Application of 3-hydroxybutyric acid and its analogs in preventing Klebsiella pneumoniae infection

Abstract

The present invention relates to the field of biomedicine technology, and specifically to the use of 3-hydroxybutyric acid and its analogs in anti-Klebsiella pneumoniae infection. The present invention finds that 3-hydroxybutyric acid can effectively alleviate Klebsiella pulmonary infection, especially in the treatment of pneumonia, reduction of cell apoptosis, alleviation of oxidative stress, alleviation of pulmonary fibrosis or alleviation of pulmonary edema, and has high clinical application prospects.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to application of 3-hydroxybutyric acid and its analogs in resisting Klebsiella pneumoniae infection. Background Art

[0002] Klebsiella pneumoniae can be divided into classical Klebsiella pneumoniae (cKP), highly virulent Klebsiella pneumoniae (hvKP), or resistant Klebsiella pneumoniae (e.g., carbapenem-resistant Klebsiella pneumoniae (CRKP)). Treatment of infections caused by cKP is often based on the selection of appropriate antibiotics based on the sensitivity of the pathogen, the severity of the infection, the patient's overall health, and the side effects of the drugs; hvKP often causes untreatable or difficult-to-cure infections; and carbapenem-resistant Klebsiella pneumoniae (CRKP) strains account for approximately 90% of clinical carbapenem-resistant Enterobacteriaceae (CRE) infections. Since CRKP strains are often more severe and progress more rapidly than cKP, and current antimicrobial drugs have no therapeutic effect, CRKP strains are likely to remain highly prevalent in the future. The emergence of CR-hvKP strains has also been reported. This pathogen exhibits both carbapenem resistance and high virulence, causing severe disease in the host and potentially leading to devastating clinical outcomes. Therefore, the development of new intervention strategies and therapeutic drugs is of great clinical significance for improving diseases caused by Klebsiella pneumoniae infection.

[0003] 3-Hydroxybutyrate (3HB or BHB), as one of the metabolites of ketone bodies, is widely used in the treatment of various diseases, such as anti-alcoholic fatty liver, improvement of neurodegenerative diseases, epilepsy, diabetes or cardiovascular diseases.

[0004] In addition, 3-hydroxybutyrate also regulates the balance of cell survival and death, inhibits cell apoptosis and promotes cell survival by affecting key cell signaling pathways such as AMPK. However, there have been no reports on the use of 3-hydroxybutyrate in the treatment of Klebsiella pneumoniae infection so far. Summary of the invention

[0005] In order to solve the problems of the prior art, the present invention provides an application of 3-hydroxybutyric acid and its analogs in anti-CRKP infection. Experimental results show that compared with 1,3-butanediol (1,3-butanediol can be converted into 3HB in the body), 3-hydroxybutyrate can effectively alleviate lung infection caused by CRKP, especially in treating pneumonia, reducing cell apoptosis, alleviating oxidative stress, alleviating pulmonary fibrosis or alleviating pulmonary edema.

[0006] The specific plan is as follows:

[0007] The first aspect of the present invention provides a use of a compound or a pharmaceutically acceptable salt, hydrate or solvate thereof in the preparation of a product for resisting Klebsiella infection, wherein the compound is represented by general formula I;

[0008]

[0009] in,

[0010] R1 is H, OH, straight chain or branched alkyl, straight chain or branched alkoxy, cycloalkyl, aralkyl, halogen or aryl; preferably a straight chain or branched C1-C4 alkyl; more preferably methyl (CH3), ethyl (CH2CH3) or propyl (e.g. CH2CH2CH3).

[0011] R2 is H, a linear or branched alkyl, cycloalkyl, aralkyl or aryl group, preferably H, a linear or branched C1-C9 alkyl group, more preferably H, methyl (CH3) or ethyl (CH2CH3).

[0012] In a specific embodiment of the present invention, R1 is CH3 and R2 is CH3; or R1 is CH3 and R2 is hydrogen; or R1 is CH3 and R2 is CH2CH3; or R1 is C H2CH3 and R2 is H; or R1 is CH2CH3 and R2 is CH3; or R1 is CH2CH3 and R2 is CH2CH3; or R1 is CH2CH2CH3 and R2 is H; or R1 is CH2CH2CH3 and R2 is CH3; or R1 is CH2CH2CH3 and R2 is CH2CH3.

[0013] In a specific embodiment of the present invention, the compound comprises a compound as shown in Formula II;

[0014]

[0015] In a specific embodiment of the present invention, the compound is 3-hydroxybutyric acid. It should be understood that the compound can be in the D-type or L-type, or a mixture of the D-type and the L-type.

[0016] In a specific embodiment of the present invention, the 3-hydroxybutyric acid is of D type.

[0017] In a specific embodiment of the present invention, the compound can be methyl 3-hydroxybutyrate, ethyl 3-hydroxybutyrate, 3-hydroxyhexanoic acid, methyl 3-hydroxyhexanoate, ethyl 3-hydroxyhexanoate, 3-hydroxyvaleric acid, methyl 3-hydroxyvalerate, ethyl 3-hydroxyvalerate, and the like.

[0018] Preferably, the pharmaceutically acceptable salt includes one or more of sodium salt, potassium salt, magnesium salt or calcium salt.

[0019] Preferably, the structural formula of the pharmaceutically acceptable salt is shown in Formula III.

[0020]

[0021] Wherein, R3 is selected from metal ions (preferably non-toxic metal ions), such as sodium ions, potassium ions, magnesium ions or calcium ions. Wherein, n is determined according to the valence state of the metal ion. For example, when R3 is a sodium ion or a potassium ion, n is 1; and when R3 is a calcium ion, n is 2.

[0022] In a specific embodiment of the present invention, the pharmaceutically acceptable salt of the compound includes 3-hydroxybutyrate (e.g., sodium salt, potassium salt, magnesium salt or calcium salt), 3-hydroxyhexanoate (e.g., sodium salt, potassium salt, magnesium salt or calcium salt) or 3-hydroxyvalerate (e.g., sodium salt, potassium salt, magnesium salt or calcium salt).

[0023] In a specific embodiment of the present invention, the pharmaceutically acceptable salt of the compound is sodium 3-hydroxybutyrate. Preferably, the structure of sodium 3-hydroxybutyrate is as shown in Formula IV.

[0024]

[0025] In a specific embodiment of the present invention, the pharmaceutically acceptable salt of the compound is potassium 3-hydroxybutyrate. Preferably, the structure of sodium 3-hydroxybutyrate is as shown in Formula V.

[0026]

[0027] In a specific embodiment of the present invention, the pharmaceutically acceptable salt of the compound is calcium 3-hydroxybutyrate, and preferably, the structure of sodium 3-hydroxybutyrate is as shown in Formula VI.

[0028]

[0029] The compound or its pharmaceutically acceptable salt, hydrate or solvate can be purchased, fermented or decomposed by PHA. Preferably, the decomposition of PHA can be hydrolysis or alcoholysis of PHA.

[0030] Preferably, the compound or a pharmaceutically acceptable salt, hydrate or solvate thereof protects against Klebsiella infection by alleviating oxidative stress.

[0031] Preferably, the anti-Klebsiella infection includes treating and / or preventing Klebsiella pulmonary infection.

[0032] Preferably, the anti-Klebsiella infection comprises one or more of treating pneumonia, reducing cell apoptosis, alleviating oxidative stress, alleviating pulmonary fibrosis or alleviating pulmonary edema.

[0033] Preferably, the anti-Klebsiella infection also includes reducing inflammatory cell infiltration, preferably reducing inflammatory cell infiltration in blood (such as whole blood, plasma), and the inflammatory cells preferably include neutrophils, and more preferably also include one or more of lymphocytes or monocytes.

[0034] Preferably, the anti-Klebsiella infection further comprises reducing the lung wet-to-dry weight ratio or reducing the content of proteins (such as cytokines, enzymes or other molecules released during inflammation).

[0035] Preferably, the reduction of cell apoptosis includes reducing cell death (apoptosis) related genes / proteins, such as caspase-3.

[0036] Preferably, the alleviation of oxidative stress comprises reducing the expression of NADPH oxidase, such as reducing the expression of Nox-2.

[0037] Preferably, the anti-Klebsiella infection comprises reducing the expression of inflammatory factors. Preferably, the expression of inflammatory factors in the lung (e.g., lung tissue, alveoli) is reduced. In a specific embodiment of the present invention, the inflammatory factors include one or two of TNF-α, IL-1β or IL-6.

[0038] Preferably, the genus Klebsiella includes Klebsiella pneumoniae (KP).

[0039] Preferably, the Klebsiella pneumoniae (KP) includes any one or more of classical Klebsiella pneumoniae (cKP), highly virulent Klebsiella pneumoniae (hvKP) or drug-resistant Klebsiella pneumoniae.

[0040] In a specific embodiment of the present invention, the Klebsiella pneumoniae is highly virulent and drug-resistant Klebsiella pneumoniae.

[0041] Preferably, the drug resistance includes resistance to one or more of carbapenems, aminoglycosides, cephalosporins (such as third-generation cephalosporins), fluoroquinolones, penicillins, sulfonamides, tetracyclines or trimethoprim.

[0042] Preferably, the Klebsiella pneumoniae is highly virulent and carbapenem-resistant Klebsiella pneumoniae (CR-hvKP).

[0043] Preferably, the product comprises a medicine.

[0044] The second aspect of the present invention provides a use of 3-hydroxybutyric acid or an analogue thereof in the preparation of a product for resisting Klebsiella infection.

[0045] Preferably, 3-hydroxybutyric acid or an analog thereof protects against Klebsiella infection by alleviating oxidative stress.

[0046] Preferably, the 3-hydroxybutyric acid or its analogue can be one or more of 3-hydroxybutyric acid, 3-hydroxybutyric acid salt (such as sodium salt, potassium salt, magnesium salt or calcium salt), 3-hydroxybutyric acid methyl ester, 3-hydroxybutyric acid ethyl ester, 3-hydroxyhexanoic acid, 3-hydroxyhexanoic acid salt (such as sodium salt, potassium salt, magnesium salt or calcium salt), 3-hydroxyhexanoic acid methyl ester, 3-hydroxyhexanoic acid ethyl ester, 3-hydroxyvaleric acid, 3-hydroxyvaleric acid salt (such as sodium salt, potassium salt, magnesium salt or calcium salt), 3-hydroxyvalerate methyl ester or 3-hydroxyvalerate ethyl ester.

[0047] The 3-hydroxybutyric acid or its analogues can be purchased, fermented or decomposed by PHA. Preferably, the PHA decomposition can be hydrolyzed or alcoholyzed by PHA.

[0048] In a third aspect of the present invention, a drug for preventing Klebsiella infection is provided, wherein the drug comprises a compound or a pharmaceutically acceptable salt, hydrate or solvate thereof, wherein the compound is as shown in general formula I.

[0049] Preferably, the compound comprises a compound as shown in any one of Formulae II-VI.

[0050] Preferably, the drug contains pharmaceutically acceptable excipients.

[0051] It should be understood that "pharmaceutically acceptable" as used herein means neither significantly irritating an organism nor inhibiting the biological activities and properties of the active ingredients of the administered product.

[0052] The pharmaceutically acceptable excipients described in the present application include conventional excipients in the art, such as one or more of diluents, excipients, fillers, binders, wetting agents, disintegrants, absorption promoters, surfactants, adsorption carriers, lubricants, suspending agents, wetting agents, pigments, flavoring agents or solvents.

[0053] Preferably, the drug can be administered by any suitable route, such as by physical or chemically mediated introduction into the body or by being mixed or encapsulated with other substances and then introduced into the body, such as enteral administration (e.g. oral or rectal administration) or parenteral administration (e.g. intravenous injection, intramuscular injection, subcutaneous injection, intradermal injection, intratracheal instillation, nasal drops, eye drops, intrathecal injection, transdermal injection, mucosal tissue administration, spray administration, absorption administration (e.g. skin absorption), atomization administration, osmotic administration).

[0054] Preferably, the drug can be in any suitable dosage form, preferably including tablets, pills, powders, granules, capsules, lozenges, syrups, liquids, solutions, drops, powders, emulsions, microemulsions, suspensions, injections, sprays, aerosols, powder sprays, lotions, ointments, plasters, pastes, patches, eye drops, nasal drops, suppositories, effervescent tablets, pills or gels, etc.

[0055] Preferably, the various dosage forms described in the present invention can be prepared according to conventional production methods in the pharmaceutical field.

[0056] Preferably, the drug contains 0.01-99.5% (e.g., 0.01%, 0.1%, 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99% or 99.5%) of the compound of formula I or its pharmaceutically acceptable salt, hydrate or solvate by weight or volume.

[0057] According to the needs of the specific implementation, the drug can be used alone, or in combination with other drugs that can fight Klebsiella infection or treat lung diseases or other complications, or in combination with drugs that treat other diseases.

[0058] Preferably, the drug can be a human drug or a veterinary drug.

[0059] In a fourth aspect, the present invention provides a method for combating Klebsiella infection, the method comprising administering to a subject in need thereof an effective amount of a compound of formula I or a pharmaceutically acceptable salt, hydrate or solvate thereof, or the above-mentioned drug, or the above-mentioned 3-hydroxybutyric acid or its analogues.

[0060] Preferably, the anti-Klebsiella infection includes treating and / or preventing Klebsiella pulmonary infection.

[0061] The effective amount depends on many factors, including the patient's age, weight, gender, health status, nutritional status, time of administration, metabolic rate, severity of the disease, etc.

[0062] Preferably, the compound represented by the general formula I or its pharmaceutically acceptable salt, hydrate or solvate, or the above-mentioned drug, or the above-mentioned 3-hydroxybutyric acid or its analogue can be administered by any suitable route, for example, by physical or chemically mediated method, or by being introduced into the body after being mixed or encapsulated by other substances, such as gastrointestinal administration (for example, oral or rectal administration) or parenteral administration (for example, intravenous injection, intramuscular injection, subcutaneous injection, intradermal injection, intratracheal instillation, nasal drops, eye drops, intrathecal injection, transdermal injection, mucosal tissue administration, spray administration, absorption administration (for example, skin absorption), atomization administration, osmotic administration).

[0063] Preferably, the effective amount is 1-300 mg / kg / day, for example 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 50, 100, 200, 250 or 300 mg / kg / day.

[0064] Preferably, the effective amount administered to non-human animals (such as mice) is 20-300 mg / kg / day, preferably 50-200 mg / kg / day, such as 20, 30, 40, 50, 100, 150, 200, 250 or 300 mg / kg / day.

[0065] Preferably, based on the body surface area conversion, the ratio of the experimental dose in reference experimental mice to the equivalent dose in humans is 9.1, and the effective amount administered to humans is 2.2-32.9 mg / kg / day, preferably 5-25 mg / kg / day, for example 2.2, 3, 4, 5, 5.4, 5.5, 10, 10.9, 11, 15, 16, 16.5, 17, 20, 21, 21.9, 22, 23, 24, 25, 26, 27, 28, 29, 30 or 32.9 mg / kg / day.

[0066] The fifth aspect of the present invention provides use of a compound or a pharmaceutically acceptable salt, hydrate or solvate thereof in the preparation of a medicament for treating and / or preventing pneumonia, pulmonary fibrosis or pulmonary edema caused by infection with Klebsiella spp.

[0067] Preferably, the compound or a pharmaceutically acceptable salt, hydrate or solvate thereof treats and / or prevents pneumonia, pulmonary fibrosis or pulmonary edema caused by infection with Klebsiella by alleviating oxidative stress.

[0068] Preferably, the genus Klebsiella includes Klebsiella pneumoniae (KP).

[0069] Preferably, the Klebsiella pneumoniae (KP) is any one or more of classical Klebsiella pneumoniae (cKP), highly virulent Klebsiella pneumoniae (hvKP) or drug-resistant Klebsiella pneumoniae.

[0070] In a specific embodiment of the present invention, the Klebsiella pneumoniae is highly virulent and drug-resistant Klebsiella pneumoniae.

[0071] Preferably, the drug resistance includes resistance to one or more of carbapenems, aminoglycosides, cephalosporins (such as third-generation cephalosporins), fluoroquinolones, penicillins, sulfonamides, tetracyclines or trimethoprim.

[0072] Preferably, the Klebsiella pneumoniae is highly virulent and carbapenem-resistant Klebsiella pneumoniae (CR-hvKP).

[0073] In a sixth aspect of the present invention, a method for treating and / or preventing pneumonia, pulmonary fibrosis or pulmonary edema caused by infection with Klebsiella is provided, the method comprising administering to a subject in need thereof an effective amount of a compound of formula I or a pharmaceutically acceptable salt, hydrate or solvate thereof, or the above-mentioned drug, or the above-mentioned 3-hydroxybutyric acid or its analogues.

[0074] In the seventh aspect of the present invention, a method for alleviating inflammation or reducing the expression of inflammatory factors is provided, the method comprising administering to a subject in need thereof an effective amount of a compound represented by general formula I or a pharmaceutically acceptable salt, hydrate or solvate thereof, or the above-mentioned drug, or the above-mentioned 3-hydroxybutyric acid or its analogues.

[0075] Beneficial effects of this application:

[0076] 1. Currently, there is no effective drug for treating infection with Klebsiella pneumoniae, especially CRKP and CR-hvKP strains, due to their resistance to carbapenem antibiotics. The present application creatively discovered that 3-hydroxybutyric acid or its analogs can alleviate pneumonia, pulmonary fibrosis or pulmonary edema caused by Klebsiella pneumoniae infection, and has clinical application value.

[0077] 2. The present application claims that the direct administration of 3-hydroxybutyric acid or a pharmaceutically acceptable salt thereof can effectively alleviate Klebsiella pneumoniae infection. However, the present application claims that 3-hydroxybutyric acid analogs that can be converted into 3-hydroxybutyric acid in vivo, such as 1,3-butanediol, do not have the effect of alleviating Klebsiella pneumoniae infection.

[0078] 3. 3-Hydroxybutyric acid or its analogs can protect alveolar cells from damage by reducing apoptosis (by reducing the expression of apoptosis-related genes / proteins (such as Caspase-3)) and relieving oxidative stress caused by infection (by reducing NADPH oxidase (such as Nox-2) to regulate the generation of reactive oxygen species) to fight against Klebsiella pneumoniae infection. It also regulates metabolic pathways and signal transduction to exert multiple effects such as anti-inflammatory, antioxidant, and anti-apoptosis, thereby effectively alleviating the pathological process of Klebsiella pneumoniae infection.

[0079] 4. 3-Hydroxybutyric acid or its analogues are easily absorbed by the human body, have high safe doses, have no significant toxic side effects, and can be used for a long time.

[0080] The "method" of the present invention may be for therapeutic purposes or non-therapeutic purposes.

[0081] The term “comprising” described in the present invention is an open description, which includes the specified components or steps described, and other specified components or steps that will not be substantially affected.

[0082] The term "and / or" described in the present invention includes all combinations of items connected by the term, and each combination should be deemed to have been listed separately in this application. For example, "A and / or B" includes "A", "A and B" and "B".

[0083] As used herein, "treating" means slowing, interrupting, preventing, controlling, stopping, alleviating, or reversing the progression or severity of a sign, symptom, disorder, condition, or disease after the disease has begun to develop, but does not necessarily involve the complete elimination of all disease-related signs, symptoms, conditions, or disorders.

[0084] The term "prevention" as used in the present invention refers to all actions to suppress symptoms or delay the progression of specific symptoms by administering the product described in the present invention (such as the drug, or the compound represented by general formula I or its pharmaceutically acceptable salt, hydrate or solvate).

[0085] The "effective amount" described in the present invention refers to the amount or dosage of the product of the present invention (e.g., the drug, or the compound represented by Formula I or its pharmaceutically acceptable salt, hydrate or solvate) that provides the desired treatment or prevention after being administered to a patient in a single or multiple doses.

[0086] The "subject" of the present invention can be a human or a non-human animal (e.g., a non-human mammal), and the non-human mammal can be a wild animal, a zoo animal, an economic animal, a pet, an experimental animal, etc. Preferably, the non-human mammal includes, but is not limited to, pigs, cattle, sheep, horses, donkeys, foxes, minks, jackals, camels, dogs, cats, rabbits, mice (e.g., rats, mice, hamsters, gerbils, chinchillas, squirrels), monkeys, etc.

[0087] The "hydrate" described in the present invention is a compound containing water, wherein the water can be connected to other parts by coordination bonds or covalent bonds.

[0088] "Solvate" as used herein refers to a physical combination of a compound of the invention and one or more solvent molecules. The physical combination includes various degrees of ionic and covalent bonding, such as hydrogen bonding. In some cases, the solvate can be isolated, such as when one or more solvent molecules are incorporated into the crystal lattice of a crystalline solid. Solvates include solution phases and separable solvates. Representative solvates include ethanolates or methanolates, etc. BRIEF DESCRIPTION OF THE DRAWINGS

[0089] The embodiments of the present invention are described in detail below with reference to the accompanying drawings, wherein:

[0090] Figure 1 : Results of the stringing experiment of Klebsiella pneumoniae;

[0091] Figure 2 : The statistical results of the weight of mice in each group, the weight of all mice was normalized according to their own weight on the first day of modeling as 1;

[0092] Figure 3 : The statistical results of the survival ratio of mice in each group were calculated according to the survival percentage;

[0093] Figure 4 : Lung wet-to-dry weight ratio and protein content of each group of mice; the left figure shows the lung wet-to-dry weight ratio of mice, and the right figure shows the detection results of protein content in the supernatant of mouse bronchoalveolar lavage fluid;

[0094] Figure 5 : Analysis of neutrophils in whole blood of mice in each group;

[0095] Figure 6 :Determination of inflammatory cytokine content in the supernatant of bronchoalveolar lavage fluid of mice;

[0096] Figure 7 : Real-time fluorescence quantitative results of mouse lung tissue. The data were normalized to the mean value of the control group data.

[0097] Figure 8: Pathological HE staining of whole lung tissue, the upper picture in each group is a panoramic scan of HE staining of whole lung tissue, and the lower picture in each group is a representative enlarged picture of lung HE staining; the scale bars are marked in the upper left corner of the picture, the scale of the upper picture in each group is 2000mm, and the scale of the lower picture in each group is 0.1mm; among them, in the model group, the arrows from top to bottom represent: a large number of red blood cells aggregated in airway bleeding; the distribution of dense structures of pulmonary fibrosis increased significantly; multiple alveolar structures fused with each other; a large number of inflammatory cells infiltrated and aggregated (neutrophils and monocytes infiltrated in the alveolar wall and pulmonary interstitium); alveolar edema and thickening of alveolar wall; increased permeability of blood vessels and alveolar membranes caused exudates, proteins, etc. to leak into the alveolar cavity

[0098] exist Figure 2 , Figure 4 , Figure 5 and Figure 7 In the table, # indicates p<0.05, ## indicates p<0.01, ### indicates p<0.001, #### indicates p<0.0001, and ns indicates no significant difference. DETAILED DESCRIPTION

[0099] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, not all. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention.

[0100] The experimental methods described in the following examples are conventional methods unless otherwise specified; the reagents and biological materials described are commercially available unless otherwise specified.

[0101] The natural chiral (D-type) 3-hydroxybutyric acid sodium salt (hereinafter referred to as 3HB) used in the examples was synthesized by Chen Guoqiang's laboratory at Tsinghua University, and its structure is shown in Formula IV. 1,3-Butanediol was purchased from Sigma (309443), and its structure is shown in Formula VII.

[0102]

[0103]

[0104] Experimental materials and experimental methods involved in this application:

[0105] Mice: Eight-week-old C57B6 / J male mice were purchased from Beijing Weitonglihua Experimental Animal Technology Co., Ltd. Infection experiments were performed in the ABSL-2 animal laboratory of the Experimental Animal Center of Tsinghua University. The mice were grown under appropriate conditions that met the standards.

[0106] Strain source: The mouse model used in this example is caused by airway induction of highly virulent and drug-resistant (carbapenem antibiotics) Klebsiella pneumoniae. The Klebsiella pneumoniae used was isolated and cultured from the sputum of hospitalized patients in the Department of Respiratory and Critical Care Medicine, First Medical Center, General Hospital of the People's Liberation Army. It was identified by the BD Phoenix fully automatic bacterial system and determined to be highly virulent and drug-resistant (carbapenem antibiotics) Klebsiella pneumoniae, i.e., CR-hvKP strain, according to the drug sensitivity test standards (2016 edition) of the American Clinical Laboratory Standards Association.

[0107] Stringing experiment (viscosity test): The isolated Klebsiella pneumoniae was subjected to a stringing experiment (commonly referred to as "stringing experiment" or "viscosity test") to evaluate the adhesion properties of bacteria. First, select a semi-solid agar medium suitable for the growth of target bacteria; inoculate bacteria: inoculate the bacteria onto the culture medium, and use a sterile inoculation loop to take a small amount of bacterial culture solution; culture conditions: place the culture medium after inoculation of bacteria in a constant temperature incubator, usually at 37°C for 18-24 hours; observe growth: observe the growth of bacteria on the culture medium and identify the colony morphology; stringing test: use a sterile fine needle or inoculation loop to gently touch the surface of the colony, gently lift the fine needle or inoculation loop, if the bacteria have a high adhesion, you can see a sticky filamentous substance pulled up on the fine needle, and evaluate the adhesion properties of the bacteria based on the length and viscosity of the stringing. The longer the stringing, the stronger the bacterial adhesion.

[0108] Model construction: A total of 52 mice were randomly divided into four groups, namely, control group, model group, 3HB treatment group and 1,3-butanediol treatment group, with 13 mice in each group. Before modeling, they were placed in the same environment to adapt to the environment for 1 week, and the above-mentioned live Klebsiella pneumoniae (cultured in LB liquid medium) was prepared. The model group, 3HB treatment group and 1,3-butanediol treatment group mice anesthetized by right abdominal intraperitoneal injection of 150 μL / 10g Avertin were leaned on the inclined mouse operating table, the mouse's mouth was opened and one end of the tongue was clamped, the mouse's airway opening was found under the light of the small animal laryngoscope, and the airway administration needle dedicated to small animals was used to probe the mouse's airway. 5×10 6 The number of live bacteria was measured by dripping 50 μL of liquid into the airway of each mouse into the lungs. The anesthetized mice in the control group were treated with an equal amount of LB liquid culture medium. During the entire modeling process, live Klebsiella pneumoniae was administered once through the lungs. The model was established on the 5th day after the modeling began, and alveolar lavage fluid and eye blood were collected. After the collection was completed, the experimental animals were euthanized and lung tissue samples were retained.

[0109] Drug treatment: 3HB treatment group mice were gavaged with 100 mg / kg 3-hydroxybutyrate sodium salt 7 days in advance, and the drug was administered at the same time every day after the modeling began until the end of the modeling, once a day, and the physical condition of the mice was monitored. 1,3-Butanediol was administered to mice in the 1,3-Butanediol treatment group 7 days in advance. 1,3-Butanediol was dissolved in the drinking water of the mice and added to the drinking water at a volume ratio of 10%. The mice ingested 1,3-Butanediol while drinking water.

[0110] Statistics of mouse weight and survival status: The weight and mortality of mice were tested and the results were statistically analyzed every day.

[0111] Measurement of lung wet-to-dry weight ratio: remove the mouse lung tissue, wipe off the blood, weigh the wet weight, put the lung tissue into a 2.0 mL EP tube, open the lid and place it in a 65°C oven for one day, weigh the dry weight, and take the ratio of the two values ​​for statistical calculation as the lung wet-to-dry weight ratio.

[0112] Collection of bronchoalveolar lavage fluid (BALF) from mice: general anesthesia was performed on mice using 270-330 mg / kg, i.e. 0.14-0.18 mL / 10 g, of the anesthetic avertin; endotracheal intubation: a midline incision was made in the neck to expose the trachea and perform intubation; lavage: physiological saline (usually cold or at room temperature) was injected into the lungs through the endotracheal cannula, then gently aspirated, and this process was repeated several times; recovery of BALF: the aspirated fluid was collected into a centrifuge tube, the BALF was centrifuged, the supernatant was taken, and the protein content and cytokine content of the supernatant were measured.

[0113] BCA determination of protein content: Use Bio-Gene BCA protein quantification detection kit (BN27109) and refer to the standard curve according to the instructions to obtain the final protein content result.

[0114] Cytokine detection in bronchoalveolar lavage fluid: The mouse inflammatory factor kit BD Cytometric Bead Array (CBA) Mouse lnflammation Kit (BD-Cat552364) was used for detection. The specific operations are as follows: reagent preparation, reconstitute the cytokine standards (Lyophilized Mouse lnflammation Standards) with the specified reagent diluent (Assay Diluent), and perform serial dilutions to prepare the standard curve; mix the various capture beads (Mouselnflammation Capture Beads) evenly for experimental use; add the mixed capture beads (Mixed Capture Beads) to each reaction tube, add the standard diluent or the sample to be tested to each reaction tube, add the mouse inflammation PE detection reagent (Mouse lnflammation PE Detection Reagent), and incubate for 2 hours; washing steps: add the wash buffer (Wash buffer) to each reaction tube Buffer), discard the supernatant after centrifugation, re-add the wash buffer, and resuspend the beads. Sample collection: use flow cytometer to collect samples, and ensure that the collection is completed on the same day. Data analysis: use FCAP Array software to analyze the data.

[0115] Mouse eyeball blood collection and plasma whole blood cell analysis: Use 270-330 mg / kg, i.e. 0.14-0.18 mL / 10 g of the anesthetic avertin to perform general anesthesia on mice; disinfect the mouse eyes, use sharp ophthalmic scissors or blades to make a small incision on the eyeball, and collect blood: gently squeeze the eyeball to collect the blood flowing out of the incision; transfer the collected blood to a centrifuge tube containing EDTA anticoagulant; use the fully automatic blood cell analyzer ncpsb50002 to test the collected whole blood.

[0116] RNA extraction experiment: Place lung tissue samples in Trizol, break the samples and treat with dichloroform to separate protein and RNA; add isopropanol to precipitate RNA, and collect RNA by centrifugation; wash the RNA precipitate with 75% ethanol to remove residual salt and impurities; dissolve the RNA precipitate in RNase-free water; use NanoDrop micro-spectrophotometer to determine the concentration and purity of RNA (A260 / A280 ratio).

[0117] Real-time fluorescence quantitative experiment: Use reverse transcriptase to transcribe RNA into cDNA. qPCR reaction system preparation: cDNA template, primers, qPCR Master Mix (including DNA polymerase, buffer, dNTPs, fluorescent dye, etc.); according to the characteristics of the enzyme used, set the appropriate program in the qPCR instrument, including initial denaturation, annealing and extension steps; collect and analyze data. The primers used are as follows:

[0118] TNF-α-F: CCCTCACACTCAGATCATCTTCT (SEQ ID NO: 1);

[0119] TNF-α-R: GCTACGACGTGGGCTACAG (SEQ ID NO: 2);

[0120] IL-6-F: TAGTCCTTCCTACCCCAATTTCC (SEQ ID NO: 3);

[0121] IL-6-R:TTGGTCCTTAGCCACTCCTTC (SEQ ID NO: 4);

[0122] IL-1β-F: GCAACTGTTCCTGAACTCAACT (SEQ ID NO: 5);

[0123] IL-1β-R: ATCTTTTGGGGTCCGTCAACT (SEQ ID NO: 6);

[0124] Caspase-3-F: TGGTGAATGAAGGGTCATTTATG (SEQ ID NO: 7);

[0125] Caspase-3-R: TTCGGCTTTCCAGTCAGACTC (SEQ ID NO: 8);

[0126] Nox-2-F: GACTGCGGAGAGTTTGGAAG (SEQ ID NO: 9);

[0127] Nox-2-R: GGTGATGACCACCTTTTGCT (SEQ ID NO: 10).

[0128] Mouse lung tissue pathology section experiment: After the lung tissue is removed, it is immediately placed in a 10% formalin solution for fixation to maintain the tissue structure; the fixed tissue is dehydrated by different concentrations of ethanol, and then xylene is used as a transparent agent; the dehydrated and transparent tissue block is soaked in paraffin and then embedded to make a wax block; the embedded paraffin block is frozen and cut into thin slices with a slicer, generally with a thickness of about 5μm; the slices are separated from the paraffin and usually dewaxed with xylene; the dewaxed slices are hydrated with gradient ethanol and finally rinsed with tap water; HE staining includes hematoxylin staining of cell nuclei and eosin staining of cytoplasm. After hematoxylin staining, 1% hydrochloric acid ethanol is used for differentiation, and then blueing is performed. After that, eosin is used to stain the cytoplasm; the stained slices are dehydrated by gradient ethanol, transparentized with xylene, and finally sealed with neutral gum.

[0129] Statistics and data analysis: Values ​​were expressed as mean ± SD. Statistical comparisons were performed using Student's t-test, with p values ​​less than 0.05 considered significant differences.

[0130] Example 1: Construction of Klebsiella pneumoniae infection model

[0131] The Klebsiella pneumoniae used to construct the severe pneumonia model in this application was isolated and cultured from the sputum of hospitalized patients in the Department of Respiratory and Critical Care Medicine of the First Medical Center of the General Hospital of the People's Liberation Army. The genes sequenced from the bacteria were compared on the species and taxonomy prediction website (a comprehensive analysis and prediction platform containing typing results of multiple pathogens) (https: / / pathogen.watch / sign-in?redirect= / upload), and it was further confirmed that the bacteria belonged to Klebsiella pneumoniae (Taxonomy ID: 573). The analysis of antibiotic resistance is shown in Table 1, which shows that it contains resistance to carbapenems. The serial number of the bacteria uploaded to the National Center for Biotechnology Information (NCBI) website is BioSampleaccessions: SAMN43298422.

[0132] Table 1

[0133]

[0134]

[0135] The results are as follows:

[0136] Table 1 shows that the Klebsiella pneumoniae used in this model is resistant to many commonly used antibiotics and is a clinical multi-drug resistant strain, including but not limited to aminoglycosides, carbapenems, third-generation cephalosporins (3rdgen.), etc. Multi-drug resistance makes clinical treatment complicated, and traditional antibiotic treatment regimens are often difficult to work.

[0137] Figure 1 The wire drawing experiment proved that after the Klebsiella pneumoniae used in the model was cultured, a sterile inoculation loop was used to gently touch the surface of the colony and lift it up, and a sticky filamentous substance was observed to form on the inoculation loop. The filamentous substance was uniformly transparent, had a certain elasticity, and was not easy to break. The colony morphology was regular and the edges were clear. This shows that the bacteria have strong adhesion and are more likely to colonize and spread in the host body, indicating that the bacteria are highly toxic.

[0138] Table 1 Figure 1 The results show that the Klebsiella pneumoniae strain used in this example has the characteristics of multiple antibiotic resistance (including carbapenems) and high toxicity, and can well simulate the clinical Klebsiella pneumoniae (especially CRKP or CR-hvKP) infection.

[0139] Example 2: Comparison of 3HB and 1,3-butanediol in alleviating Klebsiella pneumoniae infection

[0140] The survival rate, lung wet-to-dry weight ratio, protein content in bronchoalveolar lavage fluid, neutrophil percentage in whole blood, and cytokine content in bronchoalveolar lavage fluid of mice in the model group, control group, 3HB treatment group, and 1,3-butanediol treatment group were analyzed using the method described above.

[0141] Figure 2 The results showed that compared with the control group, the body weight of the model group decreased significantly after the model was established, and the 3HB treatment group effectively alleviated the weight loss, but 1,3-butanediol did not alleviate the weight loss.

[0142] Figure 3 The results revealed the severity of Klebsiella pneumoniae infection. Compared with the control group, the model group had a high mortality rate after the model was established, highlighting that the strain caused a non-ordinary infection that does not usually lead to death. This high mortality rate indicates that Klebsiella pneumoniae can cause severe pneumonia, a clinical condition that can rapidly deteriorate and lead to respiratory failure. The survival rate of mice in the 3HB treatment group increased significantly, but the mortality rate of mice in the 1,3-butanediol treatment group was similar to that of the model group, or even higher than that of the model group.

[0143] Figure 4The results showed that the lung wet-to-dry weight ratio of the model group increased significantly compared with the control group, and the 3HB treatment group significantly restored the lung wet-to-dry weight ratio compared with the model group, which is an important indicator of pulmonary edema and inflammation. The reduction in lung wet-to-dry weight ratio indicates that 3HB treatment helps reduce fluid accumulation in the lungs and improves alveolar ventilation, which is a positive change for patients with severe pneumonia.

[0144] In addition, compared with the control group, the protein content in the model group and the 1,3-butanediol treatment group increased significantly, while a decrease in the protein content in the 3HB treatment group was observed in the alveolar lavage fluid. Proteins in the alveolar lavage fluid are usually derived from cytokines, enzymes, and other molecules released during inflammation, and their increased content is associated with alveolar damage and the severity of the inflammatory response. The decrease in protein content in the 3HB treatment group suggests that 3HB may have an anti-inflammatory effect, which can reduce the inflammatory response in the lungs and reduce the damage to cells and extracellular matrix.

[0145] Figure 5 The results further revealed the effect of 3HB on neutrophils in the blood of mice infected with Klebsiella pneumoniae. Compared with the control group, the number of neutrophils in the whole blood of mice in the model group increased significantly, reflecting the systemic inflammatory response and activation of the immune system triggered by the infection. In the 3HB-treated group, the trend of neutrophil increase was observed to be significantly inhibited. This suggests that 3HB may have a certain regulatory effect on cell mobilization and infiltration during the inflammatory process. Neutrophils are the first white blood cells to arrive at the site of infection or injury in the inflammatory response, and they play a key role in clearing pathogens and damaged tissues. However, excessive neutrophil infiltration may also lead to increased tissue damage. 3HB treatment reduced the number of neutrophils, which may help to reduce lung inflammation and associated tissue damage.

[0146] Figure 6Cytokines were detected using bronchoalveolar lavage fluid from each group of mice, including IL-6 (interleukin 6), IL-10 (interleukin 10), TNF-α (tumor necrosis factor α), MCP-1 (monocyte chemoattractant protein 1) and IFNγ (interferon γ). Compared with the control group, the levels of IL-6, TNF-α, MCP-1 and IFNγ in the bronchoalveolar lavage fluid of mice in the model group increased significantly. The increase in these cytokines is usually associated with the inflammatory process and the activation of immune cells. IL-6 and TNF-α are key proinflammatory cytokines that play an important role in the early stages of the inflammatory response. MCP-1 is an important chemotactic factor for monocytes and lymphocytes, while IFNγ plays a central role in regulating immune responses and cell-mediated defense mechanisms. The 3HB treatment group significantly reduced the levels of IL-6 and TNF-α, indicating that 3HB may have an anti-inflammatory effect and can reduce the systemic inflammatory response caused by infection. The 3HB treatment group showed a more obvious trend in reducing the levels of MCP-1 and IFNγ. IL-10 is an anti-inflammatory factor. Compared with the control group, the IL-10 content in the model group decreased significantly, while the IL-10 content in the 3HB treatment group showed an upward trend. The above results indicate that 3HB may have a regulatory effect on specific inflammatory pathways, especially in reducing the recruitment and activation of inflammatory cells. Figure 6 The results showed that the anti-inflammatory effect of 3HB may help alleviate lung inflammation damage caused by Klebsiella pneumoniae infection, improve clinical symptoms, and may have a positive impact on preventing further damage to lung tissue after infection. 3HB may play an important role in regulating the host immune response to infection by reducing the levels of key pro-inflammatory cytokines, thereby helping to control the inflammatory process and reduce lung tissue damage.

[0147] 1,3-Butanediol can be converted into 3-hydroxybutyric acid in the body, but in the above results, 1,3-butanediol had no improvement on the body weight, survival rate, whole blood cell analysis, cytokine content of bronchoalveolar lavage fluid, lung wet-to-dry weight ratio and total protein content of bronchoalveolar lavage fluid of model mice. In this application, the effect of 3-hydroxybutyric acid is significantly better than 1,3-butanediol.

[0148] Example 3: 3HB alleviates Klebsiella pneumoniae infection

[0149] The RNA in the lung tissue was extracted by the method described above, and fluorescence quantitative detection was performed to measure the expression of cytokines, apoptosis-related genes (such as Caspase-3) and oxidative stress-related genes (such as Nox-2) in the lung tissue of mice in the model group, control group and 3HB treatment group.

[0150] Figure 7 The results showed that Klebsiella pneumoniae successfully induced a severe pneumonia phenotype in model mice.

[0151] In terms of cytokines, compared with the control group, the expression of tumor necrosis factor α (TNF-α), interleukin-6 (IL-6) and interleukin-1β (IL-1β) in the lung tissue of the model group was significantly upregulated, which indicated that the inflammatory response of the lung tissue was activated. The upregulation of the gene expression of these cytokines not only damaged the alveolar epithelial cells and vascular endothelial cells, but also increased the permeability of the alveolar-capillary membrane, causing pulmonary edema.

[0152] In terms of apoptosis and oxidative stress, Caspase-3, as a key protease for executing programmed cell death, is overactivated in Klebsiella pneumoniae infection, leading to apoptosis and further damage to lung tissue. At the same time, in the oxidative stress response that occurs in the lungs during infection, NADPH oxidases (NOXs) are an important source of regulating the generation of reactive oxygen species (ROS), such as Nox-2, which is an oxidative stress-related gene. Compared with the control group, the expression of Caspase-3mRNA and Nox-2mRNA in the lung tissue of the model group was significantly upregulated.

[0153] In the 3HB treatment group, the pathological changes caused by Klebsiella pneumoniae infection were significantly alleviated by the treatment with 3HB. Specifically, 3HB significantly reduced the expression of TNF-α, IL-6, and IL-1β genes by 41.5% (p<0.01), 48.63% (p<0.001), and 28.4% (p<0.05), respectively. These results indicate that 3HB has a significant anti-inflammatory effect. In terms of the apoptosis pathway, 3HB treatment significantly reduced Caspase-3 gene expression by 48.6%, a finding that reveals the anti-apoptotic effect of 3HB. In addition, 3HB also significantly reduced Nox-2 gene expression by 42.2%, indicating that 3HB has an anti-oxidative stress effect and helps to reduce oxidative damage caused by Klebsiella pneumoniae infection.

[0154] Figure 7 The results showed that at the genetic level, during Klebsiella pneumoniae infection, 3HB can not only regulate the inflammatory response and reduce the expression of key proinflammatory cytokines, but also inhibit cell apoptosis and oxidative stress, thereby playing a protective role in the treatment of severe pneumonia.

[0155] Furthermore, the above method was used to perform pathological sectioning and staining of the lung tissues of mice in the model group, control group, and 3HB treatment group. Figure 8 shown.

[0156] Figure 8The panoramic view and representative magnified images of lung tissue pathology show that compared with the control group, the alveolar structure in the model group was significantly destroyed, with alveolar edema and thickening of the alveolar wall, as shown by the red arrow; multiple alveolar structures were fused with each other, as shown by the blue arrow; a large number of inflammatory cells infiltrated and aggregated in large numbers (neutrophils and monocytes infiltrated in the alveolar wall and pulmonary interstitium), showing a severe inflammatory phenotype, as shown by the black arrow; the distribution of dense structures of pulmonary fibrosis increased significantly, as shown by the yellow arrow; a large number of red blood cells aggregated in the airway bleeding, as shown by the green arrow; the increased permeability of blood vessels and alveolar membranes caused exudates, proteins, etc. to leak into the alveolar cavity, as shown by the gray arrow. In the 3HB treatment group, the infiltration of inflammatory cells, pulmonary edema, distribution of pulmonary fibrosis and inflammatory phenotype were greatly reduced. The above results fully illustrate the effective role of 3HB in alleviating severe pneumonia caused by Klebsiella pneumoniae from the genetic and pathological levels.

[0157] This example comprehensively evaluates the potential effect of 3HB in treating Klebsiella pneumoniae (especially CRKP or CR-hvKP) infection through the above experiments. Compared with the control group, the mice in the model group showed significant weight loss and high mortality after infection, which is consistent with the high virulence and multidrug resistance of Klebsiella pneumoniae, and 3-hydroxybutyric acid (3HB) showed significant multi-faceted efficacy in treating Klebsiella pneumoniae infection.

[0158] 3HB effectively regulates the host's immune response to infection and reduces inflammatory damage caused by infection through its combined effects at the molecular and cellular levels. Specifically, 3HB significantly reduced the expression of key proinflammatory cytokines TNF-o, IL-6, and IL-1β in lung tissue, reduced the protein content in bronchoalveolar lavage fluid, improved the lung wet-to-dry weight ratio, and alleviated pathological damage to lung tissue. In addition, 3HB also reduced the number of inflammatory cells such as neutrophils in the blood that increased due to Klebsiella pneumoniae infection, indicating its potential in inhibiting the recruitment and activation of inflammatory cells. 3HB's reduced expression of the apoptosis-related gene Caspase-3 and inhibition of Nox-2 gene expression further confirmed its role in anti-apoptosis and anti-oxidative stress. Pathological results further confirmed the therapeutic effect of 3HB. The lung tissues of mice in the 3HB-treated group showed less inflammatory cell infiltration, pulmonary edema, and fibrosis. These improved pathological features were consistent with the changes in gene and cytokine expression. These results comprehensively confirm the potential value of 3HB in regulating the host immune response to Klebsiella pneumoniae infection and alleviating the inflammatory process.

[0159] In summary, this example reveals the multiple mechanisms of action of 3HB in reducing inflammation, inhibiting apoptosis, and alleviating oxidative stress through comprehensive experimental evaluation. These mechanisms of action not only provide new strategies for clinical treatment, but also point the way for future research and drug development in the field of treatment of drug-resistant strain infections (especially CRKP infections). With the further study of 3HB and the advancement of clinical trials, it not only provides a new perspective for the treatment of Klebsiella pneumoniae infections, but also contributes new solutions to address the global challenge of antibiotic resistance.

[0160] The preferred embodiments of the present invention are described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the technical concept of the present invention, a variety of simple modifications can be made to the technical solution of the present invention, and these simple modifications all belong to the protection scope of the present invention.

[0161] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present invention will not further describe various possible combinations.

Claims

1. D-3-hydroxybutyric acid or a pharmaceutically acceptable salt thereof as the sole active ingredient in a preparation for treating and / or preventing airway infection caused by Klebsiella pneumoniae ( Klebsiella Pneumoniae ) caused by pneumonia, pulmonary fibrosis or pulmonary edema; the Klebsiella pneumoniae is highly virulent and carbapenem-resistant Klebsiella pneumoniae (CR-hvKP).

2. The use according to claim 1, characterized in that: in, Pharmaceutically acceptable salts include one or more of sodium salts, potassium salts, magnesium salts or calcium salts.

3. The use according to claim 1, characterized in that: The Klebsiella pneumoniae ( Klebsiella Pneumoniae )’s BioSample accessions are SAMN43298422.

Images