InDel molecular marker closely linked to maize brittle stalk and application thereof
By developing the InDel molecular marker InDel-NR53 on maize chromosome 3, the problem of unclear molecular mechanism of maize stalk brittle mutant was solved, enabling early and accurate screening and breeding, and improving the breeding efficiency of maize lodging resistance and yield.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-08-30
- Publication Date
- 2026-03-27
AI Technical Summary
There are few reports on maize stalk brittle mutants in the current technology, the molecular mechanism regulating maize stalk brittleness is unclear, which affects maize lodging resistance and yield, and existing molecular markers are difficult to screen and breed efficiently.
A new InDel molecular marker, InDel-NR53, closely linked to maize stalk brittleness was developed. The marker was amplified by PCR using specific primer pairs and utilized to perform early screening and identification of maize stalk brittleness by leveraging the presence of a 1480-nucleotide insertion on maize chromosome 3 compared to the wild type.
It enables a simple, fast, and efficient identification of maize brittle stalk traits, supports marker-assisted breeding of maize, improves breeding efficiency, and helps breed lodging-resistant, high-yielding, and high-quality maize varieties.
Smart Images

Figure CN118813861B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of molecular genetics, and particularly relates to an InDel molecular marker closely linked to maize brittle stalk and application thereof. BACKGROUND
[0002] Under the background of the current escalating energy crisis, the development of bioenergy has attracted global attention. As one of the world's major food crops, maize plays an indispensable role in food, feed, industry and energy.
[0003] Maize lodging is a key trait affecting maize high yield and quality, mechanized harvesting. In recent years, maize lodging has become one of the key factors restricting maize high yield and quality in China. Maize resistance to lodging is related to many factors such as stem mechanical strength, lignocellulose content of stem, and environmental changes, and the mechanical strength occupies the main influencing factor.
[0004] The mechanical strength of plants directly affects the yield and quality of crops. Brittle mutant is a common mutation type in plants. Brittle mutation refers to the mutation of increased brittleness of plant stems, leaves and other tissues. Brittle traits have been found in rice, maize, barley and wheat. Brittle traits mainly manifest in two aspects: one is to cause the mechanical strength of crops to decrease, thereby affecting the resistance to lodging; the other is to cause the lignocellulose content of plants to decrease, the soluble sugar content to change, and the brittleness to increase, and the plants to be easy to break.
[0005] Stems not only provide mechanical support for maize during growth, but also are important parts for maize to store and transport nutrients. Maize lodging will affect the full absorption of sunlight by maize leaves for photosynthesis, resulting in the abnormal growth of maize, and thereby affecting the yield of maize.
[0006] The lignocellulose content will affect the taste of fresh corn and the quality of green storage corn, and the brittleness of corn stalks is a favorable trait for livestock digestion and absorption. Therefore, the study of the brittleness mechanism of maize stems will improve the understanding of maize lodging, and has important guiding significance for cultivating maize varieties with high yield, grain and feed dual-purpose and bioenergy purposes, and improving the utilization value of crop straw.
[0007] Cellulose is synthesized by the cellulose synthase complex (CSC) on the plasma membrane (PM). The CSC complex has six-fold symmetry and is referred to as a "rosette". Each CSC contains 18-24 cellulose synthase catalytic subunits (CESA). All CESA proteins found are 986-1088 amino acids in length and have the same overall structure, including two N-terminal transmembrane domains (TMDs), six C-terminal TMDs, an N-terminal zinc finger domain, and a cytoplasmic catalytic domain between TMD 2 and TMD 3. Synthase complexes composed of different CESA subtypes are responsible for the cellulose of the primary and secondary cell wall, respectively.
[0008] Molecular markers have the advantages of large quantity, simple and rapid, not affected by environmental conditions, etc., and can provide rich and complete genetic information, and are widely used in germplasm identification, QTL positioning and molecular marker assisted selection, etc. Insertion deletion (InDel) marker is a commonly used molecular marker based on DNA level difference. It refers to the difference between two samples, that is, compared with one sample, another sample has a specific number of nucleotide insertion or deletion at some sites in the genome. According to these insertion deletion sites, specific PCR primers are designed for amplifying these sites. Using InDel markers closely linked to target genes, through assisted backcrossing, pedigree selection, or even whole genome selection, linkage drag can be reduced, beneficial genes can be aggregated, breeding process can be accelerated, and selection efficiency can be effectively improved. However, there are few reports on corn stalk fragility mutants, and the molecular mechanism regulating corn stalk fragility is not clear. By finding molecular markers closely linked to corn brittle stalk, it is of great significance to explore genes related to brittle stalk and effectively utilize corn stalk fragility traits. SUMMARY
[0009] In view of the above prior art, the purpose of the present application is to provide an InDel molecular marker closely linked to corn brittle stalk and its application. The InDel molecular marker of the present application can be used to detect corn brittle stalk traits, and can be used in breeding practice simply, quickly and with high throughput, thereby accelerating the breeding process of corn.
[0010] To achieve the above purpose, the technical scheme adopted by the present application is as follows:
[0011] In a first aspect of the present application, an InDel molecular marker closely linked to corn brittle stalk is provided, and the InDel molecular marker is molecular marker InDel-NR53; the nucleotide sequence of the molecular marker InDel-NR53 is shown in SEQ ID No. 1. The specific embodiments are as follows:
[0012]
[0013] The molecular marker InDel-NR53 of the present application is located on the chromosome 3 of maize, compared with the wild type, there is an insertion of 1480 nucleotides between 203349918bp-203349919bp of chromosome 3, and the physical position refers to the B73RefGen_v5 genome version.
[0014] The inserted 1480 nucleotides are as shown in SEQ ID No. 2, specifically as follows:
[0015]
[0016] In a second aspect of the present application, the above InDel molecular marker is applied in (1) or (2) as follows:
[0017] (1) early seedling stage screening or identification of maize germplasm resources for brittle stalk trait;
[0018] (2) maize molecular marker assisted breeding.
[0019] In the above application, the maize molecular marker assisted breeding is specifically maize brittle stalk germplasm innovation and / or hybrid breeding.
[0020] In a third aspect of the present application, a primer pair for amplifying the above InDel molecular marker is provided, and the nucleotide sequences of the primer pair are shown in SEQ ID No. 3 and SEQ ID No. 4, respectively; and specifically as follows:
[0021] upstream primer: 5'-GCCCGCTGTGGTACGGTTA-3'; (SEQ ID No. 3)
[0022] downstream primer: 5'-GACCGATGGTGAATCAGCAGAT-3'. (SEQ ID No. 4)
[0023] The InDel molecular marker band closely linked to the maize brittle stalk amplified by the above primer pair is 2297 bp, and the nucleotide sequence is shown in SEQ ID No. 1.
[0024] If the band size amplified by the above primer pair is 817 bp, and the nucleotide sequence is shown in SEQ ID No. 5, it indicates that the stem phenotype is not brittle.
[0025] GCCCGCTGTGGTACGGTTACGGTGGCGGCCGTCTGAAATGGCTCCAGAGGCTCTCCTACATCAACACCATCGTGTACCCGTTCACTTCTCTTCCTCTCGTTGCCTACTGTTGCCTGCCTGCCATTTGCCTGCTCACAGGAAAGTTCATTATACCTACGGTAAGTTAGCTCTCAGCACGTGTACCTGGCGTCGTAATTCATATGGCCACCCACGATGCTCATTTGTCATTCTTTCTTCCAGCTGTCCAACGCTGCAACGATATGGTTTCTTGGCCTCTTCATGTCCATCATCGTGACGAGCGTGTTGGAGCTGCGGTGGAGTGGCATCGGGATCGAGGACTGGTGGCGCAACGAGCAGTTCTGGGTCATCGGAGGCGTGTCCGCGCACCTGTTCGCCGTGTTCCAGGGTATCCTCAAGATGATTGCCGGGCTGGACACCAACTTCACGGTCACGGCAAAGGCCACGGACGACACTGAGTTCGGGGAGCTGTACCTGTTCAAGTGGACGACGGTGCTGATCCCGCCCACAAGCATCCTGGTGCTGAACCTGGTGGGCGTGGTGGCTGGGTTCTCGGCCGCGCTCAACAGCGGCTACGAGTCCTGGGGCCCGCTCTTCGGTAAGGTGTTCTTCGCCATGTGGGTGATCATGCACCTGTACCCGTTCCTCAAGGGTCTCATGGGCCGCCAGAACCGCACGCCGACCATCGTGGTGCTCTGGTCCGTCCTCCTCGCCTCCGTCTTCTCCCTCCTGTGGGTCAAGATCGACCCATTCGTTGGAGGAACCGAGACCGTCAACACCAACAACTGCAACACGATCA.
[0026] In a fourth aspect of the present application, a kit containing the primer pair is provided.
[0027] Further, the kit further comprises: a DNA template, Taq Master Mix, and ddH2O.
[0028] In a fifth aspect of the present application, the primer pair or the kit is used in (1) or (2) as follows:
[0029] (1) early screening or identification of maize germplasm resources with brittle stalk traits;
[0030] (2) maize molecular marker assisted breeding.
[0031] In the above applications, the maize molecular marker assisted breeding is specifically: breeding of maize lodging-resistant germplasm, high-quality forage maize germplasm, high-quality fresh corn germplasm innovation and / or hybrid.
[0032] In a sixth aspect of the present application, a method for detecting the brittle stalk trait of maize is provided, comprising the following steps:
[0033] The genomic DNA of the maize to be tested is used as a template, and a primer pair shown in SEQ ID No. 3 and SEQ ID No. 4 is used for PCR amplification, and the brittle stalk trait of the maize with the homozygous sequence of the PCR product of SEQ ID No. 1 is lower than that of the maize with the homozygous sequence of the PCR product of SEQ ID No. 5.
[0034] Preferably, the reaction system for PCR amplification is: 0.5 μL of single-stranded DNA shown in SEQ ID No. 3 with a concentration of 10 μM; 0.5 μL of single-stranded DNA shown in SEQ ID No. 4 with a concentration of 10 μM; 1 μL of genomic DNA with a concentration of 100 ng / μL; 5 μL of 2×Taq Master Mix; and 3 μL of ddH2O.
[0035] The reaction conditions for PCR amplification are: pre-denaturation at 95℃ for 5 min; denaturation at 95℃ for 30 s, annealing at 58℃ for 30 s, extension at 72℃ for 30 s, 35 cycles; extension at 72℃ for 10 min; and preservation at 12℃.
[0036] In a seventh aspect of the present application, a method for identifying the genotype of maize related to the brittle stalk trait is provided, comprising the following steps:
[0037] The genomic DNA of the maize to be tested is used as a template, and a primer pair shown in SEQ ID No. 3 and SEQ ID No. 4 is used for PCR amplification, and the brittle stalk trait of the maize with the homozygous sequence of the PCR product of SEQ ID No. 1 is lower than that of the maize with the homozygous sequence of the PCR product of SEQ ID No. 5.
[0038] If a band with a size of 2297 bp is amplified, the phenotype of the maize stalk should be brittle; if a band with a size of 817 bp is amplified, the phenotype of the maize stalk should be non-brittle; if bands with sizes of 2297 bp and 817 bp are amplified, the phenotype of the maize stalk should be a heterozygous genotype of non-brittle, and the offspring will be separated.
[0039] The present application has the following beneficial effects:
[0040] The present application first screens and identifies an InDel molecular marker closely linked to maize brittle stalk from maize chromosome 3, and the InDel molecular marker of the present application can accurately identify the brittle stalk trait of maize at an early stage, has the advantages of being simple, fast, efficient, accurate, good repeatability, high specificity, and can be used for maize molecular marker assisted breeding. Moreover, the brittle mutant found in the present application is brittle throughout the growth period, and has important value for studying maize cell wall cellulose synthesis and lodging resistance. BRIEF DESCRIPTION OF DRAWINGS
[0041] Figure 1 Sequence alignment of maize inbred line B73 and maize brittle stalk mutant wil1 at the molecular marker InDel-NR53 of the present application.
[0042] Figure 2 Electrophoretogram of PCR amplification products of the molecular marker InDel-NR53 of the present application in the maize materials of Example 2. Among them, N is the amplification band type of homozygous B73 genotype, which is the non-brittle (Non-brittle) phenotype, B is the amplification band type of homozygous wil1 genotype, which is the brittle (Brittleness) phenotype, H is the amplification band type of heterozygous genotype, and M is Marker;
[0043] (a): the amplification results of two parents using the molecular marker InDel-NR53; (b), (c) are electrophoretograms of PCR amplification products of the molecular marker InDel-NR53 in the F2 population.
[0044] Figure 3 Fiber content detection results of stem, leaf and leaf vein of V10 leaf stage in the maize materials of Example 2 of the present application. DETAILED DESCRIPTION
[0045] It should be noted that the following detailed description is exemplary and is intended to provide further explanation of the present application. Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present application belongs.
[0046] Term explanation:
[0047] Maize brittle stalk trait: the cellulose content of the stem of normal maize plants is 20%-30% throughout the growth period, and the phenotype of maize stem is defined as non-brittle; the maize brittle stalk trait referred to in the present application refers to the cellulose content of the stem of maize being less than 15% throughout the growth period, which is significantly lower than that of normal maize inbred lines.
[0048] As mentioned before, as the main food and forage crop in China, the degree of corn stalk brittleness directly affects the ability of corn to resist lodging and corn yield; when applied to livestock breeding and feed industry, the composition and brittleness of corn stalks and leaves will affect the feed digestion and absorption rate of livestock. In addition, the overall cellulose content of corn will also affect the quality of fresh corn. However, the molecular mechanism of regulating corn stalk brittleness is still unclear.
[0049] Therefore, the gene controlling the brittle stalk trait of corn is studied in the present application, the genetic mode of the brittle stalk trait is determined by using genetic methods, and the position of the gene closely related to the brittle stalk trait is determined by using techniques such as association analysis and map-based cloning. Primer design and optimization are also one of the important technical difficulties in developing InDel molecular markers closely linked to the brittle stalk trait. Due to the variability of the characteristics of the target DNA sequence, it may be challenging to design specific primers. The design of primers needs to consider the length, GC content, specificity of the target DNA sequence, and the site coverage between primers. In addition, the temperature and amplification program of the primers also need to be optimized to ensure reliable amplification effect. The brittle stalk trait with polymorphism may also require the design of multiple sets of primers to cover each polymorphic site.
[0050] In the present application, the brittle stalk mutant wil1 found in the field is used as the male parent, and the inbred lines B73 and B104 are used as the female parent to construct an F2 segregation population, and the gene controlling the brittle stalk of corn is finely mapped. The F2 segregation population constructed is planted in the field, and the segregation population is phenotyped at the 6-leaf stage. The total DNA is extracted from the leaves with brittle stalk phenotype, and the polymorphism of the brittle stalk mutant and the parent is screened by using the synthesized and self-developed SSR markers on the IBM map of corn. According to the published corn genome, the primers are encrypted, and finally the brittle stalk gene is located between the two molecular markers WN43 and WN107, with a physical distance of 30.02Kb. Sequencing in the mapping interval shows that the brittle stalk mutant of corn has an insertion of 1480 nucleotides compared with the wild type, and this region can be used as an InDel molecular marker closely linked to the brittle stalk of corn, named InDel-NR53.
[0051] Based on the InDel molecular marker, the present application further designs specific primers for specifically amplifying the above InDel molecular marker, which are as follows:
[0052] Upstream primer: 5'-GCCCGCTGTGGTACGGTTA-3';
[0053] Downstream primer: 5'-GACCGATGGTGAATCAGCAGAT-3'.
[0054] The specific primer is subjected to blast analysis, and based on the existing corn genome sequence, it is found that the molecular marker InDel-NR53 is located on the 3rd chromosome of corn, and compared with the wild type, there is an insertion of 1480 nucleotides between 203349918bp-203349919bp of the 3rd chromosome, and the physical position is referred to the B73RefGen_v5 genome version.
[0055] The molecular marker InDel-NR53 of the present application can accurately identify the brittle stalk trait of corn at an early stage, which is beneficial for breeding excellent varieties suitable for lodging resistance planting, or breeding forage varieties conducive to the digestion and absorption of livestock feed, thereby the present application is proposed.
[0056] In order to enable those skilled in the art to more clearly understand the technical solutions of the present application, the technical solutions of the present application will be described in detail below in combination with specific embodiments.
[0057] The test materials used in the embodiments of the present application are all conventional test materials in the art, and can be purchased through commercial channels. The experimental methods not specified in detail are carried out according to the conventional test methods or according to the operation instructions recommended by the suppliers.
[0058] Example 1: Obtaining of InDel molecular marker closely linked to brittle stalk of corn
[0059] 1. Obtaining of brittle stalk mutant
[0060] The wil1 mutant is a natural mutant found in a breeding field, which has a brittle stalk phenotype, the stem is easy to fold, the lodging resistance is significantly lower than that of the wild type, and the brittle stalk phenotype can be stably inherited, and it is preliminarily determined that the phenotype is caused by gene mutation.
[0061] 2. Genetic analysis
[0062] The wil1 mutant is crossed with normal inbred lines B73 and B104, and the F1 stem develops normally, indicating that the brittle stalk is a recessive trait. In the F2 segregation population combined with B73, the ratio of wild type plant number to mutant plant number is 3:1 (χ2=0.436<χ20.05,1=3.84) by chi-square test, indicating that the wil1 mutant trait is controlled by one pair of recessive nuclear genes.
[0063] Table 1: Genetic analysis of wil1 brittle stalk mutant
[0064]
[0065] 3. Preliminary positioning of brittle stalk gene
[0066] The F2 segregation population constructed from the inbred line B73 and the brittle stalk mutant is planted in the field, and the segregation population is phenotypically identified at the 6-leaf stage, and the total DNA is extracted from the leaf with the brittle stalk phenotype.
[0067] The specific identification method is as follows: the stem is identified by using a stem strength tester, the brittle stalk mutant has a stem breaking tension of about 15-25 N, and the normal stem has a breaking tension of 45-60 N. Moreover, the brittle stalk mutant can be easily broken by hand.
[0068] The existing and self-developed SSR markers on the IBM map of synthetic corn are used for polymorphism screening of the brittle stalk mutant and the parent. The mixed population segregation analysis method (BSA) is used for gene positioning of the brittle stalk mutant. The 448 pairs of public SSR primers averagely distributed on the whole genome of corn are used for polymorphism marker screening of B73 and the brittle stalk mutant, and there are 175 pairs of primers with parent polymorphism difference. Equal amounts of DNA of 5 normal plant strains and 5 mutant plant strains are mixed to construct a normal DNA pool and a mutant DNA pool, and the 175 pairs of primers are subjected to preliminary linkage analysis, and finally 6 pairs of markers that are possibly closely linked to the brittle stalk trait are screened out. The 32 F2 brittle stalk plants are subjected to PCR amplification by using the 6 pairs of molecular markers that are possibly linked to the target gene, and the gel electrophoresis is used for verification, and the result shows that WN-9 and WN-401 are closely linked to the target trait. The 652 brittle stalk mutant plants are subjected to PCR amplification and electrophoresis verification by using the two pairs of primers WN-9 and WN-401, and the single plants with recombination exchange between the markers are found out, and according to the number and physical position of the exchange single plants, the brittle stalk gene is preliminarily positioned between the WN-9 and WN-401 markers on the chromosome of corn No., and the genetic distances are 6 cM and 21 cM respectively, and the physical distance is 39 Mb.
[0069] Note: WN-9 and WN-401 are both self-designed markers, and the base sequences are as follows:
[0070] WN-9
[0071] Upstream primer: 5'-GTGGTTGGTTTGGTCAATCA-3';
[0072] Downstream primer: 5'-TTATCTTCCATGGTGCAACG-3'.
[0073] WN-401
[0074] Upstream primer: 5'-AGCCATGGCATAGTGATGGT-3';
[0075] Downstream primer: 5'-AACCCTAACCTAGCCCTCTGA-3'.
[0076] 4. Fine mapping of brittle gene
[0077] DNA was extracted from the leaves of the brittle plants of the F2 segregation population constructed from B73, B104 and brittle mutant. Based on the initial mapping between the markers WN-9 and WN-401, 96 pairs of SSR molecular markers were developed for detecting the polymorphic differences between B73, B104 and the brittle mutant. The markers with differences were used for further fine mapping, and finally the brittle gene was mapped between the two molecular markers WN43 and WN107 on chromosome 3 of corn, with a physical distance of 30.02 Kb.
[0078] Note: WN-43 and WN-107 are self-designed markers, and their base sequences are as follows:
[0079] WN-43
[0080] Upstream primer: 5'-GCAATGGCCTTTGTGTTTCC-3';
[0081] Downstream primer: 5'-CATGCCAGTTACCAGGTGC-3'.
[0082] WN-107
[0083] Upstream primer: 5'-CCTCTATGCGTGCAATGCTA-3';
[0084] Downstream primer: 5'-CGCTAGCTGCTGCTACCTCT-3'.
[0085] Finally, an InDel molecular marker closely linked to the brittle corn was screened on chromosome 3 of corn, named molecular marker InDel-NR53. The nucleotide sequence of the corresponding molecular marker InDel-NR53 in the brittle mutant is shown in SEQ ID No. 1. Compared with the wild type, there is an insertion of 1480 nucleotides between 203349918bp-203349919bp on chromosome 3, and the physical position is referred to the B73 RefGen_v5 genome version.
[0086] Example 2: Application of molecular marker InDel-NR53 in the identification of corn stalk brittleness
[0087] Based on the molecular marker InDel-NR53 screened in Example 1, a primer pair for amplifying the molecular marker was designed, and the sequence of the designed primer pair is shown in SEQ ID No. 3 and SEQ ID No. 4, as follows:
[0088] Upstream primer: 5'-GCCCGCTGTGGTACGGTTA-3';
[0089] Downstream primer: 5'-GACCGATGGTGAATCAGCAGAT-3'.
[0090] The alignment results of the amplification product sequences of the molecular marker InDel-NR53 for the corn inbred line B73 and the wil1 mutant are shown in the following table. Figure 1
[0091] Taking the corn inbred line B73 and the wil1 mutant as parents, a new F2 separation population is constructed, and the brittle stalk trait of the corn material in the F2 separation population can be detected by using the molecular marker InDel-NR53 and the designed primer pair, as follows:
[0092] Taking the genomic DNA of the corn to be tested as a template, the primer pair shown in SEQ ID No. 3 and SEQ ID No. 4 is used for PCR amplification, and the size of the amplification product is used for judgment.
[0093] If the molecular weight of the PCR amplification product of the corn sample to be tested is 817 bp, the corn sample to be tested contains the normal brittle stalk allele; if the molecular weight of the PCR amplification product of the corn sample to be tested is 2297 bp, the corn sample to be tested contains the corn brittle stalk allele.
[0094] The reaction system of 10 μL PCR amplification is as follows:
[0095] (1) 0.5 μL of the forward amplification primer shown in SEQ ID No. 3 with a concentration of 10 μmol / L;
[0096] (2) 0.5 μL of the reverse amplification primer shown in SEQ ID No. 4 with a concentration of 10 μmol / L;
[0097] (3) 1 μL of the DNA template with a concentration of 100 ng / μL;
[0098] (4) 5 μL of 2×Taq Master Mix;
[0099] (5) 3 μL of ddH2O.
[0100] The program of PCR amplification is as follows:
[0101] (1) 94℃ pre-denaturation for 10 min;
[0102] (2) 94℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 30 s, 35 cycles;
[0103] (3) 72℃ extension for 10 min;
[0104] (4) 10℃ storage.
[0105] The amplified fragments of the brittle material in the brittle mutant and the separation population are obtained by the above amplification, and electrophoresis is performed in a 1.5% agarose gel (as shown in Figure 2 If a band with a size of 2297 bp is amplified, the stem phenotype is brittle; if a band with a size of 817 bp is amplified, the stem phenotype is non-brittle normal stem; and if two bands with sizes of 2297 bp and 817 bp are amplified, it is indicated that the corn is a heterozygous genotype.
[0106] The cellulose content in the corn material identified as brittle by the above molecular marker InDel-NR53 and the corn material identified as normal stem is determined by the following method:
[0107] First, prepare the standard of cellulose, and respectively take 0, 0.40, 0.80, 1.20, 1.60, 2.00 mL into test tubes, and add 2.00, 1.60, 1.20, 0.80, 0.40, 0 mL of distilled water in corresponding order, and shake well. At this time, the 6 gradient concentrations of the cellulose standard have been prepared. Record the respective concentration values, and then add 0.5 mL of 2% anthrone and 5.0 mL of concentrated sulfuric acid to each test tube, and shake gently, wearing plastic gloves to avoid liquid splashing out. After standing for 10 min, pour into a cuvette at a wavelength of 620 nm, and determine the absorbance of the solution with different concentrations on the machine. According to the corresponding relationship between absorbance and concentration, a standard curve is made, and a regression equation is calculated.
[0108] The corn material sample is first treated, and is placed in a water bath, and a certain amount of 60% sulfuric acid is added, and is digested for 30 min. The digested cellulose solution is transferred to a 100 mL volumetric flask, and is diluted to 100 mL scale with 60% sulfuric acid. After shaking, it is filtered into another beaker. Then, 5 mL of the filtrate is taken and is placed into a 100 mL volumetric flask, and is diluted to scale with distilled water in a cold water bath, and is shaken and used. The dilution factor is recorded.
[0109] According to the above method, 2 ml of the cellulose solution is taken into a test tube, 0.5 mL of 2% anthrone and 5.0 mL of concentrated sulfuric acid are added, and are shaken gently, and are allowed to stand for 10 min, and the absorbance is read on a spectrophotometer at a wavelength of 620 nm. According to the measured absorbance, the cellulose content in the corn material can be calculated according to the regression equation.
[0110] The results are as follows: Figure 3As shown, the cellulose content of the stalks (Mu-Stalks) and leaf veins (Mu-Leaf Veins) of the maize material (Mu) identified as having brittle stalks by the molecular marker InDel-NR53 was significantly lower than that of the maize material (WT) identified as having normal stalks by the molecular marker InDel-NR53. The identification result of the molecular marker InDel-NR53 was consistent with the cellulose content determination result.
[0111] The above results prove that the molecular marker InDel-NR53 of the present application can be used to detect the brittle stalk trait of maize, and the result is accurate and reliable.
[0112] The above only describes the preferred embodiments of the present application and is not intended to limit the present application. Various modifications and changes can be made by those skilled in the art based on the present application. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application.
Claims
1. An InDel molecular marker tightly linked to corn brittle stalks, characterized in that, The InDel molecular marker is InDel-NR53; the nucleotide sequence of the molecular marker InDel-NR53 is shown in SEQ ID No. 1; The molecular marker InDel-NR53 is located on maize chromosome 3, with a 1480 nucleotide insertion between 203349918bp and 203349919bp on chromosome 3 compared to the wild type. The physical location is referenced from the B73 RefGen_v5 genome version. The sequence of the inserted nucleotides is shown in SEQ ID No.
2.
2. The use of the reagent for detecting the InDel molecular labelling of claim 1 in either (1) or (2) below: (1) Early screening or identification of brittle stalk traits in maize germplasm resources; (2) Marker-assisted breeding of maize; The specific meaning of the marker-assisted breeding of maize is: innovation of maize brittle stalk germplasm or selection of hybrid varieties.
3. The use of the primer pair or kit for amplifying the InDel molecular marker of claim 1 in the following (1) or (2): (1) Early screening or identification of brittle stalk traits in maize germplasm resources; (2) Marker-assisted breeding of maize; The specific meaning of the marker-assisted breeding of maize is: innovation of maize lodging-resistant germplasm or selection of hybrid varieties.
4. The application according to claim 3, characterized in that, The nucleotide sequences of the primer pairs are shown in SEQ ID No. 3 and SEQ ID No. 4, respectively.
5. A method for detecting the brittle stalk trait of corn, characterized in that, Includes the following steps: Using the genomic DNA of the maize to be tested as a template, PCR amplification was performed using the primer pairs shown in SEQ ID No. 3 and SEQ ID No.
4. The brittleness of the homozygous maize with the PCR product sequence of SEQ ID No. 1 was lower than that of the homozygous maize with the PCR product sequence of SEQ ID No.
5.
6. A method for identifying maize genotypes associated with the brittle stalk trait, characterized in that, Includes the following steps: Using the genomic DNA of the maize sample as a template, PCR amplification was performed using the primer pairs shown in SEQ ID No. 3 and SEQ ID No. 4, and the PCR amplification products were detected. If a band of 2297 bp is amplified, the corn stalk phenotype is brittle; if a band of 817 bp is amplified, the corn stalk phenotype is non-brittle; if bands of 2297 bp and 817 bp are amplified, the corn stalk phenotype is a heterozygous non-brittle genotype, and segregation will occur in the offspring.
Citation Information
Patent Citations
Corn ZmTrxh gene and application thereof
CN104877973A
InDel molecular marker co-separated from corn brittle gene and application thereof
CN112430682A