Development and application of CAPS markers for SNP loci associated with litchi fruit ripening

Abstract

The present invention belongs to the technical field of molecular biology, and specifically relates to the development and application of CAPS molecular markers for SNP sites related to litchi ripening period. The technical problem to be solved by the present invention is to provide a new option for screening litchi germplasm resources. The technical solution provided by the present invention is the development and application of CAPS molecular markers for SNP sites related to litchi ripening period, and its nucleotide sequence is shown in SEQ ID No.3 and SEQ ID No.4. The molecular marker can be used to identify the early and late maturity of litchi materials, and the molecular marker has a 90% coincidence rate with the field identification results. Therefore, the marker operation is simple, the amplification result has high accuracy, and the required reagent cost is low. The development of the marker is of great significance for understanding the genetic control mechanism of litchi ripening period, and provides scientific theoretical support for the in-depth study of litchi genetic improvement and germplasm resources.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology, and in particular relates to a CAPS molecular marker of a SNP site related to litchi fruit ripening period and an application thereof. Background Art

[0002] Litchi (Litchi chinensis Sonn.) is a perennial evergreen tree of the genus Litchi in the Sapindaceae family, and is widely planted in tropical and subtropical regions. In recent years, my country's litchi industry has developed rapidly, with the planting area stable at 5.4×10 5 hm 2 , with an annual output exceeding 2.0×10 6 t. After development, my country's litchi industry has formed characteristic and advantageous production areas such as Hainan's extra early maturing, southwest Guangdong and Guangxi's early maturing, central Guangdong and Guangxi's medium maturing, eastern Guangdong and southern Fujian's late maturing, and Luzhou's extra late maturing. The fruit ripening period extends from March to late August. Hainan is the earliest production area for litchi to be put on the market in my country, and its industrial status is important. However, litchi varieties are mainly early and medium maturing, with 'Fei Zi Xiao' dominating, and there is a lack of extra early maturing varieties, resulting in a concentrated supply period of litchi, great sales pressure, and affecting the income of fruit farmers. The litchi maturity period is an important economic trait and breeding target. Therefore, studying the molecular characteristics of the maturity period of different litchi varieties is of great significance to enriching early maturing varieties and optimizing variety structure. However, current research on the ripening mechanism of litchi mainly focuses on the physiological and biochemical levels, while relatively few studies have been conducted from the perspective of molecular genetics. Summary of the invention

[0003] In order to solve the above-mentioned deficiencies in the prior art, the present invention provides the following technical solutions:

[0004] The first aspect of the present invention provides CAPS molecular markers for litchi ripening period-related sites, and the nucleotide sequences of the CAPS molecular markers are shown in SEQ ID No.3 and SEQ ID No.4.

[0005] Furthermore, the CAPS molecular marker is located on chromosome 15 of the litchi genome.

[0006] The second aspect of the present invention provides a primer pair for amplifying the CAPS molecular marker, the nucleotide sequences of which are shown as SEQ ID No.1 and SEQ ID No.2.

[0007] The third aspect of the present invention provides a method for quickly identifying the early or late maturity of litchi materials, comprising the following steps:

[0008] a. Extracting genomic DNA from litchi materials;

[0009] b. Using the DNA obtained in step a as a template, amplification was performed using the primer pair shown in SEQ ID No.1 and SEQ ID No.2;

[0010] c. Sequencing or enzyme digestion of the fragment amplified in step b; the enzyme digestion is performed using EcolCRI. If a band appears at the 403bp position of the enzyme digestion product in the electrophoresis graph, it is an early-maturing litchi material; if three bands appear at the 403bp, 310bp, and 93bp positions of the enzyme digestion product in the electrophoresis graph, or two bands appear at the 310bp and 93bp positions of the electrophoresis graph, it is a mid-late maturing litchi material;

[0011] If the sequence shown in SEQ ID No.3 is obtained by sequencing, it is an early-maturing litchi material. If the sequence shown in SEQ ID No.4 is obtained by sequencing, it is a mid-to-late-maturing litchi material.

[0012] Furthermore, the amplification system in step b is: 12.5 μL KOD One TM PCR Master Mix; 0.5 μL upstream and downstream primers; 1 μL template DNA; 10.5 μL sterile water.

[0013] Furthermore, the amplification program in step b is: pre-denaturation at 98°C for 2 min; denaturation at 98°C for 10 s; annealing at 58°C for 5 s; extension at 68°C for 1 s, 35 cycles, and extension at 68°C for another 5 min.

[0014] Furthermore, in step c, the enzyme digestion system is: 16 μL sterile water; 3 μL 10X FastDigest Green Buffer; 10 μL DNA product; 1 μL FastDigest enzyme; the enzyme digestion conditions are 37° C. for 5 min; and 65° C. for inactivation for 5 min.

[0015] Beneficial effects of the present invention:

[0016] The invention discloses a CAPS molecular marker of a litchi ripening period-related locus, which can be used to identify the early or late ripening period of litchi materials, and the molecular marker has a 90% coincidence rate with the field identification results. The marker operation is simple, the amplification result is highly accurate, and the required reagent cost is low. The development of the marker is of great significance for understanding the genetic control mechanism of litchi ripening period, and provides scientific theoretical support for the in-depth study of litchi genetic improvement and germplasm resources. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 These are the enzymatic digestion results of the CAPS molecular marker for litchi ripening period in early-ripening, mid-ripening and late-ripening litchi materials.

[0018] Figure 2The enzymatic digestion results of some materials among 80 litchi materials marked by CAPS molecules at the litchi ripening stage.

[0019] Figure 3 The enzymatic digestion results of some materials among 80 litchi materials marked by CAPS molecules at the litchi ripening stage.

[0020] Figure 4 The enzymatic digestion results of some materials among 80 litchi materials marked by CAPS molecules at the litchi ripening stage.

[0021] Figure 5 The enzymatic digestion results of some materials among 80 litchi materials marked by CAPS molecules at the litchi ripening stage. DETAILED DESCRIPTION

[0022] The specific implementation modes of the present invention are described below so that those skilled in the art can understand the present invention. However, it should be clear that the present invention is not limited to the scope of the specific implementation modes. For those of ordinary skill in the art, as long as various changes are within the spirit and scope of the present invention as defined and determined by the attached claims, these changes are obvious, and all inventions and creations utilizing the concept of the present invention are protected.

[0023] Previous studies have found that based on the high heterozygosity (2.27%) of the litchi (Litchi chinensis Sonn.) genome, two sets of high-quality 'Fei Zi Xiao' haplotype genomes (470Mb) were constructed. Resequencing analysis of 72 litchis found that the early-maturing litchi varieties from a wild population in Yunnan mainly corresponded to one of the haplotypes of "Fei Zi Xiao"; the medium- and late-maturing litchi varieties from a wild population in Hainan corresponded to another haplotype. Therefore, litchi can be roughly divided into two groups, namely early-maturing varieties (EMC) and medium- and late-maturing varieties (MLMC). In production, it is generally believed that litchi varieties that mature earlier than 'Fei Zi Xiao' in the same production area are defined as early-maturing varieties, and litchi varieties that mature later than 'Fei Zi Xiao' are defined as medium- and late-maturing varieties. This example uses this as a basis to classify 80 litchi germplasm materials.

[0024] Example 1: Development of CAPS Molecular Markers

[0025] In this embodiment, the resequencing data of 152 germplasm resources (78 in Hainan, 50 in Guangdong, 2 in Guangxi, 8 in Sichuan, and 14 in Yunnan) from the main litchi producing areas in China and their maturity phenotypes were analyzed to obtain SNP loci information related to litchi maturity, and molecular markers were developed. The association interval was further shortened by haplotype analysis, and CAPS markers were developed in the target area. The co-segregation of genotypes and phenotypes of CAPS markers was statistically analyzed, and it was found that the developed CAPS molecular markers had a high co-segregation performance in the early-ripening and mid-late-ripening phenotypes of litchi ( Figure 1 ).

[0026] CAPS molecular markers:

[0027] Forward primer sequence SEQ ID No. 1: GATCTGTGCTGGTTAACGGTTC;

[0028] Reverse primer sequence SEQ ID No. 2: TCGTTTTCCATCTGGGCCTT.

[0029] SEQ ID No.3: Nucleotide sequence of early-maturing litchi variety (5'-3'):

[0030] GATCTGTGCTGGTTAACGGTTCTTATCAGTTGAAAAACATTATAGAAACA

[0031] ACTTTCATATCAATATAATGGAGAATTGGACCTAGTAACCATATGTCAGT

[0032] TCTCTTCCAATCAATATAATGGAGAATCAGACCTAGTAACCATATGTCAG

[0033] TTCTCTTCTAATCGAGTGGTTTTTGTTGTTGCAGATTATAACAAATGGAGA

[0034] GTATATTAGCTGTCAACATCAGGCCATAACAAATGCCAACAAAGCTCGA

[0035] CTTTCAGTGGCTACATTTCATGACCCAGCAAAGATGGTAAAAATATCTCC

[0036] AGCTTCT GACCTC GTCAGTGAGTCGTCTCCTCCCCACTATCGTGGAGTGG

[0037] TTTATGGAGACTACGTTTCATCATGGTACACAAAAGGCCCAGATGGAAAACGA.

[0038] SEQ ID No.4: Nucleotide sequence of a mid-late-ripening litchi variety (5'-3') (^ indicates the position of enzyme cutting): TCGTTTTCCATCTGGGCCTTTTGTGTACCATGATGAAACGTAGTCTCCATA AACCACTCCACGATAGTGGGGAGGAGACGACTCACTGAC GAG^CTC AGA AGCTGGAGATATTTTTACCATCTTTGCTGGGTCATGAAATGTAGCCACTGAAAGTCGAGCTTTGTTGGCATTTGTTATGGCCTGATGTTGACAGCTAATATACTCTCCATTTGTTATAATCTGCAACAAAAAACCACTCGATTAGAAGAG AACTGACATATGGTTACTAGGTCTGATTCTCCATTATATTGATTGGAAGAGAACTGACATATGGTTACTAGGTCCAATTCTCCATTATATTGATATGAAAGTTGTTTCTATAATGTTTTTCAACTGATAAGAACCGTTAACCAGCACAGATC.

[0039] Example 2: Validation of CAPS molecular markers for identifying litchi ripening stage

[0040] Experimental materials: A total of 80 litchi materials were selected (Table 1).

[0041] The genomic DNA of 80 litchi materials was extracted respectively, and then the litchi genomic DNA was used as a template for PCR amplification with CAPS-labeled primers (forward primer sequence SEQ ID No.1 and reverse primer sequence SEQ ID No.2). The total volume of the CAPS-labeled PCR reaction system was 25 μL. The PCR amplification program with a total volume of 25 μL was: 98°C pre-denaturation for 2 min; 98°C denaturation for 10 s; 58°C annealing for 5 s; 68°C extension for 1 s, 35 cycles, and 68°C extension for another 5 min.

[0042] In the above method, the enzyme digestion system with a total volume of 30 μL is: 16 μL sterile water; 3 μL 10X FastDigest Green Buffer; 10 μL DNA product; 1 μL FastDigest enzyme; the enzyme digestion conditions are 37°C for 5 min; 65°C for 5 min inactivation. Then the enzyme digestion product is electrophoresed on a 2.0% agarose gel, and the experimental results are observed and recorded on a gel imager.

[0043] The results of enzyme digestion of 80 litchi materials are as follows Figure 2 to Figure 5 There is polymorphism in early-maturing and mid-late-maturing litchi materials: in early-maturing litchi materials, after enzyme digestion, a band appears at the 403bp position in the electrophoresis diagram, and in mid-late-maturing litchi materials, three bands appear at the 403bp, 310bp, and 93bp positions, or two bands appear at the 310bp and 93bp positions in the electrophoresis diagram.

[0044] Table 1 Marker identification of 80 litchi materials

[0045]

[0046]

[0047]

[0048] The analysis of the maturity of the above 80 litchi materials found that: 40 were identified as early-maturing varieties by field phenotype, and 34 of them were identified as early-maturing varieties by CAPS molecular marker identification; 40 were identified as medium-late maturing varieties by field phenotype, and 38 of them were identified as medium-late maturing varieties. The statistical results showed that the CAPS molecular marker developed in this application had a consistency rate of more than 90% between the genotype and field phenotype of these litchi materials.

[0049] The present invention uses specific embodiments to illustrate the principles and implementation methods of the present invention. The description of the above embodiments is only used to help understand the method of the present invention and its core idea. At the same time, for those skilled in the art, according to the idea of ​​the present invention, there will be changes in the scope of the specific implementation methods. In summary, the content of this specification should not be understood as limiting the present invention.

Claims

1. CAPS molecular markers of litchi ripening period-related SNP loci, characterized in that: The nucleotide sequences of the CAPS molecular marker are shown in SEQ ID No.3 and SEQ ID No.4; the SEQ ID No.3 corresponds to the early-ripening stage of litchi, and the SEQ ID No.4 corresponds to the mid-late-ripening stage of litchi.

2. The CAPS molecular marker according to claim 1, characterized in that: The CAPS molecular marker is located on chromosome 15 of the litchi genome.

3. A method for quickly identifying the early or late maturity of litchi materials, characterized in that: The steps include: a. Extracting genomic DNA from litchi materials; b. Using the DNA obtained in step a as a template, amplification was performed using the primer pair shown in SEQ ID No.1 and SEQ ID No.2; c. Sequencing or enzyme digestion of the fragment amplified in step b; the enzyme digestion is performed using EcolCRI. If a band appears at the 403 bp position of the enzyme digestion product in the electrophoresis graph, it is an early-maturing litchi material; If the enzyme digestion product shows three bands at the positions of 403 bp, 310 bp, and 93 bp in the electrophoresis graph, or two bands at the positions of 310 bp and 93 bp in the electrophoresis graph, it is a mid-late-ripening litchi material; If the sequence shown in SEQ ID No. 3 is obtained by sequencing, it is an early-maturing litchi material. If the sequence shown in SEQ ID No. 4 is obtained by sequencing, it is a medium-to-late-maturing litchi material.

4. The method according to claim 3, characterized in that: The amplification system in step b is: 12.5 μL KOD One™ PCR Master Mix; 0.5 μL each of upstream and downstream primers; 1 μL template DNA; 10.5 μL sterile water.

5. The method according to claim 3, characterized in that: The amplification program in step b was: pre-denaturation at 98°C for 2 min; denaturation at 98°C for 10 s; annealing at 58°C for 5 s; extension at 68°C for 1 s, 35 cycles, and extension at 68°C for another 5 min.

6. The method according to claim 3, characterized in that: The enzyme digestion system in step c is: 16 μL sterile water; 3 μL 10XFastDigest Green Buffer; 10 μL DNA product; 1 μL FastDigest enzyme; the enzyme digestion conditions are 37°C for 5 min; and 65°C for 5 min of inactivation.

Images