A kit for rapid detection of Glechoma sutsugamushi based on RPA-CRISPR / Cas12a

Abstract

The invention discloses a kit for quickly detecting Glechoma ayuensis based on RPA-CRISPR / Cas12a. The kit is characterized in that the kit comprises a pair of RPA-specific primers and a crRNA sequence designed according to a large ribosomal subunit RNA sequence of Glechoma ayuensis, specifically Gp-RPA-F:TTCCTGCAGTAGCGGCGAGCGAAGAAGGACCAG; Gp-RPA-R:CCAAACACTACTACTCATCCTTTCACGCTGTAC; crRNA:UAAUUUCUACUAAGUGUAGAUGGUAACGAGAUGUCAUGGACGCG, and discloses a formula of RPA and CRISPR reaction system. The kit has the advantages of short detection time, strong specificity and high sensitivity, and has the advantage of being applied to on-site rapid and instant detection of Glechoma ayuensis.

Description

Technical Field

[0001] The present invention relates to the technical field of pathogenic microorganism detection, and in particular to a kit for rapidly detecting C. ayutans based on RPA-CRISPR / Cas12a. Background Art

[0002] Ayu (Latin name: Plecoglossus altivelis ) is an important high-value economic fish cultured in coastal cities in eastern my country. Large-scale, intensive and high-density artificial breeding has led to a sharp increase in diseases of sweetfish. Glugea plecoglossi ), the high infection stage of the sweetfish worm is especially concentrated in the growth period of young fish and the spawning period of adult fish. After infection with the worm, a heterogeneous cyst (xenomas) will form in the body cavity of the sweetfish, containing a large number of spores. After the spores are released, they can cause infiltration of mononuclear cells such as lymphocytes and macrophages, causing sub-lethal infection, destroying the body surface and appearance of the sweetfish, which not only increases feed consumption and leads to a significant increase in fish farming costs, but also the infected sweetfish has a poor shape and a reduced market value. The infectious spores of the sweetfish worm are only a few microns in size, and the infection is diagnosed by the formation of white heterogeneous cysts visible to the naked eye on the surface of the sweetfish tissue. When the cysts are not formed, microscopic examination can only be performed through intra-tissue separation or tissue staining. This requires the testers to have considerable professional knowledge background and operational skills, and is not suitable for rapid screening and early detection.

[0003] Recombinase polymerase amplification (RPA) is a nucleic acid amplification technology that can quickly and efficiently amplify specific DNA or RNA sequences under the action of three key components: recombinase, single-stranded DNA binding protein and strand displacement DNA polymerase. It is usually carried out under a constant temperature condition between 37-42°C, and ultimately achieves exponential amplification of the target sequence. Compared with polymerase chain reaction (PCR) related technologies, the RPA method has a shorter detection time, the entire reaction does not exceed 20 minutes, and is less instrument-dependent. It only requires a heating device maintained at 37-42°C, and has achieved certain applications in the rapid detection of microbial pathogens.

[0004] CRISPR / Cas (Clustered Regularly Interspaced Short Palindromic Repeats / CRISPR-associated proteins) is an adaptive immune system naturally present in bacteria and archaea to defend against foreign invaders such as viruses or plasmids. Cas proteins have a unique trans-cleavage activity. After being activated, they can continuously cut surrounding single-stranded oligonucleotides to achieve signal amplification. Based on this characteristic, the CRISPR / Cas system is used in disease diagnosis based on nucleic acid detection and identification of microbial pathogens by combining with isothermal amplification technology. In particular, Cas9, Cas12a, and Cas13a are most commonly used in the field of nucleic acid detection. For example, based on the trans-cleavage activity of Cas12a, the DETECTR method for detecting human papillomavirus developed in conjunction with the RPA method, the HOLMESv2 method for detecting Japanese encephalitis virus developed in conjunction with CRISPR / Cas12b and LAMP, and the SHERLOCK method for detecting Zika virus developed in conjunction with CRISPR / Cas12a and RPA. In the field of aquaculture, there are also reports on the use of CRISPR / Cas and RPA to detect white spot syndrome virus in shrimp, hepatic echinococcosis, and acute hepatopancreatic necrosis disease-causing Vibrio. At present, there are no reports on the application of this technology to the detection of Gastrodia elata in sweetfish at home and abroad. Summary of the invention

[0005] The technical problem to be solved by the present invention is to provide a kit for rapid detection of C. aquaticus based on RPA-CRISPR / Cas12a with fast detection speed, high detection sensitivity and accuracy.

[0006] The technical solution adopted by the present invention to solve the above technical problems is: a kit for rapid detection of G. ayuensis based on RPA-CRISPR / Cas12a, the kit comprising a pair of RPA-specific primers and a crRNA sequence designed according to the G. ayuensis large ribosomal subunit RNA sequence (GenBank accession number: KX814862.1),

[0007] The nucleotide sequence of the forward primer Gp-RPA-F of the RPA-specific primer is shown in SEQ ID NO.1: 5'-TTCCTGCAGTAGCGGCGAGCGAAGAAGGACCAG-3';

[0008] The nucleotide sequence of the reverse primer Gp-RPA-R of the RPA-specific primer is shown in SEQ ID NO.2: 5'-CCAAACACTACTACTCATCCTTTCACGCTGTAC-3';

[0009] The nucleotide sequence of the crRNA is shown in SEQ ID NO.3: 5'-UAAUUUCUACUAAGUGUAGAUGGUAACGAGAUGUCAUGGACGCG-3'.

[0010] Furthermore, an RPA reaction system is included, and the formula of the RPA reaction system is as follows: 29.4 µL of RPA reaction reagent, 2 µL of 10 µmol / L primer Gp-RPA-F, 2 µL of 10 µmol / L primer Gp-RPA-R, 2.5 µL of 280 mmol / L magnesium acetate, 2 µL of DNA template and 12.1 µL of ddH2O.

[0011] Furthermore, a CRISPR reaction system is included, and the formula of the CRISPR reaction system is as follows: 2 μL RPA reaction product, a final concentration of 20-60 nM Cas12a protein, 5 μL 10×Reaction buffer 1, a final concentration of 50 nM crRNA, a final concentration of 20-100 nM ssDNA, and finally ddH2O is added to make the total volume of the CRISPR reaction system 50 μL, wherein the ssDNA is FAM-TTATT-BHQ-1.

[0012] Preferably, the final concentration of the Cas12a protein is 50 nM, and the final concentration of the ssDNA is 80 nM.

[0013] Compared with the prior art, the advantages of the present invention are:

[0014] 1. High detection sensitivity. Each reaction of the present invention can detect 2 copies of the recombinant plasmid DNA of the large ribosomal subunit RNA of the sweetfish.

[0015] 2. High specificity. The specific RPA primers and crRNA used are designed based on the conserved region of the large ribosomal subunit RNA of Glechoma ayutans. They are highly targeted and specific, and can effectively avoid the false positive problem caused by agarose gel electrophoresis and fluorescent dyes.

[0016] 3. Short detection time. The amplification reaction only takes 20 minutes. According to the complexity of sample types such as fish tissue, sweetfish worm, and environmental water, the entire detection can be completed within 1.5 hours from the extraction of sample genomic DNA to the completion of result judgment, which greatly improves the detection speed.

[0017] 4. Low equipment dependence. The entire testing process only needs to be carried out at a constant temperature of 39 °C. A simple heating device such as a water bath can meet the requirements.

[0018] 5. The operation is simple. The entire detection process does not involve complicated instruments and equipment. Anyone with a basic knowledge of molecular biology can complete the operation. The test results are clear and obvious and can be judged by naked eye observation.

[0019] In summary, the use of the RPA primers and crRNA of the present invention to quickly detect the sweet fish larvae using the RPA-CRISPR / Cas12a technology has better speed, specificity and sensitivity, which is conducive to the immediate detection and differential identification of the sweet fish larvae. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 It is a fluorescence curve diagram of the optimal final concentration screening experiment of Cas12a protein in Example 2;

[0021] Figure 2 It is a bar graph of the optimal final concentration screening experiment of Cas12a protein in Example 2;

[0022] Figure 3 This is a fluorescence curve diagram of the ssDNA optimal final concentration screening experiment in Example 2;

[0023] Figure 4 This is a bar graph of the ssDNA optimal final concentration screening experiment in Example 2;

[0024] Figure 5 This is the fluorescence curve result of the specificity experiment of RPA-CRISPR / Cas12a detecting Glechoma ayuensis in Example 3;

[0025] Figure 6 This is a naked eye observation photo of the specificity experiment of RPA-CRISPR / Cas12a detecting the sweetfish worm in Example 3;

[0026] Figure 7 The fluorescence curve results of the sensitivity of RPA-CRISPR / Cas12a in detecting the sweet fish worm in Example 4;

[0027] Figure 8 This is a bar graph showing the sensitivity of RPA-CRISPR / Cas12a in detecting G. ayutans in Example 4;

[0028] Fig. 9 This is a naked eye observation photograph of the sensitivity of RPA-CRISPR / Cas12a in detecting Ayu sutsugamushi in Example 4;

[0029] Fig.10 The fluorescence curve results of the RPA-CRISPR / Cas12a method established in Example 5 for detecting field samples, S1-S15 are 15 field samples, NTC: ddH2O without DNA is used as a template;

[0030] Fig.11 These are naked eye observation photos of field samples detected using the RPA-CRISPR / Cas12a method established in Example 5. S1 to S15 are 15 field samples. NTC: ddH2O without DNA is used as a template. DETAILED DESCRIPTION

[0031] The present invention is further described in detail below with reference to the accompanying drawings.

[0032] Example 1: Establishment of a method for rapid detection of Ayu sutsugamushi based on RPA-CRISPR / Cas12a, the steps are as follows:

[0033] Step 1, RPA primer and crRNA design: Design specific RPA primer and crRNA sequence according to the large ribosomal subunit RNA sequence of Glechoma ayutans (GenBank accession number: KX814862.1), the specific sequence is as follows:

[0034] The nucleotide sequence of the RPA forward primer Gp-RPA-F is shown in SEQ ID NO. 1: 5'-TTCCTGCAGTAGCGGCGAGCGAAGAAGGACCAG-3';

[0035] The nucleotide sequence of the RPA reverse primer Gp-RPA-R is shown in SEQ ID NO.2: 5'-CCAAACACTACTACTCATCCTTTCACGCTGTAC-3';

[0036] The nucleotide sequence of crRNA is shown in SEQ ID NO.3: 5'-UAAUUUCUACUAAGUGUAGAUGGUAACGAGAUGUCAUGGACGCG-3'.

[0037] Step 2, DNA extraction of samples: Dissect fresh sweetfish, remove white heteroplasmic tumors from organs such as liver or gonads, rupture them to obtain and purify the spores of G. anguillarum. Take out the stored Vibrio anguillarum and Pseudomonas aeruginosa from -80℃ and streak them, pick out single clones for culture and expand to the required concentration. According to the instructions of the genomic DNA extraction kit (Nanjing Novozyme Biotechnology Co., Ltd.), extract the genomic DNA of G. anguillarum, Neobenedenia meijinensis, Cryptocaryon irritans, shrimp tissue samples positive for hepatic enterocytosis, Anisakis perryi, Intrauterine nematodes, Vibrio anguillarum, Pseudomonas aeruginosa, and liver tissue of sweetfish (without G. anguillarum DNA). For specific operation steps, see the instructions of the genomic DNA extraction kit. The extract was finally dissolved in 50 μL sterile ddH2O and stored at -20℃.

[0038] The genomic DNA of Ayu Glechoma was used as a template, and the PCR method (the nucleotide sequence of the PCR upstream amplification primer Gp-PF is shown in SEQ ID NO.4: 5'-AAGGGATCTCTAGGCTCG-3'; the nucleotide sequence of the PCR downstream amplification primer Gp-PR is shown in SEQ ID NO.5: 5'-TCTCCTTGGTCCGTGTTTC-3') was used to amplify the partial fragment of the large ribosomal subunit RNA sequence, and the product was detected by 1.5wt% agarose gel electrophoresis, and the target band was recovered by gel and connected with pMD19-T to construct a recombinant plasmid. After the sequencing was correct, the recombinant plasmid DNA was extracted using a commercial plasmid DNA extraction kit (Nanjing Novozyme Biotechnology Co., Ltd.). The specific operation steps are shown in the instructions of the plasmid DNA extraction kit. After the extraction was completed, the concentration and purity were determined using Nanodrop2000, and the samples were stored at -20°C for future use.

[0039] Step 3: RPA-CRISPR reaction

[0040] 3.1 Prepare the total RPA reaction system (50 μL): 29.4 μL RPA reaction reagent, 2 μL primer Gp-RPA-F (10 μmol / L), 2 μL primer Gp-RPA-R (10 μmol / L), 2.5 μL magnesium acetate (280 mmol / L), 2 μL DNA template, 12.1 μL ddH2O. Add all components except magnesium acetate and DNA template to the reaction tube containing RPA reaction reagent powder, vortex thoroughly, centrifuge briefly, and open the reaction tube. Add 2.5 μL magnesium acetate to the cap of the reaction tube, then add template DNA to the reaction tube, mix thoroughly and centrifuge;

[0041] 3.2 RPA reaction: The above RPA reaction system was reacted at a temperature of 39 °C and a reaction time of 20 min;

[0042] 3.3 Prepare the CRISPR reaction system: Take 2 μL of the RPA reaction product, add 0.15 μL of Cas12a protein (final concentration of 60 nM), mix with 5 μL of 10 × Reaction buffer 1 (Magigen CRISPR-Cas12a protein-LbaCas12a (Cpf1) 2000p, provided by Guangzhou Meige Biotechnology Co., Ltd.), add 1 μL of crRNA (final concentration of 50 nM) and 1 μL of ssDNA (final concentration of 100 nM), and finally add ddH2O to 50 μL, where the ssDNA (single-stranded DNA) is FAM-TTATT-BHQ-1, where the 5' end is modified with a FAM fluorescent group, and the 3' end is added with a black hole quencher group BHQ-1;

[0043] 3.4 CRISPR reaction: The above CRISPR reaction system was reacted at 37°C for 30 min, and the result was determined by the fluorescence curve or the color change of the product in the tube.

[0044] Example 2: The RPA primers and crRNA sequences in Example 1 were used to screen the optimal concentrations of Cas12a protein and ssDNA.

[0045] The recombinant plasmid DNA of the large ribosomal subunit RNA sequence fragment was prepared according to the method of step 2 of Example 1. The concentration and purity were determined using Nanodrop 2000 according to the formula: copies / μL = (6.02×10 23 )×(ng / μL×10 -9 ) / (DNA length × 660) to convert to copies. Select 10 6 The recombinant plasmid DNA of 100 copies / μL was used as a template. First, the RPA-CRISPR reaction was performed according to the method in step 3 of Example 1. In the reaction, Cas12a proteins with final concentrations of 20 nM, 30 nM, 40 nM, 50 nM, and 60 nM were selected to cut the RPA product, and the optimal concentration of Cas12a protein was screened. At the same time, the above concentrations of Cas12a protein were used respectively, and ddH2O without DNA was used as a negative control. The negative controls were recorded as NTC1 to NTC5. The results are shown in Figure 1 As shown in the figure, when different concentrations of Cas12a protein were used to cut the RPA product, the fluorescence intensity produced was different, and the negative control group NTC1 to NTC5 did not produce obvious fluorescence signals. Figure 2 As shown in the figure, when 20 nM, 30 nM, 40 nM, and 50 nM of Cas12a protein were used, the fluorescence intensity increased successively. When 60 nM of Cas12a protein was used, the fluorescence intensity decreased, and the negative control group NTC1 to NTC5 did not produce obvious fluorescence signals. Therefore, 50 nM of Cas12a protein was used as the optimal final concentration of the CRISPR reaction, and the optimal concentration was used to further optimize the final concentration of ssDNA in the CRISPR reaction system.

[0046] Next, select 10 6The recombinant plasmid DNA of large ribosomal subunit RNA with 100 copies / μL was used as a template, and the RPA-CRISPR reaction was performed according to step 3 of Example 1. In the reaction, 20 nM, 40 nM, 60 nM, 80 nM, and 100 nM ssDNA were used as one of the substrates for Cas12a protein cleavage, indicating the generation of RPA products. At the same time, the above concentrations of ssDNA were used respectively, and ddH2O without DNA was used as a negative control. The negative controls were recorded as NTC1 to NTC5. The results are shown in Figure 3 As shown, when the ssDNA with different final concentrations provided was used for the reaction, obvious fluorescence curves were generated, and the negative control groups NTC1 to NTC5 did not produce obvious fluorescence signals. Figure 4 As shown in the figure, when 20 nM, 40 nM, 60 nM, and 80 nM ssDNA were used, the fluorescence gradually increased. When 100 nM ssDNA was used, the fluorescence intensity decreased, and the negative control group NTC1 to NTC5 did not produce obvious fluorescence signals. Therefore, 80 nM ssDNA was selected as the optimal final concentration of the CRISPR reaction for subsequent experiments.

[0047] Example 3: The RPA primers and crRNA sequences in Example 1 were used to conduct a specific experiment on G. auris.

[0048] The method of step 2 of the above embodiment 1 was used to extract the genomic DNA of shrimp tissue samples positive for Gp, Neobenedenia meishi Nm, Cryptocaryon Ci, and Enterocytosis hepaticus Eh, Anisakis Ap, Ha, Vibrio anguillarum Va, Pseudomonas aeruginosa Pp, and liver tissue of Pa (without Gp, and Gp, DNA), and ddH2O without DNA was used as a template as a negative control, recorded as NTC. The RPA-CRISPR reaction was performed with the optimal final concentration of 50 nM Cas12a protein and 80 nM ssDNA screened in Example 2. The results are shown in the figure. Figure 5 As shown, when the genomic DNA of the sweet fish worm is used as a template, an obvious fluorescence curve can be observed. When the other DNAs provided above are used as templates, no obvious amplification is observed. The experimental results can also be directly interpreted by the color change of the reaction product, such as Figure 6 As shown, the reaction product is green when the genomic DNA of Ayugulidae is used as a template, and the product is colorless when other DNA is used as a template. This shows that the primer set has a strong specificity with crRNA.

[0049] Example 4: Use the RPA primers and crRNA sequences in Example 1 to perform sensitivity determination of the sweetfish worm.

[0050] The recombinant plasmid DNA of the large ribosomal subunit RNA extracted by the method of step 2 of the above embodiment 1 was adjusted to a concentration of 10 7 copies / μL, and perform 10-fold gradient dilution. Select a concentration of 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL, 10 1 copies / μL, 10 0 The recombinant plasmid DNA of large ribosomal subunit RNA with 100 copies / μL was used as template for RPA-CRISPR reaction, and ddH2O without DNA was used as template as negative control, which was recorded as NTC. Figure 7 As shown, when using 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL, 10 1 copies / μL, 10 0 When the large ribosomal subunit RNA recombinant plasmid DNA with 100 copies / μL was used as a template, a positive amplification curve was obtained. However, when ddH2O without DNA was used as a template, no obvious amplification was observed. Figure 8 As shown in Figure 2, the fluorescence intensity of the amplified protein decreases as the template concentration decreases. Fig. 9 As shown, when using 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL, 10 1 copies / μL, 10 0 When the large ribosomal subunit RNA recombinant plasmid DNA with 200 copies / μL was used as a template, the product in the reaction tube was green; when ddH2O without DNA was used as a template, the product in the reaction tube was colorless and transparent. Considering that 2 μL of DNA template was added to the reaction system, the above results show that the detection sensitivity of the RPA-CRISPR reaction is 2 copies / reaction.

[0051] Example 5: Use the RPA primers and crRNA sequences in Example 1 to detect sweetfish samples.

[0052] 15 sweetfish samples were collected, and white heteroplastic tumors were collected and sample DNA was extracted according to the method of step 2 of the above embodiment 1. If no obvious white heteroplastic tumor was found, liver and kidney tissues of the sweetfish were taken and mixed in equal mass. Genomic DNA was extracted according to the method of step 2 of the above embodiment 1. After identification using the PCR method (the nucleotide sequence of Gp-PF is shown in SEQ ID NO.4: 5'-AAGGGATCTCTAGGCTCG-3', and the nucleotide sequence of Gp-PR is shown in SEQ ID NO.5: 5'-TCTCCTTGGTCCGTGTTTC-3'), 12 of the 15 samples tested positive for the sweetfish larvae, and 3 tested negative, as shown in FIG. Fig.11 As shown, S1-S12 are DNAs of isolated white heteroplastic tumors, S13-S15 are DNAs of sweetfish tissues from which white heteroplastic tumors were not isolated, and no obvious amplification was observed when ddH2O without DNA was used as a template. RPA-CRISPR test was performed according to step 3 of the above embodiment 1, and the results are shown in FIG. Fig.10 and Fig.11 As shown, 12 samples identified as positive by PCR were positive by RPA-CRISPR detection, and 3 samples identified as negative by PCR were negative by RPA-CRISPR detection. No color reaction was observed when ddH2O without DNA was used as a template, indicating that the RPA-CRISPR / Cas12a-based rapid detection kit for C. ayuensis was stable and reliable, and could be used for the detection of C. ayuensis-infected sweetfish samples.

[0053] The above description is not intended to limit the present invention, and the present invention is not limited to the above examples. Any changes, modifications, additions or substitutions made by a person skilled in the art within the spirit and scope of the present invention shall also fall within the protection scope of the present invention.

Claims

1. A kit for rapid detection of Ayu sutsugamushi based on RPA-CRISPR / Cas12a, characterized in that The kit includes a pair of RPA specific primers and a crRNA sequence designed according to the RNA sequence of the large ribosomal subunit of the sweet fish, the nucleotide sequence of the forward primer Gp-RPA-F of the RPA specific primer is shown in SEQ ID NO.1: 5'-TTCCTGCAGTAGCGGCGAGCGAAGAAGGACCAG-3'; the nucleotide sequence of the reverse primer Gp-RPA-R of the RPA specific primer is shown in SEQ ID NO.2: 5'-CCAAACACTACTACTCATCCTTTCACGC TGTAC-3'; the nucleotide sequence of the crRNA is shown in SEQ ID NO.3: 5'-UAAUUUCUACUAAGUGUA GAUGGUAACGAGAUGUCAUGGACGCG-3', and also includes an RPA reaction system and a CRISPR reaction system. The formula of the RPA reaction system is as follows: 29.4 μL of RPA reaction reagent, 2 μL of 10 μmol / L primer Gp-RPA-F, 10 μmol / L primer Gp-RPA-R 2μL, 280mmol / L magnesium acetate 2.5μL, DNA template 2μL and ddH2O 12.1μL, the formula of the CRISPR reaction system is as follows: 2μL RPA reaction product, Cas12a protein with a final concentration of 20-60nM, 5μL 10×Reaction buffer 1, crRNA with a final concentration of 50nM, ssDNA with a final concentration of 20-100nM, and finally ddH2O is added to make the total volume of the CRISPR reaction system 50μL, wherein the ssDNA is FAM-TT ATT-BHQ-1.

2. A kit for rapid detection of Ayu sutsugamushi based on RPA-CRISPR / Cas12a according to claim 1, characterized in that: The final concentration of the Cas12a protein is 50 nM, and the final concentration of the ssDNA is 80 nM.

Images