A primer-probe combination for real-time fluorescence RAA detection of human type 1 of circovirus and its application

Abstract

The present invention discloses a primer-probe combination for real-time fluorescent RAA detection of human type 1 of circular virus and its application, which relates to the field of biological detection technology. The primer-probe combination includes an upstream primer F4, a downstream primer R1 and a probe P; the nucleotide sequence of the upstream primer F4 is shown in SEQ ID NO.7; the nucleotide sequence of the downstream primer R1 is shown in SEQ ID NO.8; the nucleotide sequence of the probe P is shown in SEQ ID NO.3. The primer-probe combination can be used to realize real-time fluorescent RAA detection of human type 1 of circular virus, which has the advantages of fast operation, high sensitivity and strong specificity. The present invention provides a new technical means for accurate and rapid detection of GyH1.

Description

Technical Field

[0001] The present invention relates to the field of biological detection technology, and in particular to a primer-probe combination for real-time fluorescent RAA detection of human type 1 circovirus and an application thereof. Background Art

[0002] Gyrovirus homsa1 (GyH1) is the third newly discovered circular virus after Chicken infectious anemia virus (CIAV), and is a member of the genus Gyrovirus in the family Anelloviridae. GyH1 infection is often found in chickens and often occurs in the form of mixed infection. The main symptoms of sick chickens are depression, thin body and obvious swelling of the glandular stomach. Pathological histological examination can observe serous inflammation of the glandular stomach, and blood smear observation shows anemia. It is an important pathogen that causes infectious glandular gastritis in chickens. There is currently no effective treatment for GyH1 infection, and there is no commercial vaccine for GyH1 infection.

[0003] In the clinical detection and epidemiological research of GyH1, immunological diagnosis includes indirect ELISA method, double antibody sandwich ELISA method and colloidal gold immunochromatographic test strip detection method, and molecular detection technology includes conventional PCR detection and real-time fluorescence quantitative PCR detection. Due to the lack of cell culture and reproduction system for GyH1, PCR has been used as the main method for detecting GyH1 infection. At present, conventional PCR detection is widely used in laboratory testing, but the detection results of this method are not specific enough, there are false positives, and it is often necessary to cooperate with DNA sequencing for verification; while real-time fluorescence quantitative PCR detection has high requirements for instruments and equipment, is limited to the laboratory, and has a long detection time, which is not suitable for grassroots pathogen detection. Therefore, it is necessary to improve the relevant detection technology research as soon as possible, establish a more rapid, sensitive and specific detection method, monitor GyH1 infection, and protect the healthy development of poultry farming. Summary of the invention

[0004] The purpose of the present invention is to provide a primer-probe combination for real-time fluorescent RAA detection of human type 1 of circular virus and its application to solve the problems existing in the above-mentioned prior art. The primer-probe combination can realize real-time fluorescent RAA detection of human type 1 of circular virus, which has the advantages of fast operation, high sensitivity and strong specificity.

[0005] To achieve the above object, the present invention provides the following solutions:

[0006] The present invention provides a primer-probe combination for real-time fluorescence RAA detection of human type 1 of circular virus, comprising an upstream primer F4, a downstream primer R1 and a probe P;

[0007] The nucleotide sequence of the upstream primer F4 is shown in SEQ ID NO.7;

[0008] The nucleotide sequence of the downstream primer R1 is shown in SEQ ID NO.8;

[0009] The nucleotide sequence of the probe P is shown in SEQ ID NO.3.

[0010] Furthermore, the probe P has 4 modification sites, and its sequence is: TGCCACATTAGTTGTTGTAACGT TTT[ROX-dT]G[THF]C[BHQ2-dT]TTAGTTGTGTCTGGT[c3-spacer].

[0011] The present invention also provides the use of the above primer-probe combination in preparing a product for detecting human type 1 of circle virus with real-time fluorescence RAA.

[0012] Furthermore, the product is a kit or a reagent.

[0013] The present invention also provides a product for real-time fluorescent RAA detection of human type 1 circular virus, comprising the above-mentioned primer-probe combination.

[0014] Furthermore, the product is a kit or a reagent.

[0015] Furthermore, the product also includes A Buffer and B Buffer.

[0016] Furthermore, the product also includes RNase-free Water.

[0017] Furthermore, the reaction system of the product is: ABuffer 25μL, upstream primer F42.5μL, downstream primer R12.5μL, probe P1.2μL, RNase-free Water 11.3μL, DNA sample 5μL and B Buffer 2.5μL.

[0018] Furthermore, the reaction procedure of the product is: 38°C for 60s; 38°C for 30s, 40 cycles.

[0019] The present invention discloses the following technical effects:

[0020] The present invention designs and screens specific primers and probes for GyH1, optimizes the reaction conditions, and establishes a GyH1 recombinase-mediated nucleic acid isothermal amplification (RAA) detection method. The real-time fluorescence RAA method established by the present invention can identify GyH1 within 20 minutes; the method has strong specificity, and no amplification phenomenon occurs when reacting with other related poultry pathogens, and there is no cross reaction; the method has high sensitivity, and the screened primers and probes can be effectively amplified, with a conventional sensitivity of 4×10 2 copies / μL, the detection limit can reach 10 after optimizing the reaction conditions 2 The repeatability was good, and the coefficient of variation within and between batches was less than 4%. The fluorescence RAA method and the fluorescence quantitative PCR method were used to test 231 samples at the same time, and the test results of the two methods were consistent.

[0021] The present invention successfully establishes a real-time fluorescent RAA rapid detection kit, which can be used for the identification and detection of GyH1, and provides a new technical means for the accurate and rapid detection of GyH1. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0023] Figure 1 is the result diagram of the all-negative test; wherein, 1 to 16 represent the primer and probe combinations of F1 / R1 / P, F1 / R2 / P, F1 / R3 / P, F1 / R4 / P, F2 / R1 / P, F2 / R2 / P, F2 / R3 / P, F2 / R4 / P, F3 / R1 / P, F3 / R2 / P, F3 / R3 / P, F3 / R4 / P, F4 / R1 / P, F4 / R2 / P, F4 / R3 / P and F4 / R4 / P respectively;

[0024] Figure 2 This is a positive test verification result diagram; A is the plasmid concentration of 4×10 5 The RAA amplification results of primer-probe combinations F1 / R1 / P, F1 / R2 / P, F1 / R3 / P, F1 / R4 / P, F2 / R1 / P, F2 / R2 / P, F2 / R3 / P and F2 / R4 / P at 4×10 copies / μL; B is the RAA amplification results of primer-probe combinations F1 / R1 / P, F1 / R2 / P, F1 / R3 / P, F1 / R4 / P at 4×10 copies / μL; B is the RAA amplification results of primer-probe combinations F1 / R1 / P, F1 / R2 / P, F1 / R3 / P and F2 / R4 / P at 4×10 5 The RAA amplification results of primer-probe combinations F3 / R1 / P, F3 / R2 / P, F3 / R3 / P, F3 / R4 / P, F4 / R1 / P, F4 / R2 / P, F4 / R3 / P and F4 / R4 / P at 4×10 copies / μL; C is the plasmid concentration of 4×10 3The RAA amplification results of primer-probe combinations F1 / R1 / P, F1 / R2 / P, F1 / R3 / P, F1 / R4 / P, F2 / R1 / P, F2 / R2 / P, F2 / R3 / P and F2 / R4 / P at 4×10 copies / μL; D is the plasmid concentration of 4×10 3 copies / μL, RAA amplification results of primer-probe combinations F3 / R1 / P, F3 / R2 / P, F3 / R3 / P, F3 / R4 / P, F4 / R1 / P, F4 / R2 / P, F4 / R3 / P, and F4 / R4 / P;

[0025] Figure 3 Figure 2 is the sensitivity test result of the primer-probe combination of F4 / R1 / P and F4 / R1 / P; A is the primer-probe combination of F4 / R1 / P; B is the primer-probe combination of F4 / R1 / P; in A and B, 1-6: 4×10 6 ~4×10 1 copies / μL; 7: negative control;

[0026] Figure 4 It is a graph of the results of the real-time fluorescence RAA specificity test; 1-4: 4 GyH1 nucleic acid samples; 5-15: GyVg1, CIAV, FadV4, AIV-H9, NDV, IBV, IBDV, ChPV, ALV, MG, MS; 16: negative control;

[0027] Figure 5 This is the result of the real-time fluorescence RAA sensitivity test; 1-7:10 6 ~10 0 Copies / μL; 8: negative control;

[0028] Figure 6 This is the result of the real-time fluorescence RAA intra-batch repeatability test; 1-3:10 6 Copies / μL: 4-6:10 4 Copies / μL; 7-8: negative control;

[0029] Figure 7 This is the result of the real-time fluorescence RAA batch reproducibility test; 1-3:10 6 Copies / μL: 4-6:10 4 Copies / μL; 7-8: negative control. DETAILED DESCRIPTION

[0030] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0031] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0032] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0033] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0034] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0035] Example 1

[0036] 1 Materials and methods

[0037] 1.1 Viruses and clinical samples

[0038] Four GyH1-positive nucleic acids (verified by PCR sequencing) and 11 other non-target reference strains, including circovirus avian type 1 (GyVg1), chicken infectious anemia virus (CIAV), fowl adenovirus type 4 (FadV4), H9 subtype avian influenza (H9-AIV), Newcastle disease virus (NDV), avian infectious bronchitis virus (IBV), infectious bursal disease virus (IBDV), chicken parvovirus (ChPV), avian leukemia virus (ALV), Mycoplasma gallisepticum (MG) and Mycoplasma synoviae (MS), were isolated and preserved by our laboratory; 231 clinical samples were collected from live poultry markets and small-scale chicken farms in Guangxi, including 163 chicken oro-anal swabs and 68 chicken tissue samples, and stored at -80℃.

[0039] 1.2 Reagents and instruments

[0040] Pre-packaged viral RNA / DNA extraction kits were purchased from Biowater (Tianjin) Biotechnology Co., Ltd.; rapid gel recovery kits and Trans5α competent cells were purchased from Beijing Quanshijin Biotechnology Co., Ltd.; Omega plasmid mini-extraction kits were purchased from Beijing Solebow Technology Co., Ltd.; pMD18-T vectors, EcoR I and Hind III restriction enzymes were purchased from Bio-Rad Biotechnology (Dalian) Co., Ltd.; RAA nucleic acid amplification kit (fluorescence type) was purchased from Hangzhou Zhongce Biotechnology Co., Ltd.

[0041] NPA-32P fully automatic nucleic acid extraction and purification instrument was purchased from Hangzhou Biori Technology Co., Ltd.; T100 gradient PCR instrument and universal Hood II gel imager were purchased from BIO-RAD, USA; DYY-7C nucleic acid electrophoresis instrument was purchased from Beijing Liuyi Instrument Factory; NanoDrop2000 UV spectrophotometer was purchased from Thermo Fisher Scientific, USA; Genchek isothermal fluorescence amplification instrument was purchased from Hangzhou Zhongce Biotechnology Co., Ltd.

[0042] 1.3 Primer probe design and screening

[0043] All GyH1 sequences on NCBI were queried and downloaded, and the full sequence was aligned to determine the amplification region. According to the primer design principles, primers (F / R) for preparing positive cloning vectors were designed around the selected amplification region; according to the RAA primer probe design principles, a specific probe was designed and synthesized, and 4 upstream and downstream primers were designed and synthesized corresponding to the probe. 4 upstream primers (F1-4), 4 downstream primers (R1-4), and 1 probe (P) were used to establish 16 sets of primer-probe combinations, and full negative verification, positive test verification, and sensitivity comparison were performed to screen out the optimal primer-probe combination for subsequent experiments. All the above primers and probes were synthesized by Sangon Biotech (Shanghai) Co., Ltd., and the sequences are shown in Table 1.

[0044] Table 1 Nucleotide sequences of primers and probes

[0045]

[0046]

[0047] 1.4 Preparation of positive cloning vector

[0048] One of the GyH1 positive nucleic acids was selected as a template, and PCR amplification was performed with primers GyH1-F / R. The expected amplified fragment size was 418bp. The amplified product was subjected to 1.5% agarose gel electrophoresis, and the target fragment was excised and recovered. The gel-recovered product was connected to the vector. After the connection reaction was completed, it was transformed into competent cells to screen and obtain positive clones. The plasmid was extracted by expanding the system culture, and double enzyme digestion was performed to verify the successful construction of the cloning vector. The positive cloning vector was sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing, and the sequence of the cloned fragment was confirmed to be consistent with the expectation, and it was named pMD18-T-GyH1. The nucleic acid concentration of the positive cloning vector was determined by ultraviolet spectrophotometer and stored at -20℃ as a standard for standby use.

[0049] 1.5 Optimization of reaction conditions

[0050] The reaction system was configured according to the instructions of the RAA Nucleic Acid Amplification Kit (Fluorescence Type), and six temperature gradients of 37, 38, 39, 40, 41, and 42°C were set. The optimal preheating and amplification temperatures were determined according to the reaction results. A 3×3 primer-probe concentration matrix table (Table 2) was designed, including 3 primer concentrations (300, 400, and 500 nmol / L) and 3 probe concentrations (90, 120, and 150 nmol / L). The optimal primer-probe concentration combination was determined based on the comprehensive fluorescence intensity and Ct value.

[0051] Table 2 Primer and probe concentration optimization matrix

[0052]

[0053] 1.6 Specificity, sensitivity and repeatability test

[0054] The nucleic acids of 11 reference strains (GyVg1, CIAV, FadV4, AIV-H9, NDV, IBV, IBDV, ChPV, ALV, MG, and MS) were used as templates. Sterile water was used as a negative control, and 4 GyH1 positive nucleic acids were used as 4 different positive controls. The specificity of this method was verified using the optimized real-time fluorescence RAA reaction system.

[0055] The positive clone vector standard was diluted tenfold, and 10 6 ~10 0 The positive clone vector standard with 100 copies / μL was used as a template, and sterile water was used as a template as a negative control. The optimized reaction system was used for sensitivity test to determine the minimum detection limit of GyH1.

[0056] Select a dilution of 10 6 , 10 4The positive clone vector standard with 100 copies / μL was used as a template, and each dilution was repeated 3 times for intra-batch repeatability test; after an interval of one week, the above detection operation was repeated for inter-batch repeatability test. The intra-batch and inter-batch coefficients of variation were calculated to evaluate the stability of the method.

[0057] 1.7 Clinical sample testing

[0058] The 231 clinical samples collected in the laboratory in the early stage were soaked in DMEM culture medium supplemented with double antibodies (streptomycin and penicillin), and were repeatedly frozen and thawed three times at -80°C. Then 200 μL of supernatant was taken and the nucleic acid was extracted as a template using an automatic nucleic acid extraction and purification instrument. At the same time, the real-time fluorescence RAA detection method established in this study and the SYBR Green real-time fluorescence quantitative PCR detection method established by Tian Xue (Tian Xue, Yu Kexiang, Hu Feng, et al. Establishment of SYBR GreenⅠ real-time fluorescence quantitative PCR method for circovirus type 3 associated with infectious glandular gastritis in chickens [J]. Chinese Journal of Zoonotic Infectious Diseases. 2022, 30(02): 93-99) were used for amplification, and the detection results of the two methods were compared.

[0059] 2 Results

[0060] 2.1 Primer screening

[0061] The negative test of 16 primer sets was carried out, and the fluorescence curve was flat, with no peak and Ct value ( Figure 1 ), negative is qualified. Select 4×10 5 copies / μL, 4×10 3 Two template concentrations of copies / μL were used for positive test verification, and the comprehensive fluorescence curve ( Figure 2 ) and Ct values ​​(Table 3). The optimal primer-probe combination was F4 / R1 / P, and the suboptimal combination was F2 / R1 / P. The optimal and suboptimal primer-probe combinations were tested for sensitivity, and the template concentration was 4×10 6 ~4×10 1 Copies / μL, according to the reaction results ( Figure 3 , Table 4) can determine that the sensitivity of the F4 / R1 / P combination is 4×10 2 copies / μL, the sensitivity of the F2 / R1P combination is 4×10 3 copies / μL, so the optimal primer-probe combination was F4 / R1 / P, with a conventional sensitivity of 4×10 2 copies / μL.

[0062] Table 3 Positive test verification Ct value results

[0063]

[0064]

[0065] Table 4 Sensitivity test Ct value results

[0066]

[0067] Note: noct stands for not detected.

[0068] 2.2 Optimal reaction conditions

[0069] The optimal preheating and amplification temperature determined by optimization was 38°C; considering the comprehensive Ct value and fluorescence intensity, the optimal primer-probe combination was group B3, that is, the total nucleic acid amplification system determined was 50 μL, including 25 μL A Buffer, 2.5 μL each of upstream and downstream primers (10 μmol / L), 1.2 μL of probe (5 μmol / L), 11.3 μL of RNase-free Water, 5 μL of DNA sample, and 2.5 μL of B Buffer; the final reaction procedure was: preheating at 38°C for 60 s; amplification at 38°C for 30 s, 40 cycles to collect fluorescence signals, and confirming the amplification curve at the end of the reaction.

[0070] 2.3 Specificity, sensitivity, and repeatability results

[0071] The real-time fluorescence RAA method established in Section 2.2 of the present invention was used to detect nucleic acids of 15 reference strains. The results were ( Figure 4 ) showed that 4 GyH1 nucleic acid samples were amplified within 8 cycles and generated corresponding fluorescent signals, while the other 11 non-target strain nucleic acid samples and sterile water did not amplify, indicating that the method established by the present invention has strong specificity.

[0072] Real-time fluorescence RAA sensitivity test results ( Figure 5 ) showed that the detection limit of this method was 10 2 copies / μL, with higher sensitivity.

[0073] 10 6 , 10 4 The intra-batch and inter-batch reproducibility results of the GyH1 real-time fluorescence RAA method at two dilutions of 1.54 copies / μL Figure 6 , Figure 7 ) showed that the three amplification curves of each dilution under the "ROX" channel fitted well, with intra-batch coefficients of variation of 2.37% and 3.88%, and inter-batch coefficients of variation of 0.95% and 1.08%, respectively, all below 4%, with good repeatability.

[0074] 2.4 Clinical sample testing

[0075] The GyH1 real-time fluorescence RAA method established in Section 2.2 of the present invention was used to detect 231 clinical samples, and 11 positive samples were detected, with a positive rate of 4.76%. The SYBR Green real-time fluorescence quantitative PCR method was used to detect 13 positive samples, among which the GyH1 positive samples detected by the real-time fluorescence RAA method were completely consistent with the positive samples detected by the real-time fluorescence quantitative PCR, indicating that the detection results of this method are credible.

[0076] In summary, the present invention designs and screens specific primers and probes for GyH1, optimizes the reaction conditions, and makes the established fluorescent RAA reaction system and other related poultry pathogens react without amplification, with good specificity; small coefficients of variation within and between batches, strong stability; the detection results of clinical samples are consistent with the actual results, with high credibility. In addition, the detection sensitivity of this method can reach 10 2 Copies / μL is 100 times that of conventional PCR and 10 times that of colloidal gold test strips. This method only requires a Genchek isothermal fluorescence amplification instrument or a mini digital constant temperature detector to react at 38°C for 20 minutes to obtain the result. The instrument is cheap and easy to operate, and can realize rapid on-site testing for grassroots staff.

[0077] Example 2

[0078] A kit for real-time fluorescence RAA detection of human type 1 circovirus, comprising A Buffer, B Buffer, upstream primer F4, downstream primer R1 and probe P.

[0079] The reaction system of the kit for real-time fluorescence RAA detection of human type 1 of circle virus is as follows:

[0080] ABuffer 25μL, upstream primer F4 (10μmol / L) 2.5μL, downstream primer R1 (10μmol / L) 2.5μL, probe P (5μmol / L) 1.2μL, RNase-free Water 11.3μL, DNA sample 5μL and B Buffer 2.5μL.

[0081] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. Use of a primer-probe combination for real-time fluorescence RAA detection of circle virus human type 1 in the preparation of a product for real-time fluorescence RAA detection of circle virus human type 1, characterized in that: It includes an upstream primer F4, a downstream primer R1 and a probe P; The nucleotide sequence of the upstream primer F4 is shown in SEQ ID NO.7; The nucleotide sequence of the downstream primer R1 is shown in SEQ ID NO.8; The nucleotide sequence of the probe P is shown in SEQ ID NO.3; the probe P has 4 modification sites, and its sequence is: TGCCACATTAGTTGTTGTAACGTTTT[ROX-dT]G[THF]C[BHQ2-dT]TTAGTTGTGTCTGGT[c3-spacer].

2. The use according to claim 1, characterized in that: The product is a kit or a reagent.

3. A product for real-time fluorescence RAA detection of human type 1 of circle virus, characterized in that: A primer-probe combination for real-time fluorescence RAA detection of human type 1 of circle virus, characterized in that it includes an upstream primer F4, a downstream primer R1 and a probe P; The nucleotide sequence of the upstream primer F4 is shown in SEQ ID NO.7; The nucleotide sequence of the downstream primer R1 is shown in SEQ ID NO.8; The nucleotide sequence of the probe P is shown in SEQ ID NO.3; the probe P has 4 modification sites, and its sequence is: TGCCACATTAGTTGTTGTAACGTTTT[ROX-dT]G[THF]C[BHQ2-dT]TTAGTTGTGTCTGGT[c3-spacer].

4. The product according to claim 3, characterized in that The product is a kit or a reagent.

Images