A method for constructing a triple-mutant Alzheimer's disease mouse model and its application

Abstract

The present specification provides a method for constructing a triple-mutant Alzheimer's disease mouse model and its application, the construction method comprising: (1) preparing a transgenic fragment of the first exogenous gene hAPP, a transgenic fragment of the second exogenous gene hPSEN1, and a transgenic fragment of the third exogenous gene hMAPT; (2) inserting the three transgenic fragments into the genome of a mouse fertilized egg; (3) transplanting the fertilized egg into a pseudo-pregnant female mouse, and screening to obtain F0 generation mice in which all three exogenous genes are positive; (4) based on the F0 generation mice, obtaining an Alzheimer's disease mouse model 3-FAD homozygous positive mouse. The Alzheimer's disease mouse model provided in the present specification has a disease progression consistent with that of human patients, with blood markers appearing first, followed by pathological manifestations, and finally behavioral characteristics, providing a more accurate and effective approach for the study and drug treatment of Alzheimer's disease.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering technology, and in particular to a method for constructing a triple-mutant Alzheimer's disease mouse model and its application. Background Art

[0002] Alzheimer's disease (AD) is a common degenerative disease of the central nervous system in the elderly or pre-elderly. It is the main type of dementia, accounting for 60-70%. Its typical manifestations are early memory loss and cognitive impairment, followed by behavioral and psychiatric symptoms such as anxiety and delusions. The main pathological characteristics of AD include amyloid plaques, neurofibrillary tangles (NFTs) in the brain, and neurodegeneration in the hippocampus and cortex. Amyloid β (Aβ) is produced by the cleavage of amyloid precursor protein (APP) by β and γ secretases. Aβ42 is more toxic due to its high aggregation. The amyloid plaques formed by its accumulation can cause neuronal damage and death through various mechanisms, exacerbating neurodegeneration. Tau protein is abnormally phosphorylated in AD, detaches from microtubules and aggregates to form NFTs, destroying neuronal structure and function, leading to severe cognitive impairment.

[0003] In order to study the pathological mechanism of AD and develop therapies, scientists have constructed a variety of transgenic mouse models, introducing mutations in AD-related genes (such as APP, PS1, and Tau genes) to simulate pathological characteristics. A common strategy is to mutate the human APP gene to simulate Aβ accumulation. Mice carrying mutations in human APP and PS1 genes can develop amyloid plaques and cognitive impairment earlier. Double transgenic mice show memory and synaptic transmission damage at 6 months, which is an ideal model for studying early pathology, but they fail to reproduce Tau protein aggregation in human patients well. Although there are models for editing three mutant genes, mice develop Aβ pathology at 6 months and form NFTs at 12 months, but the behavioral and pathological changes are not completely consistent with clinical patients and can only be used to study specific relationships. In addition, there are non-transgenic models that induce AD-like pathological changes by injecting toxins or natural aging. However, to date, although a variety of AD-related mouse models have been constructed, none of them can match the changes in the course of the disease in human patients.

[0004] Therefore, it is desirable to construct a mouse model that can match the course of Alzheimer's disease in humans. Summary of the invention

[0005] In order to provide a mouse model that can match the course of human Alzheimer's disease patients and provide a more accurate and effective approach for the study and drug treatment of Alzheimer's disease, one or more embodiments of the present specification provide a method for constructing a triple-mutant Alzheimer's disease mouse model, the construction method comprising: (1) preparing a transgenic fragment of a first exogenous gene hAPP, a transgenic fragment of a second exogenous gene hPSEN1, and a transgenic fragment of a third exogenous gene hMAPT; (2) inserting the three transgenic fragments into the genome of a mouse fertilized egg; (3) transplanting the fertilized egg into a pseudo-pregnant female mouse, and screening to obtain F0 generation mice in which all three exogenous genes are positive; (4) based on the F0 generation mice, obtaining 3-FAD homozygous positive mice of the Alzheimer's disease mouse model;

[0006] Among them, the transgenic fragment of the first exogenous gene hAPP carries the Swedish mutation; the transgenic fragment of the second exogenous gene hPSEN1 carries the hPSEN1 M146V mutation; and the transgenic fragment of the third exogenous gene hMAPT carries the hMAPT P243L mutation.

[0007] One or more embodiments of the present specification provide a triple-mutation Alzheimer's disease mouse model for use in studying the pathological mechanism of Alzheimer's disease or screening drugs for treating Alzheimer's disease, wherein the genome of the mouse model includes a transgenic fragment of a first exogenous gene hAPP, a transgenic fragment of a second exogenous gene hPSEN1, and a transgenic fragment of a third exogenous gene hMAPT; wherein the transgenic fragment of the first exogenous gene hAPP carries a Swedish mutation; the transgenic fragment of the second exogenous gene hPSEN1 carries an hPSEN1 M146V mutation; and the transgenic fragment of the third exogenous gene hMAPT carries an hMAPT P243L mutation.

[0008] The embodiments of this specification have at least the following beneficial effects: providing a triple-mutant Alzheimer's disease mouse model that can be stably inherited and whose disease progression is completely consistent with that of human patients. The development of the pathological process or stage of Alzheimer's disease in this mouse model is consistent with that of clinical patients, and has the prospect of being used to study the pathological mechanism of Alzheimer's disease and to screen drugs for the treatment of Alzheimer's disease. BRIEF DESCRIPTION OF THE DRAWINGS

[0009] This specification will be further described in the form of exemplary embodiments, which will be described in detail by the accompanying drawings. These embodiments are not restrictive, and in these embodiments, the same number represents the same structure, wherein:

[0010] Figure 1This is a graph showing the results of testing the blood test indicators for early clinical stage of Alzheimer's disease in the blood of 3-FAD mice according to some embodiments of this specification;

[0011] Figure 2 This is a diagram showing the detection results of Aβ deposition in the brain region of 2-month-old 3-FAD mice according to some embodiments of this specification;

[0012] Figure 3 This is a graph showing the detection results of Aβ deposition in the brain region of 3-FAD mice showing aggregation and plaque formation as the disease progresses according to some embodiments of this specification;

[0013] Figure 4 This is a diagram showing the detection results of p-Tau181 in the brain region of 1-month-old 3-FAD mice according to some embodiments of this specification;

[0014] Figure 5 This is a diagram of the detection results of p-Tau217 in the brain region of 2-month-old 3-FAD mice according to some embodiments of this specification;

[0015] Figure 6 This is a graph showing the detection results of p-Tau (Thr231) in the brain region of 2-month-old 3-FAD mice according to some embodiments of this specification;

[0016] Figure 7 This is a diagram showing the detection results of p-Tau (Ser202, Thr205) in the brain region of 3-FAD mice at 3 months of age as shown in some embodiments of this specification;

[0017] Figure 8 This is a diagram showing the detection results of p-Tau (Ser396) in the brain region of 3-FAD mice at 3 months of age as shown in some embodiments of this specification;

[0018] Figure 9 This is a graph showing the detection results of p-Tau181 changes in the brain region of 3-FAD mice along with the course of the disease as shown in some embodiments of this specification;

[0019] Figure 10 This is a graph showing the detection results of p-Tau (Ser202, Thr205) in the brain region of 3-FAD mice changing with the course of the disease according to some embodiments of this specification;

[0020] Figure 11 This is a diagram of the experimental results of Morris water maze test on 3-month-old 3-FAD mice according to some embodiments of this specification;

[0021] Figure 12 This is a graph showing the test results of mouse blood after administration according to some embodiments of this specification;

[0022] Figure 13 This is a diagram of the detection results of the mouse brain area after administration as shown in some embodiments of this specification. DETAILED DESCRIPTION

[0023] In order to more clearly illustrate the technical solutions of the embodiments of this specification, the following is a brief introduction to the drawings required for the description of the embodiments. Obviously, the drawings described below are only some examples or embodiments of this specification. For ordinary technicians in this field, this specification can also be applied to other similar scenarios based on these drawings without creative work. Unless it is obvious from the language environment or otherwise explained, the same reference numerals in the figures represent the same structure or operation.

[0024] As shown in this specification and claims, unless the context clearly indicates an exception, the words "a", "an", "an" and / or "the" do not refer to the singular and may also include the plural. Generally speaking, the terms "comprise" and "include" only indicate the inclusion of the steps and elements that have been clearly identified, and these steps and elements do not constitute an exclusive list. The method or device may also include other steps or elements.

[0025] One or more embodiments of the present specification provide a triple mutation Alzheimer's disease (3-FAD) mouse model and a construction method and application thereof. By means of gene editing, transgenic fragments of three exogenous genes (including hPSEN1 M146V mutation, hAPP Swedish mutation and hMAPT P243L mutation) are randomly inserted into the mouse genome. Under the regulation of the promoter neural-specific element, the transgenic fragments of the three exogenous genes can be specifically expressed in the brain region of the mouse, thereby obtaining a triple mutation Alzheimer's disease (3-FAD) mouse model that can be stably inherited and whose disease progression is basically consistent with that of human patients.

[0026] The present invention provides a method for constructing a triple-mutant Alzheimer's disease (3-FAD) mouse model, which comprises the following steps:

[0027] (1) Preparing a transgenic fragment of the first exogenous gene hAPP, a transgenic fragment of the second exogenous gene hPSEN1, and a transgenic fragment of the third exogenous gene hMAPT.

[0028] The hAPP gene (human Amyloid Precursor Protein gene) is a gene encoding amyloid precursor protein (APP) and is located on the long arm of human chromosome 21 (21q21.3). It is of great significance in the fields of biomedicine and neuroscience, especially in relation to Alzheimer's Disease (AD).

[0029] In some embodiments, the transgenic fragment of the first exogenous gene hAPP carries a Swedish mutation. The Swedish mutation is a specific mutation of the hAPP gene, named "Swedish mutation" because it was originally found in several families in Sweden and is closely related to early-onset familial Alzheimer's disease (FAD). The Swedish mutation involves two nucleotide changes in the coding region of the hAPP gene, specifically at amino acids 670 and 671 on the coding amyloid precursor protein (APP).

[0030] In some embodiments, the transgenic fragment of the first exogenous gene hAPP comprises the nucleotide sequence shown in SEQ ID NO:1.

[0031] In some embodiments, the transgenic fragment of the first exogenous gene hAPP includes hAPP 5'UTR and a mutant hAPP CDS sequence, and the mutant hAPP CDS sequence carries a Swedish mutation.

[0032] In some embodiments, the transgenic fragment of the first exogenous gene hAPP further includes the nucleotide sequence shown in SEQ ID NO:2.

[0033] The hPSEN1 gene (human Presenilin-1 gene) is a gene that encodes the Presenilin-1 protein (PS1). Presenilin 1 (PSEN1) is a catalytic subunit of γ-secretase, which is responsible for processing amyloid precursor protein (APP) to produce Aβ. The hPSEN1 gene is located on the long arm of human chromosome 14 (14q24.3). Mutation of the PSEN1 gene is one of the main causes of early-onset familial Alzheimer's disease (FAD).

[0034] In some embodiments, the transgenic fragment of the second exogenous gene hPSEN1 carries the hPSEN1 M146V mutation.

[0035] As used herein, "hPSEN1 M146V mutation" refers to the mutation of methionine M at position 146 in the hPSEN1 protein obtained by transcription and translation after the hPSEN1 gene mutates to valine V. The methionine M at position 146 is obtained based on the hPSEN1 protein sequence (GI: 15079861) or its homologous sequence.

[0036] In some embodiments, the transgenic fragment of the second exogenous gene hPSEN1 comprises the sequence shown in SEQ ID NO:3.

[0037] In some embodiments, the transgenic segment of the second exogenous gene hPSEN1 includes a mutant hPSEN1 CDS sequence, and the mutant hPSEN1 CDS sequence carries the hPSEN1 M146V mutation.

[0038] The MAPT gene encodes the microtubule-associated protein Tau, which is a microtubule-binding protein. The intracellular Tau protein is hyperphosphorylated, which reduces its solubility. Hyperphosphorylated Tau competes with tubulin for binding to normal Tau and other microtubule-associated proteins, thereby losing its biological activity in promoting microtubule assembly, leading to microtubule depolymerization and impaired axonal transport, thus causing neuronal degeneration and apoptosis, and ultimately leading to the occurrence of AD. Mutations in the microtubule-associated protein Tau (MAPT) gene are the main factors leading to other Tau-related neurodegenerative diseases such as AD, cortical-basal syndrome, and progressive supranuclear palsy (PSP) syndrome.

[0039] In some embodiments, the transgenic fragment of the third exogenous gene hMAPT carries the hMAPT P243L mutation.

[0040] As used herein, "hMAPT P243L mutation" refers to the mutation of the hMAPT gene to convert the proline P at position 243 in the human microtubule-associated protein Tau (MAPT) to leucine L. The proline P at position 243 is obtained based on the hMAPT protein sequence (GI: 8400711) or its homologous sequence.

[0041] In some embodiments, the transgenic fragment of the third exogenous gene hMAPT includes a mutant hMAPT CDS sequence, and the mutant hMAPT CDS sequence carries an hMAPT P243L mutation.

[0042] In some embodiments, the transgenic fragment of the third exogenous gene hMAPT comprises the nucleotide sequence shown in SEQ ID NO:5.

[0043] In some embodiments, the transgenic fragment of the first exogenous gene hPSEN1, the transgenic fragment of the second exogenous gene hAPP, and the transgenic fragment of the third exogenous gene hMAPT each include a Thy1 promoter.

[0044] In some embodiments, the transgenic fragment of the first exogenous gene hAPP includes elements operably linked and arranged in the following order from 5' to 3': Thy1 promoter, hAPP 5'UTR, mutant hAPP CDS sequence (carrying Swedish mutation); the transgenic fragment of the first exogenous gene hAPP also includes the sequence shown in SEQ ID NO:2.

[0045] In some embodiments, the transgenic fragment of the second exogenous gene hPSEN1 includes elements operably linked and arranged in the following order from 5' to 3': Thy1 promoter, mutant hPSEN1 CDS sequence (carrying hPSEN1 M146V mutation); the transgenic fragment of the second exogenous gene hPSEN1 also includes a sequence as shown in SEQ ID NO:4.

[0046] In some embodiments, the transgenic fragment of the third exogenous gene hMAPT comprises elements operably linked and arranged in the following order from 5' to 3': Thy1 promoter, mutant hMAPT CDS sequence (carrying hMAPT P243L mutation); the transgenic fragment of the third exogenous gene hMAPT also comprises the sequence shown in SEQ ID NO:6.

[0047] The transgenic fragment of the exogenous gene can be obtained in a variety of ways. For example, the transgenic fragment can be directly obtained by artificial in vitro synthesis. In some embodiments, the transgenic fragment can be obtained by constructing a plasmid and performing PCR amplification.

[0048] In some embodiments, preparing the transgenic fragment comprises:

[0049] a. Obtain PCR products of the Thy1 promoter and the first exogenous gene hAPP, the second exogenous gene hPSEN1, and the third exogenous gene hMAPT.

[0050] In some embodiments, primers are designed to obtain PCR products of four fragments, namely, Thy1 promoter, hAPP CDS, hPSEN1 CDS, and hMAPT CDS, by PCR.

[0051] b. The Thy1 promoter is connected to the PCR products of the first exogenous gene hAPP, the second exogenous gene hPSEN1 and the third exogenous gene hMAPT and the backbone vector to form a recombinant vector, and the recombinant vector is transformed into competent cells.

[0052] In some embodiments, the recombinant vectors formed by the Thy1 promoter and the three fragments of hAPP CDS, hPSEN1 CDS, and hMAPT CDS can be transformed into competent cells by heat shock, and then cultured in a 37° C. incubator overnight.

[0053] As used herein, "recombinant vector" refers to a tool for carrying, replicating and expressing exogenous gene fragments. In some embodiments, the vector of the recombinant vector includes but is not limited to a plasmid vector, a eukaryotic cell expression vector, a lentiviral vector, an adenoviral vector or an adeno-associated viral vector.

[0054] c. After transformation, PCR identification and sequencing are performed, and the clones with correct sequencing are selected as transgenic vectors;

[0055] In some embodiments, a transformed monoclonal colony is selected for PCR identification, and the positive clones are transferred to a test tube, the plasmid is extracted, and the clones with correct enzyme digestion are identified. The clones with correct enzyme digestion are sent for testing, and the clones with correct sequencing are selected as the transgenic vectors of the exogenous gene.

[0056] d. preparing the transgenic fragment based on the transgenic vector.

[0057] In some embodiments, the constructed transgenic vector is digested by enzymes to prepare transgenic fragments of the exogenous gene.

[0058] (2) Insert the three transgenic fragments into the genome of mouse fertilized eggs.

[0059] The "insertion" of inserting the three transgenic fragments into the mouse fertilized egg refers to the addition of integration and / or integration replacement in the mouse genome, and the insertion method can be random insertion or site-specific insertion.

[0060] In some embodiments, the transgenic fragment is microinjected into fertilized mouse eggs and randomly targeted and inserted into the mouse genome.

[0061] (3) The fertilized eggs are transplanted into pseudo-pregnant female mice, and the F0 generation mice that are positive for the exogenous gene are screened.

[0062] In some embodiments, identification is performed by PCR reaction, and the primer pairs used in the PCR reaction are shown in SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, and SEQ ID NO: 17, respectively. Among them, SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9 are used to identify the first exogenous gene hAPP; SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, and SEQ ID NO: 13 are used to identify the second exogenous gene hPSEN1; SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, and SEQ ID NO: 17 are used to identify the third exogenous gene hMAPT.

[0063] (4) Based on the F0 generation of mice, 3-FAD homozygous positive mice of the Alzheimer's disease mouse model were obtained.

[0064] In some embodiments, F0 mice are backcrossed with wild type (WT) mice until F0N5 mice are obtained; and F0N5 mice are self-crossed to obtain 3-FAD homozygous positive mice of the Alzheimer's disease mouse model.

[0065] The embodiments of this specification provide an application of a triple-mutant Alzheimer's disease mouse model obtained by the construction method as described above in studying the pathological mechanism of Alzheimer's disease.

[0066] The embodiments of this specification provide an application of a triple-mutant Alzheimer's disease mouse model obtained by the construction method as described above in screening drugs for treating Alzheimer's disease.

[0067] The present specification also provides a triple-mutant Alzheimer's disease mouse model, whose genome includes a transgenic segment from a first exogenous gene hAPP, a transgenic segment from a second exogenous gene hPSEN1, and a transgenic segment from a third exogenous gene hMAPT. The "mouse model" described herein corresponds to a homozygous positive mouse.

[0068] In some embodiments, the transgenic fragment of the first exogenous gene hAPP carries a Swedish mutation.

[0069] In some embodiments, the transgenic fragment of the first exogenous gene hAPP comprises the sequence shown in SEQ ID NO:1.

[0070] In some embodiments, the transgenic fragment of the second exogenous gene hPSEN1 carries the hPSEN1 M146V mutation.

[0071] In some embodiments, the transgenic fragment of the second exogenous gene hPSEN1 comprises the sequence shown in SEQ ID NO:3.

[0072] In some embodiments, the transgenic fragment of the third exogenous gene hMAPT carries the hMAPT P243L mutation.

[0073] In some embodiments, the transgenic fragment of the third exogenous gene hMAPT comprises the sequence shown in SEQ ID NO:5.

[0074] In some embodiments, the transgenic fragment of the first exogenous gene hAPP, the transgenic fragment of the second exogenous gene hPSEN1, and the transgenic fragment of the third exogenous gene hMAPT each include a Thy1 promoter.

[0075] The embodiments of this specification provide a triple-mutant Alzheimer's disease mouse model. In some embodiments, the triple-mutant Alzheimer's disease mouse model is prepared by the aforementioned construction method.

[0076] The embodiments of this specification provide a triple-mutant Alzheimer's disease mouse model, which can be used to study the pathological mechanism of Alzheimer's disease or screen drugs for treating Alzheimer's disease.

[0077] The embodiments of this specification also provide a method for studying the pathological mechanism of Alzheimer's disease using the triple mutation Alzheimer's disease mouse model described above, and also provide a method for screening drugs for treating Alzheimer's disease using the triple mutation Alzheimer's disease mouse model described above.

[0078] In some embodiments, the method for studying the pathological mechanism of Alzheimer's disease comprises the following steps:

[0079] (1) The transgenic fragments of three exogenous genes were randomly inserted into the mouse genome to prepare a triple-mutant Alzheimer's disease mouse model;

[0080] (2) Add specific markers or crossbreed with other mice to conduct research related to disease mechanisms, regularly monitor the biological characteristics of mice, and collect tissue blocks of mouse tissue structures when biological markers of Alzheimer's disease appear;

[0081] (3) evaluating the expression of DNA, RNA or protein in the tissue blocks collected in step (2);

[0082] (4) Identifying genes or proteins in the tissue block that are associated with the hierarchical organization of diseased cells, the disease process, or changes in biological characteristics.

[0083] The specific marker can be a virus or a lentivirus, including adeno-associated virus (AAV), lentivirus, etc.

[0084] In some embodiments, the method for screening a drug for treating Alzheimer's disease comprises the following steps:

[0085] (1) The transgenic fragments of three exogenous genes were randomly inserted into the mouse genome to prepare a triple-mutant Alzheimer's disease mouse model;

[0086] (2) administering the drug to be screened to the mouse model;

[0087] (3) Regularly test biological characteristics related to Alzheimer's disease in mouse models, including but not limited to blood, cerebrospinal fluid, pathological and behavioral indicators, and test objects including but not limited to proteins, DNA or RNA, etc.;

[0088] (4) Screen for drugs that inhibit the development of biological features associated with Alzheimer’s disease in mouse models.

[0089] The embodiments of this specification have at least the following beneficial effects: the transgenic fragments of the first exogenous gene (containing the hAPP Swedish mutation), the second exogenous gene (containing the hPSEN1 M146V mutation) and the third exogenous gene (containing the hMAPT P243L mutation) are randomly inserted into the mouse genome by gene editing, and under the regulation of the Thy1 promoter neural specific element, the transgenic fragments containing the hPSEN1 M146V mutation, the hAPP Swedish mutation and the hMAPT P243L mutation can be specifically expressed in the brain region of the mouse, thereby obtaining a triple-mutation Alzheimer's disease (3-FAD) mouse model that can be stably inherited and has a disease progression that is completely consistent with that of human patients. The 3-FAD mouse is consistent with that of human patients in the disease progression of Alzheimer's disease, and the situation presented is that blood markers appear first, followed by pathological manifestations, and finally behavioral characteristics appear, which provides a more accurate and effective approach for the study and drug treatment of Alzheimer's disease.

[0090] The technical scheme of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. The partial contents in these embodiments can also be replaced or combined with the corresponding contents in other embodiments, so as to form new embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in the art without making creative labor conditions belong to the scope of protection of the present invention. The experimental methods in the following embodiments, if not otherwise specified, are conventional methods. The test materials used in the following embodiments, if not otherwise specified, are purchased from conventional biochemical reagent companies. The quantitative tests in the following embodiments are all set to three repeated experiments, and the results are averaged. It should be understood that the following examples are for better explanation of the present invention and are not intended to limit the present invention.

[0091] Example

[0092] Example 1 Construction of Alzheimer's disease mouse (3-FAD mouse) model

[0093] The construction of the 3-FAD mouse model includes the following steps:

[0094] (1) Preparing a transgenic fragment of a first exogenous gene hAPP, a transgenic fragment of a second exogenous gene hPSEN1, and a transgenic fragment of a third exogenous gene hMAPT, specifically comprising:

[0095] a. Design primers and obtain PCR products of four fragments, namely, Thy1 promoter, hAPP CDS, hPSEN1 CDS, and hMAPTCDS, by PCR;

[0096] b. The Thy1 promoter was connected to the three fragments of hAPP CDS, hPSEN1 CDS, hMAPT CDS and the backbone vector in vitro, transformed into competent cells by heat shock, and cultured on a plate overnight;

[0097] c. Pick the single clone colonies on the plate for PCR identification, transfer the positive clones to test tubes, extract the plasmids, identify the enzyme digestion, send the clones with the correct enzyme digestion for testing, and finally select the clones with the correct sequencing as the three transgenic final vectors of Thy1-APP, Thy1-PSEN1, and Thy1-MAPT.

[0098] d. The constructed transgenic vector is digested by enzymes to prepare transgenic fragments of the exogenous gene.

[0099] The specific information of the three exogenous genes is as follows:

[0100] The first exogenous gene includes Thy1 promoter, hAPP 5'UTR, mutant hAPP CDS sequence, and mutant hAPPCDS sequence carrying Swedish mutation;

[0101] The second exogenous gene includes the Thy1 promoter, the mutant hPSEN1 CDS sequence, and the mutant hPSEN1 CDS sequence carrying the hPSEN1 M146V mutation;

[0102] The third exogenous gene includes a Thy1 promoter, a mutant hMAPT CDS sequence, and a mutant hMAPT CDS sequence carrying an hMAPT P243L mutation;

[0103] In order to stabilize the transcription and translation efficiency of hAPP, hPSEN1 and hMAPT, Kozak (GCCGCCACC) sequences were added to the N-termini of the three genes.

[0104] Among them, the three exogenous gene sequences are specifically as follows:

[0105]

[0106] The sequence of the first exogenous gene Thy1-hAPP transgenic fragment is shown in SEQ ID NO: 2 (italics are Thy1 promoter sequences, underlined are Kozak sequences, capital letters are 5'UTR sequences, bold is the hAPP CDS sequence with mutations, where bold and underlined are mutation site sequences, and the direction is 5'-3'): aattcagagaccgggaaccaaactagcctt taaaaaacataagtacaggagccagcaagatggctcagtgggtaaaggtgcctaccagcaagcctgacagcctgag ttcagtccccacgaactacgtggtaggagaggaccaaccaactctggaaatctgttctgcaaacacatgctcacac acacacacacaaatagtataaacaattttaaatttcatttaaaaataatttgtaaacaaaatcattagcacaggtt ttagaaagagcctcttggtgacatcaagttgatgctgtagatggggtatcattcctgaggacccaaaaccgggtct cagcctttccccattctgagagttctctcttttctcagccactagctgaagagtagagtggctcagcactgggctc ttgagttcccaagtcctacaactggtcagcctgactactaaccagccatgaagaaacaaggagtggatgggctgag tctgctgggatgggagtggagttagtaagtggccatggatgtaatgaccccagcaatgctggctagaaggcatgcc tcctttccttgtctggagacggaacgggagggatcatcttgtactcacagaagggagaacattctagctggttggg ccaaaatgtgcaagttcacctggaggtggtggtgcatgcttttaactccagtactcaggaggcagggccaggtgga tctctgtgagttcaagaccagcctgcactatggagagagttttgggacagccagagttacacagaaaaatcctggt ggaaaatctgaaagaaagagagaaagaaagaaagaaagaaaggaagaaagaaagaaagagtggcaggcaggcaggc aggaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaaataggtgcgacttcaagatccggagtt aaagcagaatgcactgtttccctaacagggccaagtgttttgagtaactgaaggtgggcatgatgcctgggaagc agaaaaagccaggcagatgcaccccttgccttgcttccgaagggctgcagtagcatggaaaacatggaaaaaac caatccattccctttgctgatataacaggctccaaagccaaaacctgtcactggaggctcaagagcagatctccag ccaagaggcaaaaggaatgggggaaggctggagggcctccctctggttatccaggcttctgaaggttcaagcaaaagaa agggttacaaccttaaaagggagagcgtcccggggtatgggtagaagaactgctccaccccgacccccagggtcccta accgtcttttccctgggcgagtcagcccaatcacaggactgagagtgcctctttagtagcagcaagccacttgga cacccaaatggaacacctccagtcagccctcgccgaccacccccaccccctccatcctttccctcagcctccgatt ggctgaatctagagtccctccctgctcccccctctctccccacccctggtgaaaactgcgggcttcagcgctgggt gcagcaactggaggcgttggcgcaccaggaggggctcagctaggggagtccaggtgagagcaggccgacgggag ggacccgcacatgcaaggaccgccgcagggcgaggatgcaagccttccccagctacagttttgggaaaggatacca gggcgctcctatatggggcgcgggaactgggggaaagaaggtgctcccaggtcgaggtgggagaggaaggcagtgc ggggtcacgggctttctccctgctaacggacgctttcgaagagtgggtgccggaggagaaccatgaggaaggacat caaggacagcctttggtccccaagctcaaatcgctttagtggtgcgaatagagggaggtgggtggcaaactgg agggagtccccagcgggtgacctcgtggctggctgggtgcggggcaccgcaggtaagaaaaccgcaatgttgcggg aggggactgggtggcaggcgcgggggaggggaaagctagaaaggatgcgagggagcggaggggggagggagcggga gaatctcaactggtagaggaagattaaaatgaggaaatagcatcagggtggggttagccaagccgggcctcaggga aagggcgcaaagtttgtctgggtgtgggcttaggtgggctgggtatgagattcggggcgccgaaaacactgctgcg cctctgccaaatcacgctacccctgtatctagttctgccaggcttctccagccccagccccaattcttttctctag tgttcccccttccctcccctgaatctcaagcccacactccctcctccataacccactgttatcaaatctaagtcat ttgccacccaacaaccatcaggaggcggaagcagacgggaggagtttgagatcaacttgggctacatcacgagttc caggctcaccaaggcttcttaaggagaccttgtctctaaaattaattaattaattaattaatagtcccctttctct gccacagaaccttgggatctggctcctggtcgcagctccccccaccccaggctgacattcactgccatagcccatc cggaaatcctagtctatttccccatggatcttgaactgcagagagaatggcagagtggcccgccctgtgcaaagga tgttcctagcctaggtggagctcgcgaactcgcagactgtgcctctcttgggcaaggacaggctagacagcctgcc ggtgtgttgagctagggcactgtggggaaggcagagaacctgtgcagggcagcaatgaacacaggaccagaaaact gcagccctaggaacactcaagagctggccatttgcaagcatctctggcctccgtgcttctcactcatgtcccatgt cttatacaggcctctgtggcacctcgcttgcctgatctcatccctagccgttaagctttctgcatgacttatcact tggggcataatgctggatacctaccattttcttagaccccatcaaaatcctatttgagtgtacggttcggagaacc tcatttatccggtaaatgtcttttactctgctctcagggagctgaggcaggacatcctgagatacattgggagagg agatacagtttcaataaaataataggttgggtggaggtacatgcctataatgccaccactcaggaaatggtggcag cttcgtgagtttgaggccaacccaagaaacatagtgaaaccctgtcagtaaataagtaagcaagtatttgagtatc tactatatgctagggctgacctggacattaggggtcatcttctgaacaaactagtgcttgagggaggtatttgggg tttttgtttgtttaatggatctgaatgagttccagagactggctacacagcgatatgactgagcttaacaccccta aagcatacagtcagaccaattagacaataaaaggtatgtatagcttaccaaataaaaaaattgtattttcaagaga gtgtctgtctgtgtagccctggctgttcttgaactcactctgtagaccaggctggcctggaaatccatctgcctgc ctctgcctctctgcctctctgcctctctgcctctctctctgcctctctctgcctctctctgcccctctctgcccct ctctgcccctctctgccgccctctgccttttgccctctgccctctgttctctggcctctgccctctgccctctggc ctctggcctctgcctctgcctcttgagtgctggaatcaaaggtgtgagctctgtaggtcttaagttccagaagaaa gtaatgaagtcacccagcagggaggtgctcagggacagcacagacacacacccaggacataggctcccacttcctt ggctttctctgagtggcaaaggaccttaggcagtgtcactcccttaagagaaggggataaaagagagggctgaggta ttcatcatgtgctccgtggatctcaagccctcaaggtaaatgggggacccacctgtcctaccagctggctgacctgt agctttccccaccacagaatccaagtcggaactcttggcacctagaggatc gccgccacca aatctg gatgcagaattccgacatgactcaggatatgaagttcatcatcaaaaattggtgttctttgcagaagatgtgggttcaaacaaaggtgcaatcattggactcatggtgggcggtgttgtcatagcgacagtgatcgtcatcaccttggtgatgctgaagaagaaacagtacacatccattcatcatggtgtggtggaggttgacgccgctgtcaccccagaggagcgccacctgtccaagatgcagcagaacggctacgaaaatccaacctacaagttctttgagcagatgcagaactag tcgaggtccttctctgcagaggtcttgcttctcccggtcagctgactccctccccaagtc cttcaaatatctcagaaacatggggagaaacggggaccttgtccctcctaaggaaccccagtgctgcatgccatcat cccccccaccctcgcccccacccccgccacttctccctccatgcataccactagctgtcattttgtactctgtatt tattccagggctgcttctgattatttagtttgttctttccctggagacctgttagaacataagggcgtatggtggg taggggaggcaggatatcagtccctggggcgagttcctccctgccaaccaagccagatgcctgaaagagatatgga tgagggaagttggactgtgcctgtacctggtacagtcatactctgttgaaagaatcatcgggggaggggggggggct caagaggggagagctctgctgagcctttgtggaccatccaatgaggatgagggcttagattctaccaggtcatct cagccaccacacacaagcgctctgccatcactgaagaagccccctagggctcttgggccagggcacactcagtaaa gatgcaggttcagtcagggaatgatgggggaaaggggtaggaggtgggggagggatcaccccctcctcaaaaaacg agcctgctgtctccaaaggcctctgcctgtagtgagggtggcagaagacaaggagccagaactctgactccag gatctaagtccgtgcaggaaggggatcctagaaccatctggttggacccagcttaccaagggagagcctttattct tctttcccttgcccctctgtgccagcccctcttgctgtccctgatcccccagacagcgagagtcttgcaacctgcc tcttccaagacctcctaatctcaggggcaggcggtggagtgagatccggcgtgcacactttttggaagatagcttt cccaaggatcctctcccccactggcagctctgcctgtcccatcaccatgtataataccaccactgctacagcatct caccgaggaaagaaaactgcacaataaaaccaagcctctggagtgtgtcctggtgtctgtctcttctgtgtcctgg cgtctgtctcttctgtgttcttccaaggtcagaaacaaaaaccacacacttcaacctggatggctcggctgagcac ttctgtgtgcagaaggtccaaccagactctggggtaccccggccctccctattcccttgcctcctgtctcccgctt tttatagctccctatgctgggcttctctggagagtgaaatctttgcccaaatcaatgcgcattctctctgctgagt catctggcgacagcagttgagttcacccgccaacacatgggcccagctatgtagccgaaccctggctctggaagtg ccagggactttgtgcataagtatgtaccatgcccttttttcacagtcctagctctgcagaagtgcagcctgaaggc ctgtctgctgagaggacatgccctggagccctgaaacaggcacagtgggaggaggaacggaggatgacaggcatca ggccctcagtccaaaagcaaccacttgagaatgggctggagtacgaaacatggggtcccgtccctggatccctcct caaagagtaataagtaaaatataaacaggtaccccaggccgttctgggtttgggttgtaatgggatccatttgcag agaactattgagacagcccagccgtactgtgacaggcaatgtgggggaggaggttgaatcacttggtatttagcat gaatagaataattccctgaacatttttcttaaacatccatatctaaattaccaccactcgctcccagtcttcctgc ctttgcgccagcctcctgtctggccatgcctgaagaaggctggagaagccacccacctcaggccatgacactgcca gccacttggcaggtgcagccaaacctgagctgtcccagaaagggacattctcaagacccaggcaccctgatcagca ctgacttggagctacaagtgtcatgccagaaaagtctctaagaaaaccttttcagggaaaagggggtgactcaaca ccgggcaagtttgggaagccccacccttcgagtgatggaagagcagataggaagcctcagaagagagacaccggca cccaggtaacgttcctcatgtggtctctgtcacactaggtgctcttccctggacatctccgtgaccacactctcag ttcttagggagatgcgggtgctctctgaggctatctcagagttgcagattctgaggcctagagtgactacagtcag cctaggaagccacagaggactgtggaccaggagggcagaagaggagaagggaagaaaaaccatcagataggacttg caatgaaactaacccaagacaatcataatgcagacaggaatgttaaaggcgttcagcagctggccatgacacccat ctgtccctctggccaagtcagcaagcctggaagacctgggactcctgcccatatgtcctaagctccccacccaccc actcgttcactgtccttattctctctctaccttcagccacttagtttcctaccttaagtcctagaattgatcctgg cgtaatagcgaagaggcccgcaccgat (SEQ ID NO:2)。

[0107]

[0108] The sequence of the second exogenous gene Thy1-hPSEN1 transgenic fragment is shown in SEQ ID NO: 4 (the italics are the Thy1 promoter sequence, the underline is the Kozak sequence, the bold is the hPSEN1 CDS sequence with mutations, wherein the bold and underlined are the mutation site sequences, and the direction is 5'-3'): aattcagagaccgggaaccaaactagcctttaaaaaacataagtac aggagccagcaagatggctcagtgggtaaaggtgcctaccagcaagcctgacagcctgagttcagtccccacgaac tacgtggtaggagaggaccaaccaactctggaaatctgttctgcaaacacatgctcacacacacacacacaaatag tataaacaattttaaatttcatttaaaaataatttgtaaacaaaatcattagcacaggttttagaaagagcctctt ggtgacatcaagttgatgctgtagatggggtatcattcctgaggacccaaaaccgggtctcagcctttccccattc tgagagttctctcttttctcagccactagctgaagagtagagtggctcagcactgggctcttgagttcccaagtcc tacaactggtcagcctgactactaaccagccatgaagaaacaaggagtggatgggctgagtctgctgggatgggag tggagttagtaagtggccatggatgtaatgaccccagcaatgctggctagaaggcatgcctcctttccttgtctgg agacggaacgggagggatcatcttgtactcacagaagggagaacattctagctggttgggccaaaatgtgcaagtt cacctggaggtggtggtgcatgcttttaactccagtactcaggaggcagggccaggtggatctctgtgagttcaag accagcctgcactatggagagagttttgggacagccagagttacacagaaaaatcctggtggaaaatctgaaagaa agagagaaagaaagaaagaaagaaaggaagaaagaaagaaagagtggcaggcaggcaggcaggaggaaggaaggaa ggaaggaaggaaggaaggaaggaaggaaggaaaataggtgcgacttcaagatccggagttacaagcagaatgcact gtttccctaacagggccaagtgttttgagtaactgaaggtgggcatgatgcctgggaagcagaaacaagccaggca gatgcaccccttgccttgcttccgaagggctgcagtagcatggaaaacatggaaaaacaaccaatccattccctttg ctgatataacaggctccaaagccaaaacctgtcactggaggctcaagagcagatctccagccaagaggcaaggaa tgggggaagctggagggcctccctctggttatccaggcttctgaaggttcaagcaaagaaagggttacaaccttaa aaggagagcgtcccggggtatgggtagaagaactgctccaccccgacccccagggtccctaaccgtcttttccctgg gcgagtcagcccaatcacaggactgagagtgcctctttagtagcagcaagccacttggcacccaaatggaacac ctccagtcagccctcgccgaccaccccacaccccctccatcctttccctcagcctccgattggctgaatctagagtc cctccctgctcccccctctctccccacccctggtgaaaactgcgggcttcagcgctgggtgcagcaactggaggcg ttggcgcaccaggaggggctcagctaggggagtccaggtgagagcaggccgacgggagggacccgcacatgcaa ggaccgccgcagggcgaggatgcaagccttccccagctacagttttgggaaaggataccagggcgctcctatatgg gggcgcgggaactgggggaaagaaggtgctcccaggtcgaggtgggagaggaaggcagtgcggggtcacgggctttc tccctgctaacggagcgctttcgaagagtgggtgccggaggagaaccatgaggaagcatcaaggacagcctttgg tccccaaagctcaaatcgctttagtggtgcgaatagagggaggaggtgggtggcaaactggagggagtccccagcgg gtgacctcgtggctggctgggtgcggggcaccgcaggtaagaaaaccgcaatgttgcgggaggggactgggtggca ggcgcgggggaggggaaagctagaaaggatgcgagggagcggaggggggagggagcgggagaatctcaactggtag aggaagattaaaatgaggaaatagcatcagggtggggttagccaagccgggcctcagggaaagggcgcaaagtttg tctgggtgtgggcttaggtgggctgggtatgagattcggggcgccgaaaacactgctgcgcctctgccaaatcacg ctacccctgtatctagttctgccaggcttctccagccccagccccaattcttttctctagtgttcccccttccctc ccctgaatctcaagcccacactccctcctccataacccactgttatcaaatctaagtcatttgccacccaacaacc atcaggaggcggaagcagacgggaggagtttgagatcaacttgggctacatcacgagttccaggctcaccaaggct tcttaaggagaccttgtctctaaaattaattaattaattaattaatagtcccctttctctgccacagaaccttggg atctggctcctggtcgcagctccccccaccccaggctgacattcactgccatagcccatccggaaatcctagtcta tttccccatggatcttgaactgcagagagaatggcagagtggcccgccctgtgcaaaggatgttcctagcctaggt ggagctcgcgaactcgcagactgtgcctctcttgggcaaggacaggctagacagcctgccggtgtgttgagctagg gcactgtggggaaggcagagaacctgtgcagggcagcaatgaacacaggaccagaaaactgcagccctaggaacac tcaagagctggccatttgcaagcatctctggcctccgtgcttctcactcatgtcccatgtcttatacaggcctctg tggcacctcgcttgcctgatctcatccctagccgttaagctttctgcatgacttatcacttggggcataatgctgg atacctaccattttcttagaccccatcaaaatcctatttgagtgtacggttcggagaacctcatttatccggtaaa tgtcttttactctgctctcagggagctgaggcaggacatcctgagatacattgggagaggagatacagtttcaata aaataataggttgggtggaggtacatgcctataatgccaccactcaggaaatggtggcagcttcgtgagtttgagg ccaacccaagaaacatagtgaaaccctgtcagtaaataagtaagcaagtatttgagtatctactatatgctagggc tgacctggacattaggggtcatcttctgaacaaactagtgcttgagggaggtatttggggtttttgtttgtttaat ggatctgaatgagttccagagactggctacacagcgatatgactgagcttaacacccctaaagcatacagtcagac caattagacaataaaaggtatgtatagcttaccaaataaaaaaattgtattttcaagagagtgtctgtctgtgtag ccctggctgttcttgaactcactctgtagaccaggctggcctggaaatccatctgcctgcctctgcctctctgcct ctctgcctctctgcctctctctctgcctctctctgcctctctctgcccctctctgcccctctctgcccctctctgc cgccctctgccttttgccctctgccctctgttctctggcctctgccctctgccctctggcctctggcctctgcctc tgcctcttgagtgctggaatcaaaggtgtgagctctgtaggtcttaagttccagaagaaagtaatgaagtcaccca gcagggaggtgctcagggacagcacagacacacacccaggacataggctcccacttccttggctttctctgagtgg caaaggaccttaggcagtgtcactccctaagagaaggggataaagagaggggctgaggtattcatcatgtgctccg tggatctcaagccctcaaggtaaatggggacccacctgtcctaccagctggctgacctgtagctttccccaccaca gaatccaagtcggaactcttggcacctagaggatc gccgccacc atgacagagttacctgcaccgttgtcctacttccagaatgcacagatgtctgaggacaaccacctgagcaatactgtacgtagccagaatgacaatagagaacggcaggagcacaacgacagacggagccttggccaccctgagccattatctaatggacgaccccagggtaactcccggcaggtggtggagcaagatgaggaagaagatgaggagctgacattgaaatatggcgccaagcatgtgatcatgctctttgtccctgtgactctctgcatggtggtggtc gtg tcgaggtccttcctctgcagaggtcttgcttctcccggtcagctgactccctccccaagtccttcaaatatc tcagaacatggggagaaacggggaccttgtccctcctaaggaaccccagtgctgcatgccatcatcccccccaccc tcgcccccacccccgccacttctccctccatgcataccactagctgtcattttgtactctgtatttattccagggc tgcttctgattatttagtttgttctttccctggagacctgttagaacataagggcgtatggtgggtaggggaggca ggatatcagtccctggggcgagttcctccctgccaaccaagccagatgcctgaaagagatatggatgagggaagtt ggactgtgcctgtacctggtacagtcatactctgttgaaagaatcatcggggaggggggggggctcaagaggggag agctctgctgagcctttgtggaccatccaatgaggatgagggcttagattctaccaggtcattctcagccaccaca cacaagcgctctgccatcactgaagaagccccctagggctcttgggccagggcacactcagtaaagatgcaggttc agtcagggaatgatggggaaaggggtaggaggtgggggagggatcaccccctcctctaaaacacgagcctgctgtc tccaaaggcctctgcctgtagtgagggtggcagaagaagacaaggagccagaactctgactccaggatctaagtcc gtgcaggaaggggatcctagaaccatctggttggacccagcttaccaagggagagcctttattcttctttcccttg cccctctgtgccagcccctcttgctgtccctgatcccccagacagcgagagtcttgcaacctgcctcttccaagac ctcctaatctcaggggcaggcggtggagtgagatccggcgtgcacactttttggaagatagctttcccaaggatcc tctccccactggcagctctgcctgtcccatcaccatgtataataccaccactgctacagcatctcaccgaggaaa gaaaactgcacaataaaaccaagcctctggagtgtgtcctggtgtctgtctcttctgtgtcctggcgtctgtctct tctgtgttcttccaaggtcagaaacaaaaaaccacacattcaacctggatggctcggctgagcacttctgtgtgca gaaggtccaaccagactctggggtaccccggccctccctattcccttgcctcctgtctcccgcttttttagctcc ctatgctggggcttctctggagagtgaaatctttgcccaaatcaatgcgcattctctctgctgagtcatctggcgac agcagttgagttcacccgccaacacatgggcccagctatgtagccgaaccctggctctggaagtgccagggacttt gtgcataagtatgtaccatgcccttttttcacagtcctagctctgcagaagtgcagcctgaaggcctgtctgctga gaggacatgccctggagccctgaaacaggcacagtgggaggaggaacggaggatgacaggcatcaggccctcagtc caaaagcaaccacttgagaatgggctggagtacgaaacatggggtcccgtccctggatccctcctcaaagagtaat aagtaaaatataaacaggtaccccaggccgttctgggtttgggttgtaatgggatccatttgcagagaactattga gacagcccagccgtactgtgacaggcaatgtgggggaggaggttgaatcacttggtatttagcatgaatagaataa ttccctgaacatttttcttaaacatccatatctaaattaccaccactcgctcccagtcttcctgcctttgcgccag cctcctgtctggccatgcctgaagaaggctggagaagccacccacctcaggccatgacactgccagccacttggca ggtgcagccaaacctgagctgtcccagaaagggacattctcaagacccaggcaccctgatcagcactgacttggag ctacaagtgtcatgccagaaaagtctctaagaaaaccttttcagggaaaagggggtgactcaacaccgggcaagtt tgggaagccccacccttcgagtgatggaagagcagataggaagcctcagaagagagacaccggcacccaggtaacg ttcctcatgtggtctctgtcacactaggtgctcttccctggacatctccgtgaccacactctcagttcttagggag atgcgggtgctctctgaggctatctcagagttgcagattctgaggcctagagtgactacagtcagcctaggaagcc acagaggactgtggaccaggagggcagaagaggagaagggaagaaaaaccatcagataggacttgcaatgaaacta acccaagacaatcataatgcagacaggaatgttaaaggcgttcagcagctggccatgacacccatctgtccctctg gccaagtcagcaagcctggaagacctgggactcctgcccatatgtcctaagctccccacccacccactcgttcact gtccttattctctctctaccttcagccacttagtttcctaccttaagtcctagaattgatcctggcgtaatagcga agaggcccgcaccgat (SEQ ID NO:4)。

[0109]

[0110] The sequence of the third exogenous gene Thy1-hMAPT transgenic fragment is shown in SEQ ID NO: 6 (italics are Thy1 promoter sequences, underlined are Kozak sequences, bold is hMAPT CDS sequence with mutations, bold and underlined are mutation site sequences, and the direction is 5'-3'): aattcagagaccgggaaccaaactagcctttaaaaaacataagtacag gagccagcaagatggctcagtgggtaaaggtgcctaccagcaagcctgacagcctgagttcagtccccacgaacta cgtggtaggagagccaaccaactctggaaatctgttctgcaaacacatgctcacacacacacacaaaatga taaaaaattttaaatttcatttaaaaaataatttgttaaaaaaaatcattagcacaggtttagaaagagcctcttgg tgacatcaagttgatgcttagtaggtgggtatcattcctgaggacccaaaaccgggtctcagcctttccccattctg agagttctctcttttctcagccactagctgaagagtagagtggctcagcactgggctcttgagttcccaagtccta caactggtcagcctgactactaaccagccatgaagaaaaaaggagtggatgggctgagtctgctgggatgggagtg gagttagtaagtggccatggatgtaatgaccccagcaatgctggctagaaggcatgcctcctttccttgtctggag acggaacgggagggatcatcttgtactcacagaagggagaacattctagctggttgggccaaaatgtgcaagttca cctggaggtggtggtgcatgcttttaactccagtactcaggaggcagggccaggtggatctctgtgagttcaagac cagcctgcactatggagagagttttgggacagccagagttacacagaaaaatcctggtggaaaatctgaagaaag agaaagaaagaaagaaagaaagaagaagaagaaggtggcaggcaggcaggcaggcaggagaaggaaggaaggaaggagg agagagagagagagagagaaggaaagagaaataggtgcgacttcaagatccggagttacaagcagaatgcactgt ttccctaacaggggccaagtgttttgagtaactgaaggtgggcatgatgcctgggaagcagaaacaagccaggcaga tgcaccccttgccttgcttccgaagggctgcagtagcatggaaaacatggaaaaacaaccaatccattccctttgct gatataacaggctccaaagccaaaacctgtcactggaggctcaagagcagatctccagccaagaggcaaaggaatg ggggaagctggagggcctccctctggttatccaggcttctgaaggttcaagcaaagaaagggttacaaccttaaaa ggagagcgtcccggggtatgggtagaagactgctccaccccgacccccagggtccctaaccgtcttttccctgggc gagtcagcccaatcacaggactgagagtgcctctttagtagcagcaagccacttcggacacccaaatggaacacct ccagtcagccctcgccgaccaccccaccccctccatccttttccctcagcctccgattggctgaatctagagtccc tccctgctcccccctctctccccacccctggtgaaaactgcgggcttcagcgctgggtgcagcaactggaggcgtt ggcgcaccaggaggaggctgcagctaggggagtccaggtgagagcaggccgacgggagggacccgcacatgcaagg accgccgcagggcgaggatgcaagccttccccagctacagttttgggaaaggataccagggcgctcctatatgggg gcgcgggaactggggaaagaaggtgctcccaggtcgaggtgggagaggaaggcagtgcggggtcacgggctttctc cctgctaacggacgctttcgaagagtgggtgccggaggagaaccatgaggaaggacatcaaggacagcctttggtc cccaagctcaaatcgctttagtggtgcgaatagagggaggaggtgggtggcaaactggagggagtccccagcgggt gacctcgtggctggctgggtgcggggcaccgcaggtaagaaaaccgcaatgttgcgggaggggactgggtggcagg cgcgggggaggggaaagctagaaaggatgcgagggagcggaggggggagggagcgggagaatctcaactggtagag gaagattaaaatgaggaaatagcatcagggtggggttagccaagccgggcctcagggaaagggcgcaaagtttgtc tgggtgtgggcttaggtgggctgggtatgagattcggggcgccgaaaacactgctgcgcctctgccaaatcacgct acccctgtatctagttctgccaggcttctccagccccagccccaattcttttctctagtgttcccccttccctccc ctgaatctcaagcccacactccctcctccataacccactgttatcaaatctaagtcatttgccacccaacaaccat caggaggcggaagcagacgggaggagtttgagatcaacttgggctacatcacgagttccaggctcaccaaggcttc ttaaggagaccttgtctctaaaattaattaattaattaattaatagtcccctttctctgccacagaaccttgggat ctggctcctggtcgcagctccccccaccccaggctgacattcactgccatagcccatccggaaatcctagtctatt tccccatggatcttgaactgcagagagaatggcagagtggcccgccctgtgcaaaggatgttcctagcctaggtgg agctcgcgaactcgcagactgtgcctctcttgggcaaggacaggctagacagcctgccggtgtgttgagctagggc actgtggggaaggcagagaacctgtgcagggcagcaatgaacacaggaccagaaaactgcagccctaggaacactc aagagctggccatttgcaagcatctctggcctccgtgcttctcactcatgtcccatgtcttatacaggcctctgtg gcacctcgcttgcctgatctcatccctagccgttaagctttctgcatgacttatcacttggggcataatgctggat acctaccattttcttagaccccatcaaaatcctatttgagtgtacggttcggagaacctcatttatccggtaaatg tcttttactctgctctcagggagctgaggcaggacatcctgagatacattgggagaggagatacagtttcaataaa ataataggttgggtggaggtacatgcctataatgccaccactcaggaaatggtggcagcttcgtgagtttgaggcc aacccaagaaacatagtgaaaccctgtcagtaaataagtaagcaagtatttgagtatctactatatgctagggctg acctggacattaggggtcatcttctgaacaaactagtgcttgagggaggtatttggggtttttgtttgtttaatgg atctgaatgagttccagagactggctacacagcgatatgactgagcttaacacccctaaagcatacagtcagacca attagacaataaaaggtatgtatagcttaccaaataaaaaaattgtattttcaagagagtgtctgtctgtgtagcc ctggctgttcttgaactcactctgtagaccaggctggcctggaaatccatctgcctgcctctgcctctctgcctct ctgcctctctgcctctctctctgcctctctctgcctctctctgcccctctctgcccctctctgcccctctctgccg ccctctgccttttgccctctgccctctgttctctggcctctgccctctgccctctggcctctggcctctgcctctg cctcttgagtgctggaatcaaaggtgtgagctctgtaggtcttaagttccagaagaaagtaatgaagtcacccagc agggaggtgctcagggacagcacagacacacacccaggacataggctcccacttccttggctttctctgagtggca aaggaccttaggcagtgtcactccctaagagaaggggataaagagaggggctgaggtattcatcatgtgctccgtg gatctcaagccctcaaggtaaatggggacccacctgtcctaccagctggctgacctgtagctttccccaccacaga atccaagtcggaactcttggcacctagaggatc gccgccaccatggctgagccccgccaggagttcgaagtgatggaagatcacgctgggacgtacgggttgggggacaggaaagatcaggggggctacaccatgcaccaagaccaagagggtgacacggacgctggcctgaaagctgaagaagcaggcattggagacacccccagcctggaagacgaagctgctggtcacgtgacccaagctcgcatggtcagtaaaagcaaagacgggactggaagcgatgacaaaaaagccaagggggctgatggtaaaacgaagatcgccacaccgcggggagcagcccctccaggccagaagggccaggccaacgccaccaggattccagcaaaaaccccgcccgctccaaagacaccacccagctctggtgaacctccaaaatcaggggatcgcagcggctacagcagccccggctccccaggcactcccggcagccgctcccgcaccccgtcccttccaaccccacccacccgggagcccaagaaggtggcagtggtccgtactccacccaagtcgccgtcttccgccaagagccgcctgcagacagcccccgtgcccatgccagacctgaagaatgtcaagtccaagatcggctccactgagaacctgaagcaccagccgggaggcgggaaggtgcagataattaataagaagctggatcttagcaacgtccagtccaagtgtggctcaaaggataatatcaaacacgtc ctgggaggcggcagtgtgcaaatagtctacaaaccagttgacctgagcaaggtgacctccaagtgtggctcattaggcaacatccatcataaaccaggaggtggccag gtggaagtaaaatctgagaagcttgacttcaaggacagagtccagtcgaagatgggtccctggacaatatcacccacgtccctggcggaggaaataaaaagattg aaacccacaagctgaccttccgcgagaacgccaaagccaagacagaccacggggcggagatcgtgtacaagtcgccagtggtgtctggggacacgtctccacggca tctcagcaatgtctcctccaccggcagcatcgacatggtagactcgccccagctcgccacgctagctgacgaggtgtctgcctccctggccaagcagggtttgtga tcgaggtccttcctctgcagag gtcttgcttctcccggtcagctgactccctccccaagtccttcaaatatctcagaacatggggagaaacggggacc ttgtccctcctaaggaccccagtgctgcatgccatcatcccccccaccctcgccccccaccccccgccacttctcccc tccatgcataccactagctgtcattttgtactctgtatttattccagggctgcttctgattatttagttttgttctt tccctggagacctgttagaacataaggggcgtatggtggggtaggggaggcaggatatcagtccctggggcgagttcc tccctgccaaccaagccagatgcctgaaagagatatggatgaggagttggactgtgcctgtacctggtacagtc atactctgttgaaagaatcatcggggaggggggggggctcaagaggggagagctctgctgagcctttgtggaccat ccaatgaggatgagggcttagttctaccaggtcattctcagccaccacacacaagcgctctgccatcactgaaga agccccctagggctcttggggccagggcacactcagtaaagatgcaggttcagtcagggaatgatggggaaaggggt aggaggtggggggagggatcaccccctcctctaaaacacgagcctgctgtctccaaaggcctctgcctgtagtgagg gtggcagaagaagacaaggagccagaactctgactccaggatctaagtccgtgcaggaaggggatcctagaaccat ctggttggacccagcttaccaagggagagcctttattcttctttcccttgcccctctgtgccagcccctcttgctg tccctgatccccccagacagcgagagtcttgcaacctgcctcttccaagacctcctaatctcaggggcaggcggtgg agtgagatccggcgtgcacactttttggaagatagctttcccaaggatcctctcccccactggcagctctgcctgt cccatcaccatgtataataccaccactgctacagcatctcaccgaggaaagaaaactgcacaataaaaccaagcct ctggagtgtgtcctggtgtctgtctcttctgtgtcctggcgtctgtctcttctgtgttcttccaaggtcagaaaca aaaaccacacacttcaacctggatggctcggctgagcacttctgtgtgcagaaggtccaaccagactctggggtac cccggccctccctattcccttgcctcctgtctcccgctttttatagctccctatgctgggcttctctggagagtga aatctttgcccaaatcaatgcgcattctctctgctgagtcatctggcgacagcagttgagttcacccgccaacaca tgggcccagctatgtagccgaaccctggctctggaagtgccagggactttgtgcataagtatgtaccatgcccttt tttcacagtcctagctctgcagaagtgcagcctgaaggcctgtctgctgagaggacatgccctggagccctgaaac aggcacagtgggaggaggaacggaggatgacaggcatcaggccctcagtccaaaagcaaccacttgagaatgggct ggagtacgaaacatggggtcccgtccctggatccctcctcaaagagtaataagtaaaatataaacaggtaccccag gccgttctgggtttgggttgtaatgggatccatttgcagagaactattgagacagcccagccgtactgtgacaggc aatgtgggggaggaggttgaatcacttggtatttagcatgaatagaataattccctgaacatttttcttaaacatc catatctaaattaccaccactcgctcccagtcttcctgcctttgcgccagcctcctgtctggccatgcctgaagaa ggctggagaagccacccacctcaggccatgacactgccagccacttggcaggtgcagccaaacctgagctgtccca gaaagggacattctcaagacccaggcaccctgatcagcactgacttggagctacaagtgtcatgccagaaaagtct ctaagaaaaccttttcagggaaaagggggtgactcaacaccgggcaagtttgggaagccccacccttcgagtgatg gaagagcagataggaagcctcagaagagagacaccggcacccaggtaacgttcctcatgtggtctctgtcacacta ggtgctcttccctggacatctccgtgaccacactctcagttcttagggagatgcgggtgctctctgaggctatctc agagttgcagattctgaggcctagagtgactacagtcagcctaggaagccacagaggactgtggaccaggagggca gaagaggagaagggaagaaaaaccatcagataggacttgcaatgaaactaacccaagacaatcataatgcagacag gaatgttaaaggcgttcagcagctggccatgacacccatctgtccctctggccaagtcagcaagcctggaagacct gggactcctgcccatatgtcctaagctccccacccacccactcgttcactgtccttattctctctctaccttcagc cacttagtttcctaccttaagtcctagaattgatcctggcgtaatagcgaagaggcccgcaccgat (SEQ ID NO:6).

[0111] (2) The three transgenic fragments were microinjected into mouse fertilized eggs and randomly inserted into the mouse genome;

[0112] (3) The fertilized eggs were transplanted into pseudo-pregnant female mice, and F0 mice with positive results for all three exogenous genes were obtained through screening and identification;

[0113] The primer pairs used for PCR identification are as follows:

[0114] Primer pairs for identifying the first exogenous gene hAPP: Primer pair 1: AAGTAATGAAGTCACCCAGCAGG (SEQ ID NO: 7) and CGTTTCTCCCCATGTTCTGAGA (SEQ ID NO: 8); Primer pair 2: GGGTTGACAAATATCAAGACGGAG (SEQ ID NO: 9) and CGTTTCTCCCCATGTTCTGAGA (SEQ ID NO: 8);

[0115] Primer pairs for identifying the second exogenous gene hPSEN1: Primer pair 1: AAGTAATGAAGTCACCCAGCAGG (SEQ ID NO: 10) and CGTACAGTATTGCTCAGGTGGTTG (SEQ ID NO: 11); Primer pair 2: AGGAACTTTCCAGCAGTATCCTC (SEQ ID NO: 12) and CGTTTCTCCCCATGTTCTGAGA (SEQ ID NO: 13);

[0116] Primer pairs for identifying the third exogenous gene hMAPT: Primer pair 1: AAGTAATGAAGTCACCCAGCAGG (SEQ ID NO: 14) and TGCCTGCTTCTTCAGCTTTCAG (SEQ ID NO: 15); Primer pair 2: CAAGTGTGGCTCATTAGGCAAC (SEQ ID NO: 16) and CGTTTCTCCCCATGTTCTGAGA (SEQ ID NO: 17);

[0117] Primer pair for the internal reference gene: GTGCTGCTCACGCTGACCTTTAG (SEQ ID NO: 18) and CAGAGTGGAATACTGTTGCACC (SEQ ID NO: 19).

[0118] (4) Backcrossing F0 mice with wild type (WT) mice until F0N5 mice are obtained; and the Alzheimer's disease mouse model 3-FAD homozygous positive mice are obtained by self-crossing the F0N5 mice.

[0119] Example 2 Detection of blood biomarkers

[0120] The automated ultrasensitive immunoassay-single molecule array detection method was used to detect the early clinical blood test indicators of Alzheimer's disease in mouse plasma. The subjects included three 1-month-old 3-FAD (1M) mice, three 2-month-old 3-FAD (2M) mice and three 6-month-old C57BL / 6J control mice (WT) as the control group. The experimental results are as follows Figure 1 As shown. Among them, Figure 1 (a), (b), and (c) represent the blood (plasma) test results of Aβ42 / 40, p-Tau181, and p-Tau217, respectively (unit: pg / mL).

[0121] from Figure 1 It can be seen that, first of all, three biomarkers, Aβ42 / 40, p-Tau181 and p-Tau217, were detected simultaneously in the blood of 1M 3-FAD mice. However, there is no model on the market that can detect these three biomarkers from the blood at the same time, let alone detect them at 1 month of age.

[0122] Secondly, the Aβ42 / 40 ratio was upregulated. Specifically, compared with the control group, no Aβ42 was detected. Aβ42 appeared in 3-FAD mice at 1 month of age. Over time, the Aβ42 / 40 ratio increased at 2 months of age, but did not show a significant upward trend with the progression of the disease. This performance is consistent with the clinical course of Alzheimer's disease.

[0123] Finally, the concentrations of p-Tau181 and p-Tau217 gradually increased over time, which is consistent with the detection indicators in clinical patients.

[0124] Therefore, it can be concluded that 3-FAD mice can successfully detect Aβ42 / 40, p-Tau181, and p-Tau217 in the plasma at the same time, and the disease indicators presented are consistent with the standards of early clinical blood detection.

[0125] Example 3 Pathological brain region detection

[0126] The hallmark neuropathological changes of Alzheimer's disease are diffuse neuritic plaques, which are marked by extracellular amyloid beta deposition (Aβ deposition) and neurofibrillary tangles (formed by intracellular aggregation of hyperphosphorylated Tau protein). Among them, Aβ aggregation will occur throughout the development of Alzheimer's disease.

[0127] Detection steps: 6 3-FAD mice were taken and euthanized at 2 months of age. Then the brain was perfused and fixed and embedded. The expression of Aβ plaques was detected by immunohistochemical staining to obtain immunohistochemical (IHC) results. The same method was used to treat 2-month-old C57BL / 6J2 mice in the control group (WT) and 4-month-old and 6-month-old 3-FAD mice to obtain IHC results.

[0128] From the results, we can see that: on the one hand, Figure 2 As shown in the figure, compared with the control group, there was no Aβ deposition in the cortex (Ctx) and subiculum (Sub) of 2-month-old 3-FAD mice, and Aβ was detected in a speckled state. Figure 3 As shown, in 1-month-old 3-FAD mice, Aβ deposition was not apparent, but in the brains of 2-month-old 3-FAD mice, Aβ deposition was manifested. Combined with the aforementioned detection of Aβ42 in the blood of 1-month-old 3-FAD mice, this situation is consistent with the actual clinical manifestations. In addition, as the disease progresses, Aβ deposition in the cortex and subiculum of 3-FAD mice aggregates and plaques until Aβ plaques are deposited at 6 months of age; while the control group, which is also 6 months old, did not show Aβ deposition. This shows that the pathological manifestation of the gradual deposition and expression of Aβ plaques in 3-FAD mice is consistent with the clinical manifestations of Alzheimer's disease.

[0129] On the other hand, various hyperphosphorylated Tau proteins were detected in 3-FAD mice at different ages. Figure 4 As shown, p-Tau 181 was detected in the cortex (Ctx), hippocampus (Hip), and cerebellum (Cere) of 1-month-old 3-FAD mice; Figure 5 As shown, p-Tau 217 was detected in the cortex (Ctx), hippocampus (Hip), and cerebellum (Cere) of 2-month-old 3-FAD mice; Figure 6 As shown, p-Tau (Thr231) was also detected in 2-month-old 3-FAD mice; Figure 7 As shown, p-Tau (Ser202, Thr205) was detected in the cortex (Ctx), hippocampus (Hip), and cerebellum (Cere) of 3-FAD (3M) mice at 3 months of age; Figure 8 As shown in Figure 2, p-Tau (Ser396) was detected in the cortex (Ctx), hippocampus (Hip), and cerebellum (Cere) of 3-FAD mice at 3 months of age. Figure 9 As shown in Figure 2, phosphorylation of p-Tau181 intensified over time and gradually formed a tangled morphology; Figure 10As shown, p-Tau (Ser202, Thr205) appears after Aβ deposition is detected and increases with the progression of the disease.

[0130] Therefore, according to Figures 2 - 10 , it can be concluded that in the brain area of ​​3-FAD mice, p-Tau181, p-Tau217, p-Tau (Thr231), p-Tau (Ser202, Thr205) and p-Tau (Ser396) appear in chronological order, and in the brain of 3-FAD mice, p-Tau181 appears before Aβ deposition, p-Tau (Ser202, Thr205) appears after Aβ deposition, and it intensifies with the progression of the disease. This pathological process or stage of development is consistent with the situation of clinical patients, and has the prospect of being used to study the pathological mechanism of Alzheimer's disease and to screen drugs for the treatment of Alzheimer's disease.

[0131] Example 4 Behavioral Verification

[0132] The loss of visual-spatial memory is a typical behavioral characteristic in the course of Alzheimer's disease. The Morris water maze test is an experimental method widely used in the field of neuroscience. Its main function is to evaluate the spatial learning, memory ability and sense of direction of experimental animals. This experiment is based on the instinctive reaction of animals to escape from the water environment. That is, by observing the time and path required for animals to find a platform hidden under the water in the water maze, their spatial memory ability is evaluated.

[0133] The Morris water maze test was performed on 3-month-old 3-FAD mice, and 3-month-old C57BL / 6J mice were used as the control group (WT). Figure 11 In the circular pool shown in (a), the pool is divided into four quadrants (Q1, Q2, Q3 and Q4), and the water temperature of the pool is maintained at 23±1℃. On the first day, an invisible fixed platform (10 cm in diameter) was placed in Q2 about 1 cm above the water surface, and two visualization trainings were performed. From the 2nd to the 5th day, the invisible fixed platform was placed in Q2 1 cm below the water surface, and four trainings were performed every day. On the 6th day, the platform was removed from the maze and the mice were allowed to swim freely for 60 seconds. The time and distance that each mouse crossed the effective area (platform) and the time and distance explored in the target quadrant (the quadrant where the platform is located), as well as the number of entries, were monitored and recorded.

[0134] The results are as follows Figure 11As shown in (b) and (c), compared with the control group, the 3-FAD mice had no significant difference in swimming distance (unit: m) or swimming speed (unit: mm / s), indicating that the 3-FAD mice of 3M were consistent with the control group in terms of mobility, that is, the motor function (Normal locomotor function) was not impaired. Figure 11 As shown in (d) and (e), the number of times the 3-FAD mice entered the second quadrant where the platform was located and the time they stayed there were significantly shorter than those in the control group, and the number of times they entered was significantly reduced. Combined with the fact that their motor function was not impaired, this indicates that the 3-FAD mice failed to remember the location of the platform, that is, their memory ability was reduced. At the same time, compared with the control group, the time it took for the 3-FAD mice to enter the pool and reach the platform was significantly longer than that of the control group, as shown in Figure 2. Figure 11 As shown in (f), the number of shuttling around the platform was significantly less than that of the control group. Figure 11 As shown in (g), combined with the fact that their motor function was not impaired, it also shows that the memory ability of 3-FAD mice was impaired.

[0135] Therefore, it can be concluded that the locomotor function of 3-FAD mice at 3 months old was not impaired, but they showed a phenotype of decreased spatial memory ability consistent with clinical symptoms. And compared with the pathological manifestations of Aβ deposition starting at 2 months old, the behavioral manifestations started at 3 months old, which is consistent with the clinical progression of Alzheimer's disease.

[0136] In summary, 3-FAD mice can effectively simulate the mouse model of human Alzheimer's disease patients from clinical diagnostic markers, pathology to behavioral changes, which is of great significance for in-depth exploration of the pathogenesis of Alzheimer's disease, discovery of new therapeutic targets and promotion of drug development.

[0137] Example 5 Drug Screening Using the 3-FAD Mouse Model

[0138] The drug Lecanemab was used to treat 3-FAD mice. Specifically, 4 1-month-old 3-FAD mice were intraperitoneally injected with 12 mpk / mouse each time, once a week, for 4 consecutive weeks, which was recorded as the experimental group (3-FAD+Lecanemab). At the same time, two control groups were set up. Control group one consisted of 3 6-month-old C57BL / 6J mice (WT) that were not given the drug, and control group two consisted of 4 3-FAD mice that were not given the drug (3-FAD). The levels of p-Tau181 and p-Tau217 in the blood of mice were detected 4 weeks later. The results are as follows: Figure 12 As shown, (a) and (b) represent the detection results of p-Tau181 and p-Tau217 in blood respectively.Figure 12 It can be seen that under the same condition of no drug administration, the levels of p-Tau181 and p-Tau217 in the blood of 3-FAD mice were significantly increased compared with those of C57BL / 6J mice, but the levels of p-Tau181 and p-Tau217 in 3-FAD mice after drug administration (3-FAD+Lecanemab) were lower than those of 3-FAD mice without drug administration (3-FAD), which is consistent with the trend of clinical AD patients; and compared with p-Tau181, the downward trend of p-Tau217 was more obvious, which is also consistent with the test results of clinical patients treated with Lecanemab.

[0139] The present application also tested brain slices of the control group and the experimental group after 4 weeks of administration, and obtained the following Figure 13 The IHC results shown show that compared with C57BL / 6J mice, there was obvious Aβ deposition in the untreated 3-FAD mice (3-FAD), while the Aβ deposition in the treated 3-FAD mice (3-FAD+Lecanemab) slowed down and the plaque area became smaller, which is consistent with the test results of clinical patients treated with Lecanemab, indicating that the 3-FAD mice of the present application can be used for drug screening for Alzheimer's disease.

[0140] The basic concepts have been described above. Obviously, for those skilled in the art, the above detailed disclosure is only for example and does not constitute a limitation of this specification. Although not explicitly stated here, those skilled in the art may make various modifications, improvements and corrections to this specification. Such modifications, improvements and corrections are suggested in this specification, so such modifications, improvements and corrections still belong to the spirit and scope of the exemplary embodiments of this specification.

[0141] At the same time, this specification uses specific words to describe the embodiments of this specification. For example, "one embodiment", "an embodiment", and / or "some embodiments" refer to a certain feature, structure or characteristic related to at least one embodiment of this specification. Therefore, it should be emphasized and noted that "one embodiment" or "an embodiment" or "an alternative embodiment" mentioned twice or more in different positions in this specification does not necessarily refer to the same embodiment. In addition, certain features, structures or characteristics in one or more embodiments of this specification can be appropriately combined.

[0142] Similarly, it should be noted that in order to simplify the description disclosed in this specification and thus help understand one or more embodiments of the invention, in the above description of the embodiments of this specification, multiple features are sometimes combined into one embodiment, figure or description thereof. However, this disclosure method does not mean that the features required by the subject matter of this specification are more than the features mentioned in the claims. In fact, the features of the embodiments are less than all the features of the single embodiment disclosed above.

[0143] In some embodiments, numbers describing the number of components and attributes are used. It should be understood that such numbers used in the description of the embodiments are modified by the modifiers "about", "approximately" or "substantially" in some examples. Unless otherwise specified, "about", "approximately" or "substantially" indicate that the numbers are allowed to vary by ±20%. Accordingly, in some embodiments, the numerical parameters used in the specification and claims are approximate values, which may change according to the required features of individual embodiments. In some embodiments, the numerical parameters should take into account the specified significant digits and adopt the general method of retaining the digits. Although the numerical domains and parameters used to confirm the breadth of the range in some embodiments of this specification are approximate values, in specific embodiments, the setting of such numerical values ​​is as accurate as possible within the feasible range.

[0144] Each patent, patent application, patent application publication, and other materials, such as articles, books, specifications, publications, documents, etc., cited in this specification is hereby incorporated by reference in its entirety. Except for application history documents that are inconsistent with or conflicting with the contents of this specification, documents that limit the broadest scope of the claims of this specification (currently or later attached to this specification) are also excluded. It should be noted that if the descriptions, definitions, and / or use of terms in the materials attached to this specification are inconsistent or conflicting with the contents described in this specification, the descriptions, definitions, and / or use of terms in this specification shall prevail.

[0145] Finally, it should be understood that the embodiments described in this specification are only used to illustrate the principles of the embodiments of this specification. Other variations may also fall within the scope of this specification. Therefore, as an example and not a limitation, alternative configurations of the embodiments of this specification may be considered consistent with the teachings of this specification. Accordingly, the embodiments of this specification are not limited to the embodiments explicitly introduced and described in this specification.

Claims

1. Use of a triple-mutant Alzheimer's disease mouse model in studying the pathological mechanism of Alzheimer's disease or screening drugs for treating Alzheimer's disease, characterized in that: The genome of the mouse model includes a transgenic segment of a first exogenous gene hAPP, a transgenic segment of a second exogenous gene hPSEN1, and a transgenic segment of a third exogenous gene hMAPT; Among them, the transgenic fragment of the first exogenous gene hAPP carries the Swedish mutation; the transgenic fragment of the second exogenous gene hPSEN1 carries the hPSEN1 M146V mutation; the transgenic fragment of the third exogenous gene hMAPT carries the hMAPT P243L mutation; The CDS sequence of the transgenic fragment of the first exogenous gene hAPP is shown in SEQ ID NO: 1, the CDS sequence of the transgenic fragment of the second exogenous gene hPSEN1 is shown in SEQ ID NO: 3, and the CDS sequence of the transgenic fragment of the third exogenous gene hMAPT is shown in SEQ ID NO: 5; The transgenic fragment of the first exogenous gene hAPP, the transgenic fragment of the second exogenous gene hPSEN1 and the transgenic fragment of the third exogenous gene hMAPT are inserted into the genome of a mouse fertilized egg; the fertilized egg is transplanted into a pseudo-pregnant female mouse, and F0 generation mice in which all three exogenous genes are positive are screened and obtained; the F0 generation mice are backcrossed with wild mice until F0N5 generation mice are obtained; and the Alzheimer's disease mouse model 3-FAD homozygous positive mice are obtained by selfing the F0N5 generation mice.

2. A method for constructing a triple-mutant Alzheimer's disease mouse model, the method comprising: (1) preparing a transgenic fragment of the first exogenous gene hAPP, a transgenic fragment of the second exogenous gene hPSEN1, and a transgenic fragment of the third exogenous gene hMAPT; (2) inserting the three transgenic fragments into the genome of mouse fertilized eggs; (3) transplanting the fertilized eggs into pseudo-pregnant female mice, and screening to obtain F0 generation mice in which all three exogenous genes were positive; (4) Based on the F0 generation mice, obtaining 3-FAD homozygous positive mice of the Alzheimer's disease mouse model; Among them, the transgenic fragment of the first exogenous gene hAPP carries the Swedish mutation; the transgenic fragment of the second exogenous gene hPSEN1 carries the hPSEN1 M146V mutation; the transgenic fragment of the third exogenous gene hMAPT carries the hMAPT P243L mutation; The CDS sequence of the transgenic fragment of the first exogenous gene hAPP is shown in SEQ ID NO: 1, the CDS sequence of the transgenic fragment of the second exogenous gene hPSEN1 is shown in SEQ ID NO: 3, and the CDS sequence of the transgenic fragment of the third exogenous gene hMAPT is shown in SEQ ID NO: 5; The step (4) comprises backcrossing the F0 generation mice with wild mice until F0N5 generation mice are obtained; and self-crossing the F0N5 generation mice to obtain the Alzheimer's disease mouse model 3-FAD homozygous positive mice.

3. The construction method according to claim 2, characterized in that: The step (1) of preparing the transgenic fragment comprises: a. Obtaining PCR products of the Thy1 promoter and the first exogenous gene hAPP, the second exogenous gene hPSEN1 and the third exogenous gene hMAPT; b. connecting the Thy1 promoter to the PCR products of the first exogenous gene hAPP, the second exogenous gene hPSEN1 and the third exogenous gene hMAPT and the backbone vector to form a recombinant vector, and transforming the recombinant vector into competent cells; c. After transformation, PCR identification and sequencing are performed, and the clones with correct sequencing are selected as transgenic vectors; d. preparing the transgenic fragment based on the transgenic vector.

4. The construction method according to claim 2, characterized in that: Step (2) includes: The transgenic fragment is microinjected into the fertilized egg of the mouse and randomly inserted into the genome of the fertilized egg of the mouse.

5. The construction method according to claim 2, characterized in that: The identification in step (3) is performed by PCR reaction, and the primer pairs used in the PCR reaction are shown as SEQ ID NO:7, SEQ ID NO:8 and SEQ ID NO:9; SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12 and SEQ ID NO:13; SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16 and SEQ ID NO:17, respectively.

Images