EPSPS enzyme mutant, nucleic acid molecule, expression cassette, expression vector, recombinant bacteria or recombinant cell and application thereof

Abstract

The present invention discloses an EPSPS enzyme mutant, a nucleic acid molecule, an expression cassette, an expression vector, a recombinant bacterium or a recombinant cell and an application thereof, and relates to the technical field of plant genetic engineering. The EPSPS enzyme mutant provided by the present invention can effectively solve the problem of non-selective damage to crops by herbicides such as glyphosate, and provides a new way to cultivate glyphosate-resistant crop varieties. At the same time, the EPSPS enzyme mutant provided by the present invention also has high practicality and promotion value, can improve the weeding effect in agricultural production, reduce the cost of weeding, and promote the increase of crop yield. In addition, the present invention also provides an expression cassette for expressing the EPSPS enzyme mutant, which contains an EPSPS mutant gene that confers glyphosate resistance to various plants such as soybeans and rice.

Description

Technical Field

[0001] The present invention relates to the technical field of plant genetic engineering, and in particular to an EPSPS enzyme mutant, a nucleic acid molecule, an expression cassette, an expression vector, a recombinant bacterium or a recombinant cell and applications thereof. Background Art

[0002] Glyphosate is a herbicide that targets 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) in plant chloroplasts. EPSPS is an enzyme involved in the biosynthesis pathway of shikimic acid and is involved in the synthesis of aromatic amino acids. The herbicide mechanism of glyphosate is as follows: glyphosate mainly achieves the weed control goal by interfering with the shikimic acid synthesis pathway of plants. Its mechanism of action is mainly to competitively inhibit the activity of EPSPS in the shikimic acid pathway, so that the affected plants cannot continuously synthesize essential amino acids, thereby affecting the normal growth of the plants and even death. However, as a non-selective herbicide, glyphosate also indiscriminately harms crops while efficiently killing weeds. Therefore, cultivating and planting glyphosate-resistant crop varieties can not only reduce the burden of manual weeding, but also increase crop yields, which is conducive to mechanized crop production.

[0003] The most commonly used glyphosate-resistant CP4 gene on the market is a gene with strong glyphosate resistance isolated from Agrobacterium by Monsanto. Crops that have acquired glyphosate-resistant traits by introducing CP4 genes through transgenic technology have been widely used, and corn and soybean varieties containing CP4 genes have been widely promoted in the past 20 years. However, transgenic crops cannot be widely used due to various reasons. Therefore, discovering new glyphosate-resistant genes from plants and using them in plants has great economic and commercial value.

[0004] In view of this, the present invention is proposed. Summary of the invention

[0005] The object of the present invention is to provide an EPSPS enzyme mutant, a nucleic acid molecule, an expression cassette, an expression vector, a recombinant bacterium or a recombinant cell and its application to make plants resistant to glyphosate without affecting the original function of the biological enzyme itself. The inventors have also developed the application of these mutant proteins, encoding genes, expression cassettes and expression vectors in transgenic, gene editing or other plant breeding, which can be used to cultivate plants with glyphosate herbicide resistance, especially crops.

[0006] The present invention is achieved in that:

[0007] In a first aspect, the present invention provides an EPSPS enzyme mutant having glyphosate resistance, which is shown in (1) or (2) below:

[0008] (1): It is obtained by mutation of the 131st, 172nd, 177th, 274th, 313th and 403rd amino acids of the wild-type EPSPS enzyme from rice; the amino acid sequence of the wild-type EPSPS enzyme is shown in SEQ ID NO.2;

[0009] The amino acids at positions 131, 172, 177, 274, 313 and 403 of the EPSPS enzyme mutant are G, A, S, R, E and A, respectively, and the amino acid sequence thereof is shown in SEQ ID NO.4;

[0010] (2): It has at least 70% identity with the EPSPS enzyme mutant shown in (1), is identical to the EPSPS enzyme mutant shown in (1) at amino acids 131, 172, 177, 274, 313 and 403, and has glyphosate resistance.

[0011] For example, it has at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity with the EPSPS enzyme mutant shown in (1).

[0012] The inventors found that by mutating the above-mentioned position of the wild-type rice EPSPS enzyme to the corresponding amino acid, a glyphosate-resistant EPSPS enzyme can be obtained. After the EPSPS enzyme is transformed into a plant, the plant can express the EPSPS enzyme mutant and have glyphosate resistance. The EPSPS enzyme mutant provided by the present invention can effectively solve the problem of non-selective damage to crops by herbicides such as glyphosate, and provides a new way to cultivate glyphosate-resistant crop varieties. At the same time, the EPSPS enzyme mutant provided by the present invention also has high practicality and promotion value, can be used for glyphosate-resistant crop breeding of various crops such as rice and soybeans, can improve the weeding effect in agricultural production, reduce the weeding cost, and promote the increase of crop yield.

[0013] The expression of the EPSPS enzyme mutant in soybean can confer tolerance to herbicides that inhibit EPSPS enzymes, especially herbicides of the phosphonomethylglycine family, including but not limited to glyphosate.

[0014] As defined herein, "glyphosate" includes any herbicidally effective form of N-phosphonomethylglycine (including any salts thereof), other forms that result in production of the glyphosate anion in plants, and any other herbicides in the phosphonomethylglycine family.

[0015] The EPSPS enzyme in the present invention refers to 5-enolpyruvylshikimate-3-phosphate synthase.

[0016] After transformation with the EPSPS mutation, the plant (such as rice or soybean) has higher glyphosate tolerance than the same plant transformed with the glyphosate-resistant gene CP4-EPSPS gene and GOX gene. GOX refers to the glyphosate oxidoreductase gene.

[0017] In a second aspect, the present invention provides a nucleic acid molecule encoding the EPSPS enzyme mutant.

[0018] The term "nucleic acid molecule encoding an EPSPS enzyme mutant" may include a polynucleotide encoding a mutant protein of the present invention, or may include additional coding and / or non-coding sequences.

[0019] In the case where the present invention provides the above-mentioned amino acid sequence, those skilled in the art can easily obtain the nucleic acid sequence encoding the above-mentioned EPSPS enzyme mutant according to the degeneracy of the codon. For example, the nucleic acid sequence encoding the above-mentioned EPSPS enzyme mutant can be obtained by making corresponding nucleotide mutations on the nucleic acid sequence encoding the wild-type EPSPS enzyme. This is easy to achieve for those skilled in the art.

[0020] The mutant proteins and polynucleotides of the present invention are preferably provided in an isolated form, and more preferably, purified to homogeneity.

[0021] The full-length sequence of the polynucleotide of the present invention can usually be obtained by PCR amplification, recombination or artificial synthesis. For PCR amplification, primers can be designed based on the relevant nucleotide sequences disclosed in the present invention, especially the open reading frame sequences, and commercially available cDNA libraries or cDNA libraries prepared by conventional methods known to those skilled in the art are used as templates to amplify and obtain the relevant sequences. When the sequence is long, it is often necessary to perform two or more PCR amplifications, and then splice the fragments amplified in each time together in the correct order.

[0022] Once the relevant sequence is obtained, it can be obtained in large quantities by recombinant methods. This is usually done by cloning it into a vector, then transferring it into cells, and then isolating the relevant sequence from the propagated host cells by conventional methods.

[0023] In addition, artificial synthesis methods can also be used to synthesize related sequences, especially when the fragment length is shorter. Usually, a long fragment of sequence can be obtained by synthesizing multiple small fragments first and then connecting them.

[0024] At present, the DNA sequence encoding the protein of the present invention (or its fragment, or its derivative) can be obtained completely by chemical synthesis. The DNA sequence can then be introduced into various existing DNA molecules (or vectors) and cells known in the art. In addition, mutations can also be introduced into the protein sequence of the present invention by chemical synthesis.

[0025] The method of amplifying DNA / RNA using PCR technology is preferably used to obtain the polynucleotides of the present invention. In particular, when it is difficult to obtain full-length cDNA from a library, the RACE method (RACE-cDNA terminal rapid amplification method) can be preferably used. The primers used for PCR can be appropriately selected based on the sequence information of the present invention disclosed herein, and can be synthesized by conventional methods. The amplified DNA / RNA fragments can be separated and purified by conventional methods such as by gel electrophoresis.

[0026] In a preferred embodiment of the present invention, the nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO. 3. In order to improve the translation efficiency of the gene encoding the EPSPS enzyme mutant in soybean, the present invention optimizes the nucleotide sequence according to the codon preference of the soybean nucleotide sequence, as shown in SEQ ID NO. 3. The nucleotide sequence of the original wild-type rice EPSPS is shown in SEQ ID NO. 1, and the sequence shown in SEQ ID NO. 3 has a homology of 77% with the nucleotide of the original wild-type rice EPSPS.

[0027] In a third aspect, the present invention provides a nucleic acid molecule comprising: an intron and an exon sequence encoding the above-mentioned EPSPS enzyme mutant.

[0028] In a preferred embodiment of the present invention, the nucleic acid molecule comprises: a first exon, a first intron, a second exon, a second intron, a third exon, a third intron, a fourth exon, a fourth intron, a fifth exon, a fifth intron, a sixth exon, a sixth intron, a seventh exon, a seventh intron and an eighth exon sequence arranged in sequence from the 5'-3' direction, wherein the above sequences are shown in SEQ ID NOs. 10-24 in sequence;

[0029] Introns include, but are not limited to, Adh1, bronze 1, actin 1, actin 2 introns or the sucrose synthase intron.

[0030] In a preferred embodiment of the present invention, the sequence of the nucleic acid molecule is shown as SEQ ID NO.5.

[0031] The nucleotide sequence shown in SEQ ID NO.5 is the full-length gene sequence of the EPSPS enzyme mutant (including intron sequences and exon sequences).

[0032] In an alternative embodiment, the nucleic acid molecule is selected from DNA, RNA, or a combination thereof.

[0033] In a fourth aspect, the present invention provides an expression cassette comprising the above-mentioned nucleic acid molecule.

[0034] In a preferred embodiment of the present invention, the expression cassette further comprises a promoter and a terminator.

[0035] When the nucleic acid molecule is a nucleic acid molecule that does not include introns but only contains exons, in a preferred embodiment of the present invention, the promoter includes but is not limited to: cauliflower mosaic virus 19S promoter, cauliflower mosaic virus 35S promoter, figwort mosaic virus 35S promoter, sugarcane bacilliform virus promoter, Commelina yellow spot virus promoter, ribulose-1,5-bisphosphate carboxylase (rubisco) small subunit promoter, cassava vein mosaic virus (CsVMV) promoter, Arabidopsis Ubiquitin10 (UBI10) gene promoter, rice actin actin1 promoter, mannopine synthase gene promoter, octopine synthase gene promoter, soybean ubiquitin (GmUBI) gene promoter, corn Ubiquitin promoter or any one of the promoters of rice EPSPS gene.

[0036] When the nucleic acid molecule is a nucleic acid molecule that does not include introns but only contains exons, in a preferred embodiment of the present invention, the terminator includes but is not limited to: any one of the terminator of the nopaline synthase gene (NOS) of Agrobacterium tumefaciens, the terminator of the octopine synthase gene, the terminator of the 19S gene of CaMV, the terminator of the 35S gene of CaMV, the terminator of the mannopine synthase gene, the terminator tAdh of the ethanol dehydrogenase gene of Saccharomyces cerevisiae, the terminator of the trpC gene of Aspergillus nidulans, and the terminator of the rice EPSPS gene.

[0037] In a preferred embodiment of the present invention, when the expression cassette nucleic acid molecule is a nucleic acid molecule including an intron, the sequence of the promoter of the expression cassette is shown in SEQ ID NO.6, and SEQ ID NO.6 is the promoter of the rice EPSPS gene;

[0038] In a preferred embodiment of the present invention, when the expression cassette nucleic acid molecule is a nucleic acid molecule including introns, the sequence of the terminator of the expression cassette is shown as SEQ ID NO.7, and SEQ ID NO.7 shows the terminator of the rice EPSPS gene.

[0039] When the above-mentioned promoter and terminator are selected from the promoter and terminator of the rice EPSPS gene, since the expression cassette is derived from the rice variety itself rather than a microorganism, it can be suitable for transforming various plant varieties such as rice, tobacco, soybean, corn, cotton, sorghum, wheat and the like, and has a wider range of applications.

[0040] In one embodiment, the expression cassette carries a promoter, an intron and a terminator. The introns include but are not limited to introns that enhance transgene expression, such as artificial or natural introns, such as RBG introns.

[0041] In a preferred embodiment of the present invention, the sequence of the expression cassette is shown as SEQ ID NO.8.

[0042] In a fifth aspect, the present invention provides an expression vector comprising the above-mentioned expression cassette.

[0043] Expression vector

[0044] The present invention also relates to a vector comprising the nucleic acid molecule of the present invention, a host cell produced by genetic engineering using the vector of the present invention or the mutant protein coding sequence of the present invention, and a method for producing the EPSPS enzyme mutant of the present invention by recombinant technology.

[0045] In the present invention, the polynucleotide sequence encoding the mutant protein can be inserted into a recombinant expression vector. The term "recombinant expression vector" refers to bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses or other vectors well known in the art. As long as they can replicate and be stable in the host, any plasmid and vector can be used. An important feature of an expression vector is that it usually contains a replication origin, a promoter, a marker gene and a translation control element.

[0046] In a sixth aspect, the present invention provides a recombinant bacterium or a recombinant cell, wherein the recombinant bacterium or the recombinant cell contains a gene encoding the EPSPS enzyme mutant described above, and the recombinant cell is a non-plant cell.

[0047] In a preferred embodiment of the present invention, the recombinant bacteria or recombinant cells are bacteria or fungi.

[0048] In a preferred embodiment of the present invention, the bacteria is Agrobacterium or Escherichia coli, the fungus is yeast, and the recombinant cell can be a competent cell.

[0049] The recombinant cell can be a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher non-plant eukaryotic cell, such as a mammalian cell. Representative examples include: Escherichia coli, Streptomyces; bacterial cells of Salmonella typhimurium; fungal cells such as yeast.

[0050] In a seventh aspect, the present invention provides the use of the EPSPS enzyme mutant, the nucleic acid molecule, the expression cassette, the expression vector or the recombinant bacteria or recombinant cells in cultivating glyphosate-resistant plants;

[0051] In a preferred embodiment of the present invention, the present invention includes at least one of the following application modes:

[0052] (1) Delivering nucleic acid molecules into target plant cells;

[0053] (2) introducing the expression cassette into the target plant by gene gun or Agrobacterium transformation; the expression cassette includes but is not limited to: EPSPS promoter, intron and exon encoding SEQ ID NO.4 enzyme and EPSPS terminator;

[0054] (3) transforming the target plant with a vector containing a gene encoding a rice EPSPS enzyme mutant confers resistance to glyphosate;

[0055] (4) introducing a recombinant bacterium or a recombinant cell into a target plant, wherein the recombinant bacterium or the recombinant cell contains a gene encoding a rice EPSPS enzyme mutant that is resistant to glyphosate;

[0056] (5) Genetically editing the target plant cells so that they encode the above-mentioned EPSPS enzyme mutant.

[0057] In an optional embodiment, the method of introduction is selected from a genetic transformation method, a genome editing method or a gene mutation method.

[0058] The above genetic transformation methods include but are not limited to: producing individuals with glyphosate resistance by selfing or crossing parent plants with genes of glyphosate-resistant EPSPS enzyme mutants with other plant individuals.

[0059] In other embodiments, the above transformation methods include but are not limited to Agrobacterium-mediated gene transformation, gene gun transformation, and pollen tube channel method.

[0060] In a preferred embodiment of the present invention, the plant is selected from rice, tobacco, soybean, corn, cotton, sorghum, wheat or rapeseed;

[0061] In a preferred embodiment of the present invention, the plant is selected from rice or soybean.

[0062] In an eighth aspect, the present invention provides a method for cultivating glyphosate-resistant plants, wherein the EPSPS enzyme in the target plant cells is sequenced with the wild-type EPSPS enzyme from rice, so that the amino acids of the EPSPS enzyme in the target plant cells corresponding to the 131st, 172nd, 177th, 274th, 313th and 403rd positions of the wild-type EPSPS enzyme of rice are mutated to G, A, S, R, E and A respectively; the amino acid sequence of the wild-type EPSPS enzyme is shown in SEQ ID NO.2.

[0063] The above method for cultivating glyphosate-resistant plants includes but is not limited to: the EPSPS enzyme in the target plant cells has any homology with the wild-type EPSPS enzyme of rice, and after sequence alignment, the amino acids of the EPSPS enzyme of the target plant cells corresponding to the 131st, 172nd, 177th, 274th, 313th and 403rd positions of the wild-type EPSPS enzyme of rice are mutated to G, A, S, R, E and A respectively, so that glyphosate-resistant plants can be screened and cultivated.

[0064] The mutation method includes but is not limited to gene editing, etc., in which the coding gene in the target plant cell is edited to cause adaptive mutation of the amino acid at the corresponding position.

[0065] In a preferred embodiment of the present invention, the target plant is selected from rice, tobacco, soybean, corn, cotton, sorghum, wheat or rapeseed.

[0066] In a ninth aspect, the present invention provides a method for detecting a glyphosate-resistant EPSPS mutant plant, comprising: determining whether the test plant contains the aforementioned nucleic acid molecule; or determining whether the test plant contains the aforementioned EPSPS enzyme mutant.

[0067] Determine whether the rice to be tested contains the above nucleic acid molecules: including but not limited to detection primers, probes, nucleic acid aptamers, chips, etc. Detection of nucleic acid molecules is achieved by amplification and / or hybridization.

[0068] The method for determining whether the rice to be tested contains the above-mentioned EPSPS enzyme mutant with glyphosate resistance includes but is not limited to: modifying a marker that can detect the EPSPS enzyme mutant on a solid phase carrier to achieve qualitative or quantitative analysis of the EPSPS enzyme mutant. The solid phase carrier includes but is not limited to: magnetic beads, test strips, microplates, membranes, micron-sized particles, nanoparticles, etc.

[0069] The present invention has the following beneficial effects:

[0070] The present invention can obtain a glyphosate-resistant EPSPS enzyme by mutating the wild-type rice EPSPS enzyme at the above position, and after transforming the wild-type rice EPSPS enzyme into a plant, the rice EPSPS enzyme mutant can be expressed and has glyphosate resistance. The EPSPS enzyme mutant provided by the present invention can effectively solve the problem of non-selective damage to crops by herbicides such as glyphosate, and provides a new way to cultivate glyphosate-resistant crop varieties. At the same time, the EPSPS enzyme mutant provided by the present invention also has high practicality and promotion value, can improve the weeding effect in agricultural production, reduce the weeding cost, and promote the increase of crop yield.

[0071] The present invention provides an EPSPS enzyme mutant expressed in plants such as soybeans and rice, which can impart tolerance to herbicides that inhibit EPSPS enzymes, particularly herbicides of the phosphonomethylglycine family, including but not limited to glyphosate, to the plants such as soybeans and rice.

[0072] After transforming plants with EPSPS mutations A131G, G172A, P177S, K274R, K313E and V403A, the plants (such as rice or soybean) have higher glyphosate tolerance than the same plants transformed with the glyphosate-resistant genes CP4-EPSPS gene and GOX gene.

[0073] In addition, the present invention also provides an expression cassette for expressing an EPSPS enzyme mutant, wherein the expression cassette contains an EPSPS mutant gene that confers glyphosate resistance to various plants such as soybeans and rice.

[0074] The EPSPS enzyme mutant, nucleic acid molecule, expression box or vector or recombinant bacteria or recombinant cell with glyphosate resistance provided by the present invention has broad application prospects in cultivating glyphosate-resistant soybeans. BRIEF DESCRIPTION OF THE DRAWINGS

[0075] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments are briefly introduced below. It should be understood that the following drawings only show certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without creative work.

[0076] Figure 1 This is the expression cassette map for the herbicide resistance gene OE89Y;

[0077] Figure 2 A schematic diagram of the structure of the pBI121 vector provided by the present invention;

[0078] Figure 3 Detection of positive soybean transformed with OEM89Y provided by the present invention;

[0079] Figure 4 The growth condition of the transgenic positive soybeans provided by the present invention after being sprayed with glyphosate;

[0080] Figure 5 is the structure diagram of the expression cassette of 4KO89;

[0081] Figure 6 This is the expression cassette map for the herbicide-resistant gene CP4-GOX. DETAILED DESCRIPTION

[0082] References to embodiments of the present invention will now be provided in detail, one or more examples of which are described below. Each example is provided as an explanation rather than a limitation of the present invention. In fact, it will be apparent to those skilled in the art that various modifications and variations may be made to the present invention without departing from the scope or spirit of the present invention. For example, a feature illustrated or described as part of one embodiment may be used in another embodiment to produce a further embodiment.

[0083] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by those of ordinary skill in the art to which the present disclosure belongs. Although any methods and materials similar or equivalent to those described herein can be used for the practice or testing of the preparations or unit doses herein, some methods and materials are now described. Unless otherwise stated, the techniques adopted or considered herein are standard methods. Materials, methods and examples are illustrative and non-restrictive only.

[0084] The practice of the present invention will employ, unless otherwise indicated, conventional techniques of plant physiology, plant molecular genetics, cell biology, molecular biology (including recombinant techniques), microbiology, biochemistry, and immunology, which are within the capabilities of a skilled artisan. This technique is fully explained in the literature, such as Molecular Cloning: A Laboratory Manual, Second Edition (Sambrook et al., 1989); Oligonucleotide Synthesis (MJ Gait, ed., 1984); Plant Physiology (Cang Jing et al., 2017); Methods in Enzymology (Academic Press, Inc.); Handbook of Experimental Immunology (DM Weir and CC Blackwell, eds.); Current Protocols in Molecular Biology (FM Ausubel et al., eds., 1987); Plant Molecular Genetics (Monica A. Hughes et al.); PCR: The Polymerase Chain Reaction (Mullis et al., 1994), each of which is expressly incorporated herein by reference.

[0085] In order to make the purpose, technical scheme and advantages of the embodiments of the present invention clearer, the technical scheme in the embodiments of the present invention will be described clearly and completely below. If the specific conditions are not specified in the embodiments, they are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased commercially.

[0086] The features and performance of the present invention are further described in detail below in conjunction with the embodiments.

[0087] Example 1

[0088] This embodiment provides an EPSPS mutant derived from rice, which is a rice EPSPS mutant OE89Y, which is obtained by mutating a wild-type rice EPSPS (amino acid sequence as shown in SEQ ID NO.2), and its amino acid sequence is shown in SEQ ID NO.4.

[0089] Compared with the amino acid sequence of the wild-type rice EPSPS shown in SEQ ID NO. 2, the rice EPSPS mutant OE89Y provided in this example has A131G, G172A, P177S, K274R, K313E and V403A mutations.

[0090] That is, relative to the wild-type rice EPSPS, the 131st amino acid residue of the rice EPSPS mutant OE89Y mutated from A to G, which corresponds to the 59th position of the E. coli EPSPS; the 172th amino acid residue mutated from G to A, which corresponds to the 96th position of the E. coli EPSPS; the 177th amino acid residue mutated from P to S, which corresponds to the 101st position of the E. coli EPSPS; the 274th amino acid residue mutated from K to R, which corresponds to the 194th position of the E. coli EPSPS; the 313th amino acid residue mutated from K to E, which corresponds to the 232nd position of the E. coli EPSPS; the 403rd amino acid residue mutated from V to A, which corresponds to the 314th position of the E. coli EPSPS.

[0091] This example also provides a gene encoding the rice EPSPS mutant OE89Y, whose nucleotide sequence is shown in SEQ ID NO. 3. In order to improve the translation efficiency of the coding gene of OE89Y in soybean, the nucleotide sequence was optimized according to the codon preference of the soybean nucleotide sequence, and the optimized nucleotide sequence of OE89Y (SEQ ID NO. 3) has a homology of 77% with the original rice wild-type EPSPS.

[0092] The gene encoding the rice EPSPS mutant OE89Y provided in the embodiment of the present invention can be obtained by chemical synthesis.

[0093] Example 2

[0094] Construction of optimized OE89Y expression cassette and expression vector.

[0095] The optimized OE89Y gene was synthesized by chemical synthesis, and primers were designed to amplify the OE89Y gene fragment with overlapping fragments with 35s and NOS. The 35S promoter was amplified from the pBI121 vector. The 5' end of the OE89Y gene fragment was connected to 35S by general molecular biological methods, and then connected to a NOS terminator at the 3' end to form an expression cassette that can be expressed in plants (with a BmHI site at the 5' end and a BstBI site at the 3' end). The structure of the expression cassette is as follows: Figure 1 This expression cassette was connected to the modified pBI121 vector by homologous recombination to obtain the T-DNA vector pBI121-OE89Y, whose vector structure is shown in Figure 2 shown.

[0096] Example 3

[0097] This embodiment provides the use of the above OE89Y expression cassette in cultivating glyphosate-resistant soybeans, which includes the following steps.

[0098] 1. Agrobacterium Preparation

[0099] Spread 400ul of the bacteria containing the pBI121-OE89Y vector stored at -80℃ on YEP (LB) medium and culture for about 24 hours.

[0100] 2. Seed disinfection and soaking

[0101] The soybean seeds are sterilized by chlorine dry method, and the sterilized soybean seeds are soaked in water for 20-24 hours.

[0102] 3. Infection and co-cultivation

[0103] Add GA3 (gibberellic acid), 6-BA (6-benzylaminopurine), L-Cys (L-cysteine), and AS (acetosyringone) to the infection solution and set aside.

[0104] Move the imbibed soybean seeds from the water to a sterile culture dish, remove the seed coat, cut off the radicle, cut the seeds longitudinally along the hilum with a scalpel, and evenly separate the cotyledons and hypocotyls into two petals for later use as explants.

[0105] After 24 hours of culture, add Agrobacterium to the prepared infection solution and adjust the OD 600 Adjust to 0.7-0.8.

[0106] Pour the soybean explants into a sterilized cup, wash with clean water once, and dry the water. Add the prepared Agrobacterium to the cup with the soybean explants and infect at room temperature for more than 1 hour. Add 6 ml of co-culture solution (infection solution + DTT) to a sterile culture dish with sterile filter paper, and place the infected soybean explants with the growth point facing down in the above culture dish. After sealing, culture under light at 24°C for 4-5 days, 16h light / 8h dark.

[0107] 4. Screening

[0108] The elongated hypocotyls on the cotyledons after co-cultivation were cut in half, and the obvious small buds were removed, and the explants were transferred to the shoot induction medium (SIM g12), 10 explants / dish, 24°C, 18h light / 6h dark, and cultured for 3 weeks.

[0109] 5. Bud elongation I

[0110] The yellowed cotyledons of the explants were removed, and the explants with small buds were transferred to the shoot elongation medium (SEM g3 culture dish), 6 explants / dish, 24°C, 18h light / 6h dark cycle for 2 weeks.

[0111] 6. Bud Elongation II

[0112] For explants that are obviously elongated, cut off the black part at the bottom to expose the tissue that can absorb nutrients, remove the cotyledons and most of the small buds, and then transfer them to the bud elongation medium (SEM g2 cup), 4-6 explants / cup. After 2 weeks of culture, new culture medium is needed for subculture.

[0113] 7. Rooting

[0114] Cut off the seedlings that have grown to more than 2 / 3 of the culture cup, transfer them to rooting medium, and culture them at 24°C with a photoperiod of 18 hours light / 6 hours dark. After strong roots are induced, take out the seedlings, wash the root culture medium, number the plants, and transplant them into seedling pots. Continue to culture for about 10 days before moving them into the greenhouse.

[0115] Example 4

[0116] This example is about obtaining and identifying positive plants.

[0117] One week after transplanting the C0 seedlings provided in Example 3, 10x the field dosage of glyphosate was sprayed. In this experiment, Roundup herbicide (41% glyphosate isopropyl ammonium salt solution) was used for spraying. After one week of spraying, the surviving rice seedlings were selected, sampled, and DNA was extracted by SLS method. Transgenic detection was performed using the designed specific primers. The primer sequences are as follows:

[0118] Gm2M89-F: GGAAATGCTTATGTTGAAGGAGATGCA;

[0119] Gm2M89-R: TTCGAAGATCTAGTAACATAGATGACACCG.

[0120] PCR was performed using Nanjing Novozyme Biotechnology Co., Ltd. MIX, and the PCR reaction system (20ul) was as follows:

[0121] 2x MIX buffer 10ul;

[0122] 10uM Gm2M89-F1ul;

[0123] 10uM Gm2M89-R1ul;

[0124] Genomic DNA 1ul;

[0125] Water 7ul;

[0126] The PCR reaction conditions were:

[0127]

[0128] Take 3ul of PCR product and run it on 1% agarose gel electrophoresis. The target band size is 862bp. Figure 3 This indicates that the target gene was integrated into all nine plants transformed with the OE89Y gene.

[0129] Lane M is the DNA molecular weight marker DL2000, lane N is the wild-type soybean negative control, P is the plasmid DNA positive control, W is water, and lanes 1-9 are different transformation events. The transgenic positive plants containing the target gene can be amplified with a specific fragment of about 862 bp.

[0130] Example 5

[0131] Herbicide tolerance testing of positive plants.

[0132] In this example, wild-type soybean plants were used as a control, and the OE89Y gene-positive soybean plants obtained in Example 4 were used as an experimental group to verify the glyphosate resistance of the OE89Y gene in soybeans.

[0133] The experimental method is as follows:

[0134] The transgenic soybean plants with OE89Y gene positive and plant height of 10cm-15cm were evenly placed in the same experimental area (avoiding leaf overlap) with wild-type soybean plants of similar size, and then sprayed with 10 times the field dosage of glyphosate (commercial 41% glyphosate isopropyl ammonium salt solvent). After the leaves were dried, the plants in the experimental group and the control group were moved to the greenhouse for cultivation, and photos and plant growth conditions were recorded after one week.

[0135] Depend on Figure 4 It can be seen that after spraying 10 times the field dosage of glyphosate, wild-type soybeans had no glyphosate resistance and died, while the growth of soybeans transformed with the OE89Y gene under the same treatment was almost unaffected, and transgenic soybeans with sufficient glyphosate resistance could be obtained. The above results show that the optimized and modified OE89Y gene can significantly improve the glyphosate resistance of transgenic soybeans.

[0136] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

[0137] Example 6

[0138] This example provides an expression cassette (named 4KO89) capable of expressing an EPSPS enzyme comprising A131G, G172A, P177S, K274R, K313E and V403A mutation sites.

[0139] In this example, a 4KO89 expression cassette was constructed, the base sequence of which is shown in SEQ ID NO.8, the amino acid sequence of the EPSPS enzyme mutant is shown in SEQ ID NO.4, and the structure is shown in Figure 5 As shown, the expression cassette consists of the OsEPSPS gene promoter, the 4KO89 coding gene (SEQ ID NO. 5) and the OsEPSPS terminator.

[0140] Compared with the nucleotide sequence (SEQ ID NO.9) of the wild-type rice EPSPS (4KOWT) encoding gene, the mutant 4KO89 has multiple base mutations in its exons, that is, the base at position 3096 from the 5' end to the 3' end of the nucleic acid sequence of the mutant 4KO89 mutates from C to G, the two consecutive bases at positions 3219 and 3220 mutate from GA to CG, the base at position 3233 mutates from C to T, the base at position 3235 mutates from A to C, the base at position 3886 mutates from A to G, the base at position 4002 mutates from A to G, and the base at position 4582 mutates from T to C. Compared with the amino acid sequence (SEQ ID NO.2) of the wild-type rice EPSPS, the mutant 4KO89 has multiple amino acid residue site mutations. They are: the 131st amino acid residue from N-terminus to C-terminus mutated from A to G; the 172nd amino acid residue mutated from G to A; the 177th amino acid residue mutated from P to S; the 274th amino acid residue mutated from K to R, the 313th amino acid residue mutated from K to E, and the 403rd amino acid residue mutated from V to A.

[0141] The multiple site mutations make the rice EPSPS full-length gene mutant 4KO89 resistant to glyphosate.

[0142] Example 7

[0143] This example uses the gene gun method to transform rice, which specifically includes the following steps:

[0144] 1. Callus Induction

[0145] 1.1 Seed disinfection

[0146] Take dry mature seeds, shell them manually, select plump seeds without sterile spots, add 60-80% alcohol to disinfect for 20-60 seconds. Pour off the alcohol and wash once with sterile water; add 2-3% sodium hypochlorite solution and soak for 15-20 minutes. Pour off the sodium hypochlorite solution and soak and wash 6-7 times with sterile water, 3 minutes each time.

[0147] 1.2 Induction and subculture

[0148] The seeds were placed on sterile filter paper to absorb dryness, and placed in induction culture medium, 10-15 seeds per dish; after the operation, the culture dish was sealed with sealing film, and cultured in the dark at 30℃ for 28-35 days. The callus tissue was transferred to fresh culture medium and cultured for about 7-14 days.

[0149] 1.3 Hypertonic treatment

[0150] Take the ball-shaped callus of appropriate size and transfer it to the hypertonic medium for culture. Place each dish of callus in the center of the culture dish with a diameter of 2.5-3cm and culture for 4-8 hours;

[0151] 2. DNA fragment packaging

[0152] 2.1 DNA fragment preparation

[0153] The concentrations of the OsEPSPS gene fragment solution and the CP4-EPSPS gene fragment solution provided in Example 6 were adjusted to 50-1000 ng / μL for later use.

[0154] 2.2 Preparation of gold powder mother solution (prepared on the spot)

[0155] Weigh 30 mg of microparticles into a 1.5 ml microcentrifuge tube. Add 1 ml of 70% ethanol (v / v). Vortex vigorously to mix for 3-5 minutes. Allow the particles to soak in 70% ethanol for 15 minutes. Pellet the microparticles by spinning in a microcentrifuge for 5 seconds. Discard the supernatant.

[0156] Repeat the following washing steps three times: add 1 ml sterile water; vortex vigorously for 1 minute; let the particles settle for 1 minute. Pellet the particles by briefly spinning in a microcentrifuge, aspirate and discard the liquid. After the third wash, add 500 ul sterile 50% glycerol to a particle concentration of 60 mg / ml (assuming no particles were lost during preparation). Weigh 60 mg (0.8-1.5 μm diameter) gold powder into a 1.5 ml Eppendorf tube; add 0.5 ml 100% ethanol, vortex thoroughly for 3-5 min, or sonicate to mix, let stand for 5 min, centrifuge at 5000 rpm for 30 s; repeat 2-3 times; add 0.5 mL 75% ethanol, vortex thoroughly, let stand for 1 min, centrifuge at 5000 rpm for 30 s; discard the supernatant, add 1.2 ml sterile 50% glycerol, vortex thoroughly, aliquot 50 μL / 1.5 ml Eppendorf tube, and store at 4°C for up to 2 weeks.

[0157] 2.3 DNA packaging

[0158] Take 50 μl of gold powder suspension (referring to the gold powder mother solution in the 1.5 ml tube) and ultrasonicate it for 1-2 min, then vortex it thoroughly; then add 5 μl of DNA (50-1000 ng / μl), 50 μl of 2.5M CaCl 2 Add 20μl 0.1M spermidine while vortexing. After each addition, shake for about 30 seconds. Vortex the mixed sample thoroughly, let it stand on ice for 3-10 minutes, centrifuge at 3000-10000 rpm for 10-30 seconds, and remove the supernatant. Add 140μl 70% ethanol, vortex to mix, let it stand for 1-2 minutes, centrifuge at 3000-10000 rpm for 10-30 seconds, and remove the supernatant. Repeat adding 140μl 70% ethanol, vortex to mix, let it stand for 1-2 minutes, centrifuge at 3000-10000 rpm for 10-30 seconds, and remove the supernatant. Add 140μl 100% ethanol, vortex to mix, let it stand for 1-2 minutes, centrifuge at 3000-10000 rpm for 10-30 seconds, and remove the supernatant. Repeat adding 140μl 100% ethanol, vortex mix, let stand for 1-2 minutes, centrifuge at 5000rpm for 10-30 seconds, and remove the supernatant. Finally, vortex mix with 30-100μl of anhydrous ethanol and place on ice until use, and place for no more than 4 hours.

[0159] The prepared gold powder + OsEPSPS gene suspension or CP4-GOX gene suspension was evenly applied to the flight membrane, and then bombarded with rice callus tissue after natural air drying.

[0160] 3. Microparticle bombardment

[0161] 3.1 Preparations before bombardment

[0162] Before using the flight membrane, flight membrane fixing groove, split membrane, stainless steel mesh, split membrane cover, particle launching device, etc., soak them in 75% alcohol for 15 minutes, then dry them for later use.

[0163] 3.2 Transformation by gene gun bombardment

[0164] Rice callus that had been treated on hypertonic medium for 4-8 h was bombarded using a gene gun.

[0165] The parameters of gene gun bombardment are: 6-7MPa rupture membrane, -0.09MPa vacuum, and bombardment distance of 5-7cm.

[0166] After bombardment, callus tissue was cultured on hypertonic medium for 12-24 h.

[0167] 4. Cultivation and rooting

[0168] 4.1 Callus was transferred to screening medium S1g400, cultured in the dark at 30°C for 14 days;

[0169] 4.2 Callus tissue was transferred to screening medium S2g400 and cultured in the dark at 30°C for 14 days;

[0170] 4.3 The callus tissue was transferred to differentiation medium Fg5, 30℃, 18 hours of light, and cultured for about 21 days, then the differentiation medium was changed to a new one and cultured for another 21 days;

[0171] 4.4 Select green spots and young shoots and place them on new differentiation medium Fg5, and continue to culture at 30℃ for about 21 days;

[0172] 4.5 When the new seedlings grow to about 2 cm, they are transferred to the rooting medium and cultured at 30℃ for 18 hours for 2 to 4 weeks.

[0173] 4.6 When roots are induced and the seedlings grow to 7-10 cm, transplant them into the soil. These seedlings are the C0 generation.

[0174] Example 8

[0175] This example is about obtaining and identifying positive plants.

[0176] One week after transplanting the C0 seedlings provided in Example 7, 10x the field dosage of glyphosate was sprayed. In this experiment, Roundup herbicide (41% glyphosate isopropyl ammonium salt solution) was used for spraying. After one week of spraying, the surviving rice seedlings were selected, sampled, and DNA was extracted by alkali boiling. The designed specific primers were used for EPSPS copy number detection. The primer sequences are as follows:

[0177] R96A5: CAAGCAGTGCTTTCTCCCAAAATTATG;

[0178] R96A3: AATGCTAATTCAAAAGAAGACATCAAGACC.

[0179] PCR used KOD enzyme from Toyobo Co., Ltd., and the PCR reaction system (20ul) was as follows:

[0180] 2X KOD buffer 10ul

[0181] 10uM R96A51ul

[0182] 10uM R96A31ul

[0183] Genomic DNA 1ul

[0184] KOD enzyme 0.2ul

[0185] Water 6.8ul

[0186] The PCR reaction conditions were;

[0187]

[0188] Take 3ul of PCR product and run 1% agarose gel electrophoresis. The target band size is 1063bp. Send the PCR product to Shanghai Bioengineering Co., Ltd. for sequencing. According to the sequencing results, the copy number of C0 seedlings is evaluated, and the low copy number C0 seedlings are retained.

[0189] Comparative Example 1

[0190] This embodiment provides an expression cassette (named CP4-GOX) capable of expressing CP4 gene and GOX gene.

[0191] Using the commercially available pBI121 vector as a template, primers were designed to amplify the NOS terminator fragment. The optimized rice actin promoter, optimized cTP (chloroplast signal peptide), optimized CP4-EPSPS gene fragment, and GOX gene (glyphosate oxidoreductase gene) fragment were artificially synthesized at Sangon Biotechnology (Shanghai) Co., Ltd. Primers were designed and overlapping PCR was used to splice each fragment into the CP4-GOX coding gene fragment to obtain the CP4-GOX expression cassette, the structure of which is shown in the following figure. Figure 6 As shown, the expression cassette consists of actin promoter, CP4-EPSPS gene, GOX gene and NOS terminator.

[0192] Experimental Example 1

[0193] 1. Herbicide tolerance test of positive plants.

[0194] One week after the C0 seedlings of Example 7 were sprayed with 10 times the field dosage of glyphosate (the normal field dosage of glyphosate (1 times) is 1060 grams of active ingredient per hectare, and 10 times is 10,600 grams of active ingredient per hectare), the number of surviving plants and the number of dead plants were counted, and the statistical data are shown in Table 1.

[0195] Table 1 Number of C0 generation plants resistant to at least 10 times glyphosate

[0196]

[0197] Table 1 shows that the survival rate of rice C0 seedlings was the highest when the 4KO89 expression cassette in Example 6 was transformed into rice. Then, 168 and 118 C0 seedlings transformed with 4KO89 and CP4-GOX expression cassettes (Comparative Example 1) were taken, respectively, and sprayed with 10 times glyphosate. After 14 days, statistical data was collected. Three C0 seedlings with low copy numbers and good growth were selected and transplanted according to the above method. The remaining plants continued to be sprayed with 20 times glyphosate (the normal field dosage of glyphosate (1 times) is 1060 grams of active ingredient per hectare, and 20 times is 21200 grams of active ingredient per hectare). After 14 days, statistical data was collected. The surviving seedlings continued to be sprayed with 50 times glyphosate. After 14 days, statistical data was collected. The statistical data is shown in Table 2.

[0198] Table 2 Statistical results after spraying different glyphosate doses for 14 days

[0199]

[0200] At present, CP4-EPSPS is the most widely used glyphosate resistance gene in agriculture, and the GOX gene can degrade glyphosate. However, it can be seen from Table 2 that after spraying 10 times of glyphosate, the proportions of medium-high tolerance (plants are slightly affected) and high tolerance (plants are almost unaffected) in rice seedlings transformed with CP4-GOX are 12.7% and 2.5%, while the corresponding proportions of rice seedlings transformed with the 4KO89 expression cassette in Example 6 are 52.1% and 5.3%. After spraying 20 times of glyphosate, all rice seedlings transformed with CP4-GOX died, but 1.8% of rice seedlings transformed with 4KO89 still achieved medium-high tolerance under the spraying of 50 times of glyphosate.

[0201] The above results show that the 4KO89 expression cassette can confer resistance to rice plants at least 10 times the glyphosate concentration, and the resistance of the 4KO89 expression cassette is much higher than the superimposed resistance of the existing glyphosate resistance genes CP4 and GOX, showing excellent glyphosate resistance. At the same time, rice plants transformed with this expression cassette can grow normally, indicating that the biological enzyme activity of the rice EPSPS mutant in this expression cassette is normal.

[0202] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. An EPSPS enzyme mutant having glyphosate resistance, characterized in that: It looks like this: It is obtained by mutating the 131st, 172nd, 177th, 274th, 313th and 403rd amino acids of a wild-type EPSPS enzyme from rice; the amino acid sequence of the wild-type EPSPS enzyme is shown in SEQ ID NO.2; The amino acids at positions 131, 172, 177, 274, 313 and 403 of the EPSPS enzyme mutant are G, A, S, R, E and A respectively.

2. A nucleic acid molecule, characterized in that It encodes the EPSPS enzyme mutant described in claim 1.

3. The nucleic acid molecule according to claim 2, characterized in that The nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO.

3.

4. A nucleic acid molecule, characterized in that The sequence of the nucleic acid molecule is shown in SEQ ID NO.

5.

5. An expression cassette, characterized in that It comprises the nucleic acid molecule according to any one of claims 2 to 3 or the nucleic acid molecule according to claim 4.

6. The expression cassette according to claim 5, characterized in that The expression cassette also includes a promoter and a terminator.

7. The expression cassette according to claim 6, characterized in that When the expression cassette nucleic acid molecule is the nucleic acid molecule according to claim 4, the sequence of the promoter of the expression cassette is shown as SEQ ID NO.

6.

8. The expression cassette according to claim 6, characterized in that When the expression cassette nucleic acid molecule is the nucleic acid molecule according to claim 4, the sequence of the terminator of the expression cassette is shown as SEQ ID NO.

7.

9. An expression vector, characterized in that: It comprises the expression cassette according to any one of claims 5 to 8.

10. A recombinant bacterium, characterized in that: The recombinant bacteria contains a gene encoding the EPSPS enzyme mutant according to claim 1.

11. The recombinant bacterium according to claim 10, characterized in that The recombinant bacteria are bacteria or fungi.

12. The recombinant bacterium according to claim 11, characterized in that The bacteria are Agrobacterium or Escherichia coli; the fungus is yeast.

13. Use of the EPSPS enzyme mutant according to claim 1, the nucleic acid molecule according to any one of claims 2-3, the nucleic acid molecule according to claim 4, the expression cassette according to any one of claims 5-8, the expression vector according to claim 9 or the recombinant bacterium according to claim 10 in cultivating glyphosate-resistant plants, characterized in that: The plant is selected from rice or soybean.

14. The use according to claim 13, characterized in that The application method includes at least one of the following: (1) delivering the nucleic acid molecule into target plant cells; (2) introducing the expression cassette into the target plant by gene gun or Agrobacterium transformation; (3) transforming the target plant with the vector, wherein the vector contains a gene encoding the rice EPSPS enzyme mutant resistant to glyphosate; (4) introducing the recombinant bacteria into the target plant, wherein the recombinant bacteria contains a gene encoding the rice EPSPS enzyme mutant confers resistance to glyphosate; (5) Genetically editing the target plant cells so that they encode the EPSPS enzyme mutant described in claim 1.

15. A method for cultivating glyphosate-resistant plants, characterized in that: The EPSPS enzyme in the target plant cell is aligned with the wild-type EPSPS enzyme from rice, so that the amino acids of the EPSPS enzyme in the target plant cell corresponding to the 131st, 172nd, 177th, 274th, 313th and 403rd positions of the wild-type EPSPS enzyme of rice are mutated to G, A, S, R, E and A respectively; the amino acid sequence of the wild-type EPSPS enzyme is shown in SEQ ID NO.2; and the target plant is selected from rice or soybean.

16. A method for detecting whether a plant to be tested is an EPSPS mutant plant, characterized in that: It includes: Determine whether the plant to be tested contains the nucleic acid molecule according to any one of claims 2-3; or determine whether the plant to be tested contains the EPSPS enzyme mutant according to claim 1.

Images