G74K, ilvGM-V375R, and ilvGM-G74K / V375R genes has been introduced to enhance the affinity of AHAS II for binding to the substrate 2-ketobutyric acid and improve the yield of isoleucine. The construction of the ilvGM gene-edited strain and the design of related plasmids and primers are shown in Table 4 and Table 5 respectively.

[0057] Table 4 Construction of ilvGM gene-edited strains and related plasmids

[0058]

[0059] Table 5 Primers designed for ilvGM gene editing

[0060]

[0061]

[0062] 1. Knock out the threonine dehydrogenase tdh of the CGMCC No. 19458 strain

[0063] Using Escherichia coli CGMCC No. 19458 as the starting strain, the threonine dehydrogenase tdh was knocked out by the two-step homologous recombination method. The specific steps are as follows:

[0064] In the first step, using the pRE112 plasmid DNA as a template and tdh-cs-up / tdh-cs-down as primers, a DNA fragment was amplified and named tdh-cs for the first-step homologous recombination.

[0065] PCR amplification system: Prime STARMax Premix(2×) 25 μL, template 10 ng, tdh-cs-up 1.5 μL, tdh-cs-down 1.5 μL, supplemented with ddH2O to 50 μL.

[0066] PCR amplification program: Pre-denaturation at 98 °C for 5 min; denaturation at 98 °C for 10 s, annealing at 56 °C for 15 s, extension at 72 °C for 1 min 10 s, 32 cycles; final extension at 72 °C for 5 min, stored at low temperature at 4 °C.

[0067] Use the above DNA fragment tdh-cs for the first homologous recombination: First, electrotransform the pKD46 plasmid into Escherichia coli CGMCC No. 19458 competent cells, and then electrotransform the DNA fragment tdh-cs into Escherichia coli CGMCC No. 19458 competent cells containing the pKD46 plasmid.

[0068] Electrotransformation procedure: Prepare 50 μl of Escherichia coli CGMCC No. 19458 competent cells containing the pKD46 plasmid in advance, add 100 ng of the DNA fragment tdh-cs, let it stand on ice for 2 minutes, and then transfer it to a Bio-Rad electroporation cuvette. Use a Bio-Rad electroporator with an electroporation parameter of 2.5 kV. After electroporation, quickly transfer 600 μl of pre-cooled LB liquid medium into the electroporation cuvette, let it stand for 5 min, then transfer it into an EP tube, culture it at 75 rpm and 30 °C for 3 hours, centrifuge the bacterial liquid, retain 200 μl of the medium to resuspend the bacteria, spread it on an LB solid plate containing 100 μg / mL ampicillin and 34 μg / mL chloramphenicol, and culture it overnight at 30 °C. Pick monoclonal colonies for PCR verification. The verification primers are yz-tdh-up / yz-tdh-down. The correct colony amplification product is a 4453-bp fragment. Send it for sequencing, pick the monoclonal with the correct result for continuous culture, and name the successfully constructed strain IU-005.

[0069] In the second step, use the genomic DNA of Escherichia coli CGMCC No. 19458 as a template, amplify the DNA fragment with primers yz-tdh-up / Δtdh-down, named Δtdh, for the second homologous recombination. The amplification conditions and system are the same as those described in the first step. The DNA fragment Δtdh is electrotransformed into strain IU-005.

[0070] Electrotransformation procedure: Prepare 50 μl of IU-005 competent cells containing the pKD46 plasmid in advance, add ~100 ng of the DNA fragment Δtdh, let it stand on ice for 2 minutes, and then transfer it to a Bio-Rad electroporation cuvette. Use a Bio-Rad electroporator with an electroporation parameter of 2.5 kV. After electroporation, quickly transfer 600 μl of pre-cooled LB liquid medium into the electroporation cuvette, let it stand for 5 min, then transfer it into an EP tube, culture it at 75 rpm and 30 °C for 4 hours, transfer the bacterial liquid to 50 mL of LB liquid medium containing 10% sucrose and no sodium chloride, culture it for 24 hours, then streak the bacterial liquid on an LB solid plate containing 6% sucrose and no sodium chloride. Verify with primers yz-tdh-up / Δtdh-down. The correct colony amplification product is a 538-bp fragment. Send it for sequencing, pick the monoclonal with the correct result for continuous culture, and name the successfully constructed strain IU-006.

[0071] 2. Mutation of the acetohydroxyacid synthase gene ilvGM

[0072] The ilvGM mutant gene was introduced into Escherichia coli by a two-step homologous recombination method to enhance the specific binding of acetohydroxyacid synthase to the substrate 2-ketobutyric acid. The specific steps are as follows.

[0073] In the first step, primers ilvGM-mut-cat-up / ilvGM-mut-cat-down were used to amplify a DNA fragment with the pRE112 plasmid as the template, named ilvGM-cs, for the first-step homologous recombination.

[0074] PCR amplification system: PrimeSTAR Max Premix (2×) 25 μL, template 10 ng, ilvG-mut-cat-up 1.5 μL, ilvG-mut-cat-down 1.5 μL, supplemented with ddH2O to 50 μL.

[0075] PCR amplification program: Pre-denaturation at 98°C for 5 min; denaturation at 98°C for 10 s, annealing at 58°C for 15 s, extension at 72°C for 1 min 10 s, 32 cycles; final extension at 72°C for 5 min, stored at 4°C.

[0076] The above DNA fragment ilvGM-cs was used for the first-step homologous recombination: First, the pKD46 plasmid was electrotransformed into the competent cells of the IU-006 strain, and then the DNA fragment ilvGM-cs was electrotransformed into the competent cells of the IU-006 strain containing the pKD46 plasmid.

[0077] Electroporation steps: Prepare 50 μl of competent cells of the IU-006 strain containing the pKD46 plasmid in advance, add 100 ng of the DNA fragment ilvGM-cs, let it stand on ice for 2 minutes, and then transfer it to a Bio-Rad electroporation cuvette. Use a Bio-Rad electroporator with an electroporation parameter of 2.5 kv. After electroporation, quickly transfer 600 μl of pre-cooled LB liquid medium into the electroporation cuvette, let it stand for 5 min, then transfer it into an EP tube, culture at 75 rpm and 30°C for 3 hours, centrifuge the bacterial liquid, retain 200 μl of the medium to resuspend the bacteria, spread it on an LB solid plate containing 100 μg / mL ampicillin and 34 μg / mL chloramphenicol, and culture overnight at 30°C. Pick monoclonal colonies for PCR verification. The verification primers are yz-ilvGM-up / yz-ilvGM-down. The correct colony amplification product is a 3571-bp fragment, which is sent for sequencing. Pick the monoclonal colonies with correct results for further culture, and name the successfully constructed strain IU-007.

[0078] Step 2: Using the plasmid P-IU-002 of the constructed IU-002 strain as a template, the DNA fragment ilvGM::G74K was amplified using the primers ilvGM-universal-up / ilvGM-universal-down for the second homologous recombination. The DNA fragment ilvGM::G74K was transformed into the competent cells of IU-007 containing the pKD46 plasmid.

[0079] Using the plasmid P-IU-003 of the constructed IU-003 strain as a template, the DNA fragment ilvGM::V375R was amplified using the primers ilvGM-universal-up / ilvGM-universal-down for the second homologous recombination. The DNA fragment ilvGM::V375R was transformed into the competent cells of IU-007 containing the pKD46 plasmid.

[0080] Using the plasmid P-IU-004 of the constructed IU-004 strain as a template, the DNA fragment ilvGM::G74K / V375R was amplified using the primers ilvGM-universal-up / ilvGM-universal-down for the second homologous recombination. The DNA fragment ilvGM::G74K / V375R was transformed into the competent cells of IU-007 containing the pKD46 plasmid.

[0081] Electroporation procedure: Prepare 50 μl of competent cells of IU-007 containing the pKD46 plasmid in advance, add 100 ng of the DNA fragment ilvGM::G74K, let it stand on ice for 2 minutes, and then transfer it to a Bio-Rad electroporation cuvette. Using a Bio-Rad electroporator, the electroporation parameters were 2.5 kv. After electroporation, 600 μl of pre-cooled LB liquid medium was quickly transferred into the electroporation cuvette. After standing for 5 min, it was slowly transferred into an EP tube and cultured at 75 rpm and 30 °C for 4 hours. Then, the bacterial solution was transferred to 50 mL of LB liquid medium containing 10% sucrose and no sodium chloride and cultured for 24 hours. Then, the bacterial solution was streaked on an LB solid medium containing 6% sucrose and no sodium chloride to verify the primers yz-ilvGM-up / yz-ilvGM-mut-down. The correct colony amplification product was a 1961 bp fragment, which was sent for sequencing. The monoclonal with the correct result was picked for further culture, and the successfully constructed strain was named IU-008. Meanwhile, the DNA fragments ilvGM::V375R and ilvGM::G74K / V375R can be electroporated into the competent cells, and the strains with correct sequencing results were named IU-009 and IU-010 respectively.

[0082] Example 4: Shake flask fermentation of ilvGM engineered bacteria

[0083] The constructed strains IU-006, IU-008, IU-009, and IU-010 were respectively fermented in shake flasks with the same fermentation strategy. The shake flask medium is shown in Table 6.

[0084] Table 6 Medium formula for shake flask fermentation

[0085]

[0086]

[0087] 1. Seed culture: 5 μl was inoculated from the glycerol tubes of strains IU-006, IU-008, IU-009, and IU-010 into 5 mL of LB liquid medium and cultured overnight at 37 °C and 220 rpm.

[0088] 2. Shake flask fermentation: The seed liquid was inoculated into 100 mL of medium at an inoculation amount of 2%, and separately sterilized glucose was added to the medium (separate sterilization means sterilizing the glucose in the medium alone). Fermentation was carried out at 37 °C and 220 rpm for 2 days, and 3 parallel experiments were conducted for each strain.

[0089] 3. Analysis method: An Agilent high-performance liquid chromatograph was used to measure the products of the 2-day shake flask fermentation. Among them, a Bio-Rad Aminex HPX–87H organic acid analysis column was used for the determination of glucose and organic acid concentrations; an Agilant TC-C18, 4.6×250 mm column was used for the determination of amino acids.

[0090] According to the analysis results of the liquid phase determination, the average values of each strain's parallel groups are presented in Table 7 and Figure 2 in.

[0091] Table 7 Results of shake flask fermentation of L-isoleucine strains

[0092]

[0093] As shown in Table 7, in the medium containing 15 g / L threonine, compared with the wild-type control group IU-006, the L-isoleucine yields of the ilvGM mutant strains IU-008, IU-009, and IU-010 were all increased. Among them, the L-isoleucine yield of the IU-010 (ilvG G74K / V375R) strain was increased by 41%.

[0094] Example 5: Fermentation of ilvGM engineered bacteria in a 5 L tank

[0095] The constructed strains IU-006, IU-008, IU-009, and IU-010 were respectively fermented in a 5 L tank with the same fermentation strategy. The 5 L tank medium is shown in Table 8. Among them, the fermentation process curve of IU-010 is asFigure 3 shown.

[0096] Table 8 Medium formula for 5L fermenter

[0097] Medium Formula g / L Glucose (separately sterilized) 55 Magnesium sulfate heptahydrate (separately sterilized) 2.5 Potassium sulfate 1.3 Ammonium sulfate 12.5 Ammonium dihydrogen phosphate 6 Threonine 50 Yeast extract 2 Antifoaming agent 0.5 Ammonia water Adjust the pH to 7.0

[0098] 1. Fermentation conditions: 5L tank liquid volume 2.5L culture medium, dissolved oxygen and ventilation rate, stirring speed, sugar supplement cascade, controlled at about 30%, temperature automatically controlled at 37℃, pH automatically controlled at 7.0.

[0099] 2. Seed culture: On the first night, inoculate 50 μl of each glycerol tube of IU-006, IU-008, IU-009, and IU-010 strain into 50 mL of LB liquid medium and culture overnight at 37°C and 220 rpm.

[0100] 3. 5L tank fermentation: After adding glucose, adjust the pH to 7.0 and the temperature to 37°C, inoculate 50mL of seed liquid into the 5L tank and ferment under the same conditions for 3 days.

[0101] 4. Analytical Methods: Products from a 3-day, 5-L fermentation tank were analyzed using an Agilent HPLC. Glucose and organic acid concentrations were determined using a Bio-Rad Aminex HPX-87H organic acid column, and amino acids were determined using an Agilent TC-C18 column, 4.6 × 250 mm.

[0102] The results of liquid chromatography analysis are presented in Table 9, with the average values for each replicate group for each strain. 5L fermentation broth was analyzed using an Agilent HPLC. Glucose and organic acid concentrations were determined using a Bio-Rad Aminex HPX-87H organic acid column. Amino acid analysis was performed using an Agilent 5TC-C18 column, 4.6 × 250 mm.

[0103] The results of the liquid phase assay analysis and the 5 L tank fermentation results for each strain are presented in Table 9.

[0104] Table 9 L-isoleucine strain 5L tank fermentation results

[0105]

[0106] As shown in Table 9, in a culture medium containing 50 g / L threonine, the L-isoleucine yields of the ilvGM mutant strains IU-008, IU-009, and IU-010 were all improved compared to the wild-type control strain IU-006. Among them, the L-isoleucine yield of the IU-010 (ilvGG74K / V375R) strain was increased by approximately 50%.

[0107] The above are only the preferred embodiments of the present invention, and the protection scope of the present invention is not limited to the above embodiments. All technical solutions falling within the concept of the present invention belong to the protection scope of the present invention. It should be noted that for those of ordinary skill in the art, several improvements and refinements made without departing from the principle of the present invention should be regarded as within the protection scope of the present invention.

[0108] The above are only the preferred embodiments of the present invention, and the protection scope of the present invention is not limited to the above embodiments. All technical solutions falling within the concept of the present invention belong to the protection scope of the present invention. It should be noted that for those of ordinary skill in the art, several improvements and refinements made without departing from the principle of the present invention should be regarded as within the protection scope of the present invention.

Claims

1. An acetohydroxyacid synthase mutant, characterized in that, There are mutations of G74K and V375R at the 74th and / or 375th positions of the wild-type acetohydroxyacid synthase amino acid sequence as shown in SEQ ID NO.

1.

2. The acetohydroxyacid synthase mutant according to claim 1, characterized in that, The amino acid sequence of the mutated acetohydroxyacid synthase is as shown in Sequence Listing 2-4.

3. The acetohydroxyacid synthase mutant according to claim 1 or 2, characterized in that, The coding nucleotide sequence of the wild-type acetohydroxyacid synthase is as shown in Sequence Listing 5.

4. A nucleic acid molecule encoding the acetohydroxyacid synthase mutant according to any one of claims 1-3.

5. The nucleic acid molecule according to claim 4, wherein The nucleotide sequence of the nucleic acid molecule is as shown in Sequence Listings 6-8.

6. A recombinant vector containing the nucleic acid molecule according to claim 4 or 5.

7. A genetically engineered bacterium expressing the acetohydroxyacid synthase mutant according to any one of claims 1-3, the nucleic acid molecule according to claim 4 or 5, or the recombinant vector according to claim 6.

8. Use of the acetohydroxyacid synthase mutant according to any one of claims 1-3, the nucleic acid molecule according to claim 4 or 5, the recombinant vector according to claim 6, or the genetically engineered bacterium according to claim 7 in the production of L-isoleucine.

Images