An electrochemical sensor for detecting EGFR gene mutation and preparation method thereof

Abstract

The present invention discloses an electrochemical sensor for detecting EGFR gene mutation and a preparation method thereof, and belongs to the field of biosensor technology. The present invention solves the problems of complex data processing, high cost, long detection cycle and high invasiveness in the detection method of EGFR mutant genes in the prior art. The present invention designs a pair of stem-loop sequence primers to replace conventional LAMP primers, avoiding nonspecific amplification caused by cross-hybridization between multiple primers; GDY-Au TNPs are used as a sensing platform to improve detection sensitivity, and methylene blue-single-stranded DNA is modified as a reporter gene. When the target DNA is present in the LAMP product, a DNA / crRNA / Cas12a triplet complex is formed, the trans-cutting ability of Cas12a is activated, the reporter gene is cut, the redox mediator on the electrode is changed, and the entire signal change is detected by an electrochemical method. The present invention achieves the purpose of detecting EGFR gene mutations instantly, quickly and at low cost, and provides strong technical support for clinicians to diagnose diseases and evaluate treatment effects.

Description

Technical Field

[0001] The invention belongs to the technical field of biosensors, and in particular relates to an electrochemical sensor for detecting EGFR gene mutation and a preparation method thereof. Background Art

[0002] EGFR belongs to the receptor tyrosine kinase family and is closely related to the activation of cell signaling pathways, including cell proliferation and apoptosis protection. Related studies have shown that EGFR is overexpressed in a variety of tumors, especially non-small cell lung cancer (NSCLC). Tyrosine kinase inhibitors designed through EGFR can significantly improve the clinical course of NSCLC, but are only effective for tumors carrying EGFR gene activating mutations. This mutation mainly exists in exons 18-21 of the tyrosine kinase region, of which EGFR 19 deletion (del E746-A750) and EGFRL858R point mutations account for 90%. EGFR 19 deletion occurs most frequently, accounting for about 48%.

[0003] At present, the preferred method for EGFR mutation gene detection is still gene sequencing, including Sanger sequencing, high-throughput sequencing (Next Generation Sequencing, NGS), single-molecule sequencing, etc. As the gold standard for gene detection, it can not only detect the presence of mutations, but also determine the location of mutations, and can detect multiple mutations at the same time. However, this detection method has the following defects:

[0004] 1. Complex data processing: Due to the huge amount of data generated by gene sequencing, data processing and analysis require complex algorithms and computing resources, and therefore require professional technology and equipment support.

[0005] 2. Expensive: Although the cost of sequencing has been greatly reduced with the advancement of technology, it is still an expensive technology, especially in large-scale sequencing or personalized medicine.

[0006] 3. Long detection cycle: The detection cycle of gene sequencing can be completed in a few days at the shortest and several weeks at the longest, depending on factors such as the laboratory's experimental process, equipment performance, the complexity of data processing and analysis, and the laboratory's workload.

[0007] 4. Highly invasive: Gene sequencing samples for tumors often require obtaining patient lesion samples, which may cause irreversible trauma to the patients. Summary of the invention

[0008] In view of the problems of complex data processing, high cost, long detection cycle and high invasiveness in the detection methods of EGFR mutant genes in the prior art, the present invention provides an electrochemical sensor for detecting EGFR gene mutation and a preparation method thereof.

[0009] The technical solution adopted by the present invention is as follows:

[0010] An electrochemical sensor for detecting EGFR gene mutations, comprising a sensor platform, a ligation-initiated LAMP target nucleic acid amplification system, and a Cas12a-crRNA duplex;

[0011] The sensor platform comprises a working electrode and a composite nanolayer with conductive properties modified on the surface of the working electrode, wherein a DNA monolayer composed of a reporter gene is arranged on the composite nanolayer, and the reporter gene is methylene blue-single-stranded DNA (MB-ssDNA);

[0012] The ligation-initiated LAMP target nucleic acid amplification system comprises: a stem-loop LAMP probe LP, a stem-loop LAMP probe LP-PAM, a front inner primer FIP, and a back inner primer BIP. The ligation-initiated LAMP target nucleic acid amplification system is used to amplify the target nucleic acid through the ligation-initiated LAMP and obtain a DNA structure mixture;

[0013] The Cas12a-crRNA duplex is used to specifically recognize the E746-A750 deletion mutant gene Mut DNA of the EGFR gene in the DNA structure mixture, and activates the trans-cleavage activity of Cas12a after recognition, and non-specifically cuts the reporter gene off from the working electrode.

[0014] Furthermore, the composite nanolayer (GDY-AuTNPs) is a composite nanolayer (GDY-AuTNPs) of flaky graphene (GDY) modified with polylysine and gold nanoparticles with a triangular nanosheet morphology.

[0015] Furthermore, the gene sequence of the stem-loop LAMP probe LP is:

[0016] P / TTGATAGCGATTTATCGTCGTGACTGTTTGTAATAGGACAGAGCCCCGCACTTTCAGTCACGACGAT;

[0017] The gene sequence of the stem-loop LAMP probe LP-PAM is:

[0018] CGACAGCAGAGGATTTGTTGTGTGGAAGTGTGAGCGGATTTTCCTCTGCTGTCGTTTGCGGAGATGTT.

[0019] Further, the gene sequence of the amplification front inner primer FIP is:

[0020] ATCGTCGTGACTGAAAGTGCGGGGCCTCTGTCCTATTAC;

[0021] The gene sequence of the inner primer BIP after amplification is:

[0022] CGACAGCAGAGGATTTGTTGTGTGGAAGTGTGAGCGGA.

[0023] Further, the gene sequence of crRNA in the Cas12a-crRNA duplex is:

[0024] UAAUUUCUACUAAGUGUAGAUCGGAGAUGUUUUGAUAGCGA.

[0025] Preferably, the working electrode is a glassy carbon electrode.

[0026] A method for preparing an electrochemical sensor for detecting EGFR gene mutations comprises the following steps:

[0027] Step A: preparing composite nanomaterials;

[0028] Step B: using the composite nanomaterial prepared in step A to modify the working electrode, and connecting methylene blue-single-stranded DNA to the composite nanolayer to obtain a sensor platform;

[0029] Step C: constructing a ligation-initiated LAMP target nucleic acid amplification system;

[0030] Step D: Construction of Cas12a-crRNA duplex.

[0031] Furthermore, the composite nanomaterial is a composite nanomaterial of Graphene sheet modified by polylysine and gold nanoparticles with triangular nanosheet morphology. The detailed steps of preparing the composite nanomaterial in step A include:

[0032] Step A1: modifying the graphene sheet using polylysine;

[0033] Step A2: preparing gold nanoparticles with triangular nanosheet morphology by using a seed growth method;

[0034] Step A3: gold nanoparticles with a triangular nanosheet morphology are modified on the surface of polylysine-modified flaky graphyne by electrostatic adsorption to obtain a composite nanomaterial.

[0035] Furthermore, the specific steps of obtaining the sensor platform in step B are as follows:

[0036] Step B1: adding a composite nanomaterial to the working electrode to obtain a working electrode modified with the composite nanomaterial;

[0037] Step B2: The reporter gene is connected and fixed on the working electrode modified with the composite nanomaterial by reducing the thiol group to obtain a sensor platform.

[0038] In summary, due to the adoption of the above technical solution, the beneficial effects of the present invention are:

[0039] 1. The present invention can quickly detect EGFR gene mutations in samples to be tested, and can reduce the time for diagnosis and treatment based on the quantitative results and combined with clinical symptoms. From the beginning of detection to the diagnosis and treatment results, only sampling, processing, loading, displaying results, scanning and interpretation of results, and consultation are required, which only takes 5-10 minutes. The traditional examination mode of medical treatment: going back and forth to the hospital, queuing for registration and payment, sampling, testing, and doctor's diagnosis and treatment, which takes at least 6 hours.

[0040] 2. In the present invention, the specific amplification initiated by LAMP primers and the target recognition and activation cutting ability of the CRISPR / Cas12a system double guarantee the specificity of the sensing detection. The LAMP connection starter primer designed according to the target mutant DNA can specifically identify the target DNA, and the CRISPR / Cas12a system further specifically recognizes the LAMP product through crRNA and activates the nuclease activity of Cas12a, achieving the effect of dual specific recognition of the target mutant DNA.

[0041] 3. The present invention uses the composite nanomaterial GDY-Au TNPs with excellent performance to improve the overall sensitivity of the sensing strategy. The unique large crystal surface of Au TNPs can adhere tightly to the surface of GDY, making GDY-Au TNPs a nanomaterial with high carrier mobility that uses thiol groups to adsorb and fix nucleic acids, and provides a highly active and large-area binding microenvironment for single-stranded reporter genes, thereby further improving the sensitivity of the designed sensing technology.

[0042] 4. The present invention adopts the LAMP started by connection to amplify the nucleic acid target of sequence specificity on the one hand, designs a pair of stem-loop sequence primers to replace the 4-6 primers required for conventional LAMP, and avoids the non-specific amplification produced by cross-hybridization between multiple primers. On the other hand, GDY-Au TNPs are used as a sensing platform to improve the sensor detection sensitivity, and methylene blue-single-stranded DNA (MB-ssDNA) is modified as a reporter gene. Subsequently, the cutting ability of Cas12a is used to complete the purpose of identifying and detecting targeted DNA. When there is target DNA in the LAMP product, DNA / crRNA / Cas12a triplet complex is formed, the trans-cutting ability of Cas12a is activated, the MB-ssDNA reporter gene on the electrode surface is cut, the redox mediator on the electrode is changed, and the whole signal change is detected by an electrochemical method. The recognition activation cutting ability of LAMP primer-specific amplification and CRISPR / Cas12a systems has effectively guaranteed the specificity of detecting the target DNA. Compared with traditional mutation nucleic acid detection methods, this project has better detection performance and efficient detection speed. In addition, the sensor detection mediated by a portable electrochemical workstation gives this project the advantages of "immediate, fast, and low-cost", providing strong technical support for clinicians to diagnose diseases and evaluate treatment effects. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] Figure 1 It is a schematic diagram of the principle of the present invention;

[0044] Figure 2 is a control graph of SWV detection with or without EGFR-Mut DNA;

[0045] Figure 3 Figures 1 and 2 are characterization diagrams of various substances in the preparation process of composite nanomaterials, among which Figures A to C are TEM images of Au TNPs at different magnifications; Figures D and E are IFFT images of the selected area in Figure C; Figure F is the SEM image of GDY; Figure G is the SEM image of GDY-AuTNPs; Figure H is an enlarged image of the selected area in Figure G; I is the energy spectrum of different elements in GDY-Au TNPs, among which I(a) is the SEM image; I(b) is the full image; I(c) is the carbon element image, and I(d) is the gold element image;

[0046] Figure 4 This is the EDS analysis diagram of GDYAu TNPs;

[0047] Figure 5 The graphs are the conductivity results of the electrodes, wherein (A) is the conductivity result of different materials analyzed using DPV; (B) is the conductivity result of polylysine-modified GDY analyzed using CV;

[0048] Figure 6 The figure is a result diagram of the whole process of LAMP amplification verified by PAGE, wherein Figure (A) is a gel electrophoresis diagram of PAGE verifying the connection of dumbbell-shaped primers; Figure (B) is a gel electrophoresis diagram of the LAMP process; Figure (C) is a result diagram of dye verification of amplification;

[0049] Figure 7 The result diagram of the whole process of constructing the sensing strategy for electrochemical measures verification, wherein Figure (A) is a result diagram of the construction of the sensor verified by CV; Figure (B) is a result diagram of the construction of the sensor verified by EIS; Figure (C) is a result diagram of the trans-cutting performance of Cas12a verified by EIS; Figure (D) is a result diagram of the trans-cutting performance of Cas12a verified by SWV;

[0050] Figure 8 Figure 1 is a performance test result diagram under different experimental conditions, wherein Figure (A) is an electrical performance test result diagram under different LAMP temperatures; Figure (B) is an electrical performance test result diagram under different times; Figure (C) is an electrical performance test result diagram under different Cas12a trans-cleavage times;

[0051] Fig. 9 The detection sensitivity results of the sensing strategy are shown in Figure 1, where Figure 1 (A) is the SWV curve of Mut DNA at different concentrations; Figure 1 (B) is the calibration curve of Mut DNA at different concentrations (a–h: 1 μM–100 fM, i: blank control);

[0052] Fig.10 The figures are the performance test result graphs of the sensors, wherein Figure (A) is the reproducibility result graph of the sensor used for Mut DNA detection; Figure (B) is the stability result graph of the sensor used for Mut DNA detection; and Figure (C) is the specificity result graph of the sensor used for Mut DNA detection. DETAILED DESCRIPTION

[0053] In order to make the purpose, technical solutions and advantages of the embodiments of the present application clearer, the technical solutions in the embodiments of the present application will be clearly and completely described below in combination with the drawings in the embodiments of the present application. Obviously, the described embodiments are only part of the embodiments of the present application, not all of the embodiments.

[0054] Preparation Example 1

[0055] Preparation of composite nanomaterials:

[0056] Step A1: modifying the graphene sheet using polylysine;

[0057] Polylysine (1 mg) was dissolved in 1 mL Tris-HCl buffer (10 mM, pH 7.4), and the mixture was sonicated for 40 min; 1 mg GDY was then added, and the mixture was stirred at room temperature overnight. The product was centrifuged and washed several times with ethanol and ultrapure water, and the precipitate was redistributed in Tris-HCl buffer (10 mL, 10 mM) for subsequent use;

[0058] Step A2: preparing gold nanoparticles with triangular nanosheet morphology by using a seed growth method;

[0059] Step A21: prepare a gold seed solution, add HAuCl4 solution (5 μL, 25 mM) to hexadecyltrimethylammonium chloride solution (CTAC, 0.47 mL, 0.10 M), inject freshly prepared NaBH4 solution (30 μL, 10 mM) under vigorous stirring at room temperature, and allow to react for 2 hours;

[0060] Step A22: Two sets of growth solutions were prepared for the subsequent growth of Au seeds: Growth solution A: CTAC solution (1 mL, 0.1 M) was added to 5 mL of ultrapure water, KI solution (50 μL, 10 mM) and HAuCl4 solution (50 μL, 25 mM) for later use. Growth solution B: KI solution (800 μL, 10 mM) and HAuCl4 solution (2 mL, 25 mM) were added to CTAC solution (80 mL, 0.1 M) for later use.

[0061] Step A23: Au TNPs were obtained using the gold seed growth method as follows: 25 μL and 800 μL of L-ascorbic acid solution (AA, 0.10 M) were added to growth solutions A and B, respectively. After both growth solutions A and B became transparent, the solutions were slowly stirred and 125 μL of a 10-fold diluted Au seed solution was added to growth solution A. Subsequently, growth solution A was quickly added to B, and the mixture was gently stirred for a few seconds. Then, CTAC solution (1.2 mL, 1.0 M) was added, and the mixture was left overnight. Finally, the supernatant was removed using high-speed centrifugation, and the precipitate was ultrasonically dispersed in 10 mL of ultrapure water to obtain an Au TNPs dispersion;

[0062] Step A3: gold nanoparticles with a triangular nanosheet morphology are modified on the surface of the polylysine-modified Graphdine sheet by electrostatic adsorption to obtain a composite nanomaterial;

[0063] The GDY solution modified with polylysine was mixed with the Au TNPs dispersion at a volume ratio of 1:1 and stirred at room temperature for 1 hour to obtain a GDY-Au TNPs dispersion.

[0064] The prepared Au TNPs were subjected to TEM analysis. Figure 3 A and B show that the prepared Au TNPs have a relatively uniform and regular triangular structure. High-resolution transmission electron microscopy images show clear lattice fringes ( Figure 3 C); the Fast Fourier inverse transform (IFFT) image of the selected area is as follows Figure 3 E. The intensity distribution of four lines with a crystal plane distance of 0.934nm ( Figure 3 D) and 0.234nm lattice fringe spacing ( Figure 3 C). This is consistent with the crystal structure of Au TNPs, indicating the successful preparation of the material. Figure 3 F shows that GDY is composed of stacked layered structures. In addition, scanning electron images of GDY-Au TNPs at different magnifications show that triangular particles are embedded on GDY ( Figure 3 G, H), confirming the successful modification of Au TNPs on GDY. Energy dispersive X-ray spectroscopy (EDS) of the sample surface confirmed the presence of Au and C elements in GDY-AuTNPs ( Figure 3 I), EDS spectrum analysis shows the specific ratio of elements ( Figure 4 ), further proving the successful preparation of GDY-AuTNPs nanomaterials.

[0065] Preparation Example 2

[0066] Preparation of sensor platform:

[0067] Step B1: Using a glassy carbon electrode (GCE) as a working electrode, the glassy carbon electrode was first pretreated: GCE was polished with 0.3 μm and 0.05 μm alumina powders, respectively, and ultrasonically treated in acetone, ethanol and ultrapure water for 3 min, and then dried naturally at 22°C. A fresh mirror-like GCE electrode was obtained; then, 5 μL of the GDY-Au TNPs dispersion prepared in Preparation Example 1 was dripped onto the surface of the smooth GCE electrode, and the GCE / GDY-AuTNPs electrode was obtained by natural drying at 22°C.

[0068] Step B2: The reporter gene is connected and fixed on the working electrode modified with the composite nanomaterial by reducing the thiol group to obtain a sensor platform.

[0069] In a dark environment, 0.5 μL 0.5 M TCEP (tris(2-carboxyethyl) phosphine hydrochloride) was mixed with 10 μL 15 μM thiol-modified MB-ssDNA, and reacted at 22°C for 30 min to reduce it to a single strand with exposed thiol groups. 5 μL was directly incorporated into the GCE / GDY-Au TNPs electrode obtained in step B1, and incubated in a dark room at 37°C for 30 min to obtain a GCE / GDY-AuTNPs / ssDNA electrode, and then the electrode was rinsed with 10 mM Tris-HCl buffer (pH 7.4). The cleaned electrode was then immersed in a 10 mM Tris-HCl solution (pH 7.4) containing 1 mM MCH for 1 h to passivate the surface and obtain a well-arranged DNA monolayer to complete the construction of the sensor.

[0070] Example

[0071] An electrochemical sensor for detecting EGFR gene mutations, the electrochemical sensor comprising a sensor platform obtained in Preparation Example 2, a connected and initiated LAMP target nucleic acid amplification system and a Cas12a-crRNA duplex (Cas12a and crRNA in the Cas12a-crRNA duplex are not connected, but crRNA is required for guidance during use, so Cas12a and crRNA are named Cas12a-crRNA duplex);

[0072] The ligation-initiated LAMP target nucleic acid amplification system comprises: a stem-loop LAMP probe LP, a stem-loop LAMP probe LP-PAM, a front inner primer FIP, and a back inner primer BIP. The ligation-initiated LAMP target nucleic acid amplification system is used to amplify the target nucleic acid through the ligation-initiated LAMP, and the final product is a mixture of DNA structures with different stem lengths and multiple rings ( Figure 1 A), which contains a large number of Mut DNA sequences. The entire LAMP amplification process was verified by polyacrylamide gel electrophoresis (PAGE), and orange-green color-changing reagent tubes were used to achieve visual verification of the amplification process (positive is yellow-green, negative is orange). The sequences involved in this project are shown in Table 1:

[0073] Table 1

[0074]

[0075] The detailed process of LAMP initiated by the connection includes two steps:

[0076] (a) Ligation of dumbbell primers. 1 μL of Mut DNA, 2 μL of 5 μM LP, 2 μL of 5 μM LP-protospacer adjacent motif (PAM), 2 μL of 10×T4 DNA ligase reaction buffer, and 12 μL of RNase-free water were mixed to a final volume of 19 μL. The mixed system was annealed at 95°C, 75°C, 52°C, and 37°C for 5 min, 30 s, 30 s, and 5 min, respectively, and stored at 4°C. Then 1 μL of 10 U / μL T4 DNA ligase was added, and the mixture was incubated at room temperature for 2 h and inactivated at 95°C for 5 min, with a final volume of 20 μL. The mixed system was annealed at 95°C, 75°C, 52°C, and 37°C for 5 min, 30 s, 30 s, and 5 min, respectively, and stored at 4°C. Then, 1 μL of 10 U / μL T4 DNA ligase was added, and the mixture was incubated at room temperature for 2 h and inactivated at 95°C for 5 min to complete dumbbell primer ligation in a final volume of 20 μL.

[0077] (b) Amplification. 4 μL of the ligation product was added to the amplification system, which included 10 μL of 2×Bst 4.0 alkaline mixture (reaction buffer, Mg 2+ , deoxyribonucleic acid triphosphate substrate [dNTP], Bst 4.0 DNA polymerase), 1 μL 16 μM FIP, 1 μL 16 μM BIP and 4 μL RNase-free water. The mixture was incubated at 65°C for 22 min to complete amplification and inactivated at 95°C for 5 min, and then the product was placed on ice;

[0078] The Cas12a-crRNA duplex is used to specifically recognize the E746-A750 deletion mutant gene Mut DNA of the EGFR gene in the DNA structure mixture, and activates the trans-cleavage activity of Cas12a after recognition, and non-specifically cuts the reporter gene off from the working electrode.

[0079] With Mut DNA as the template target, two stem-loop LAMP probes (LP and LP-PAM) are rationally designed. Each probe contains a universal stem-loop sequence (gray) and a sequence that specifically complements Mut DNA (blue), and is complementary to half of the sequence of Mut DNA. In the presence of Mut DNA, the two primers are connected to form a dumbbell-shaped DNA primer under the action of T4 DNAligase, which is the starting material for the LAMP cyclic amplification step. Next, under isothermal conditions and the presence of Bst DNA polymerase, the forward inner primer and the backward inner primer (FIP, BIP) can continuously and repeatedly initiate the efficient and rapid amplification of LAMP. The final product is a mixture of DNA structures with different stem lengths and multiple rings (only one structure is drawn here for illustration), which contains a large number of Mut DNA sequences.

[0080] Based on the target's PAM sequence and specially designed guide RNA (crRNA) complementary to the target Mut DNA, the Cas12a-crRNA duplex is pulled to specifically recognize the Mut DNA. When Mut DNA is present, the Cas12a protein recognizes the PAM sequence and acts as a helicase to unwind the target DNA, while activating the trans-cleavage activity of Cas12a, non-specifically cutting the MB-ssDNA reporter gene off the electrode surface, resulting in a significant decrease in the electrical signal, the degree of which depends on the original target dose ( Figure 1 B).

[0081] For electrochemical measurements of CRISPR / Cas12a-mediated trans-cleavage, 1 μL of 1 μM LbaCas12a(Cpf1), 1 μL 10× NE buffer TM r2.1, 1 μL 20 μM crRNA and 6 μL double distilled water (dd H2O) were mixed, and then 1 μL LAMP amplification product was added to activate the cleavage activity of Cas12a, which was incubated on the constructed electrode. The electrode was then rinsed with 10 mM Tris-HCl buffer, dried, and stored at 4 ° C for a short time for subsequent electrochemical detection process.

[0082] Electrochemical detection: All electrochemical tests were performed using a Chenhua electrochemical workstation, which includes a three-electrode system, in which GCE, silver chloride electrode, and platinum wire electrode were used as working electrode, reference electrode, and auxiliary electrode, respectively. 3- / 4-Cyclic voltammetry (CV), electrochemical impedance spectroscopy (EIS), and differential pulse voltammetry (DPV) were performed in an electrolyte (10 mL). The voltage range of CV was -0.1 to 0.6 V, and the scan rate was 50 mV / s. The open circuit voltage of EIS was 0.24 V, and the frequency range was 0.1 to 10 5 Hz, with an amplitude of 50 mV. The voltage range of DPV was -0.2 to 0.6 V, the potential increment was 4 mV, the amplitude was 0.05 V, and the pulse width was 0.2 s. Square wave voltammetry (SWV) detection was performed in an electrolyte (10 mL) containing 0.1 M NaCl and 10 mM Tris-HCl buffer. The potential range was -0.5 to 0.1 V, the voltage increment was 2 mV, the amplitude was 25 mV, and the frequency was 15 Hz.

[0083] The relevant tests are as follows:

[0084] (1) Figure 1 As shown in B, GDY-Au TNPs were electrostatically modified on GCE, and then the MB-ssDNA reporter gene was fixed using thiol groups and passivated using MCH to obtain a well-arranged DNA monolayer. Importantly, based on the target's PAM sequence and the specially designed crRNA complementary to the target DNA, the Cas12a-crRNA duplex was guided to specifically recognize Mut DNA. In the absence of target DNA, the cleavage activity of the Cas12a nuclease is not activated, and the MB-ssDNA reporter gene remains on the electrode surface, generating a significant electrochemical peak signal. However, when Mut DNA is present, the Cas12a protein recognizes the PAM sequence and unfolds the target DNA as a helicase, while activating the trans-cleavage activity of Cas12a, non-specifically cutting the MB-ssDNA reporter gene off the electrode surface, resulting in a significant decrease in the electrical signal, the degree of which depends on the original target dose ( Figure 2 ).

[0085] (2) The conductivity of the electrode directly affects the sensitivity of the electrochemical biosensor. In the embodiment, the conductivity of GDY-Au TNPs was verified by DPV test, such as Figure 5As shown in A, the electrical signals of GDY, Au NPs or Au TNPs modified alone are higher than those of bare GCE, indicating that all three are materials with good electrical conductivity, among which the modified Au TNPs have higher electrical conductivity than Au NPs. This may be due to its triangular structure, which allows Au TNPs to adhere better to the GCE surface, which enhances the contact area with the electrode surface and accelerates the migration of electrons on the working electrode surface. In addition, the synergistic effect produced by the bridging effect of Au TNPs and GDY nanosheets may lead to GDY-Au TNPs having better carrier mobility than GDY-Au NPs. Therefore, these results indicate that GDY-Au TNPs are ideal materials for modifying the sensing interface for nucleic acid detection.

[0086] It is worth noting that GDY has poor water dispersibility. In this study, polylysine was used to improve its dispersibility in water. Figure 5 As shown in B, it can be intuitively seen that its water dispersibility is improved, and through CV detection, it is known that the modified GDY presents a higher electrical signal, which is more conducive to its use as a base material to improve the sensitivity of the entire sensor.

[0087] (3) PAGE electrophoresis to verify the entire LAMP amplification process

[0088] Polyanilamide gel electrophoresis (PAGE) was used to analyze the connection of dumbbell primers during LAMP amplification. Figure 6 A) To successfully complete the connection of dumbbell primers, hairpin primers LP and LP-PAM, Mut DNA and T4 DNA ligase are indispensable. In addition, Wt DNA cannot complete the connection of dumbbell primers, indicating that the designed hairpin primers can achieve the purpose of specific recognition. The dumbbell primers that are successfully connected have a larger molecular weight, run slower during electrophoresis, and the observed band position is higher (band 6).

[0089] Subsequently, the LAMP amplification process was studied by PAGE, such as Figure 6 B, FIP and BIP bands alone cannot initiate amplification (band 1), and amplification is still not possible when unlinked LP and LP-PAM are introduced (band 2). When dumbbell-shaped primers are added (MutDNA concentration is 1 μM), electrophoresis shows high-brightness waterfall-like ladder bands (band 3), and a mixture of DNA with different lengths appears, indicating the successful amplification of LAMP. In addition, in order to verify that the amount of LAMP product is related to the Mut DNA concentration, an electrophoresis with a Mut DNA concentration of 0.1 μM was also prepared (band 4), and waterfall-like ladder bands appeared with reduced brightness, indicating that the amount of LAMP product is related to the Mut DNA concentration.

[0090] Note that since the LAMP product contains pyrophosphate ions precipitated from deoxyribonucleic acid triphosphate substrates (dNTPs), after the introduction of the OG orange-green color-changing dye, it exhibits obvious fluorescent green, while the negative color of the unamplified product is orange ( Figure 6 C), this feature can be used to achieve the purpose of preliminary qualitative analysis of Mut DNA in samples.

[0091] (4) Electrochemical characterization of step-by-step modified electrodes

[0092] CV measurements can be used to demonstrate the layer-by-layer modification of the sensor ( Figure 7 A), compared with the GDY and Au TNPs modified materials on the electrode, the composite material GDY-Au TNPs showed a higher redox peak, which is due to the good synergistic effect of the two in promoting electron transfer. At the same time, the electrochemical properties of the immunosensor were monitored by EIS ( Figure 7 B), In the Nyquist plot, the diameter of the semicircular domain is the smallest after coating with GDY-Au TNPs, which means a relatively low electron transfer resistance (Ret), a finding consistent with the CV results.

[0093] The cleavage performance of CRISPR / Cas12a was verified by EIS. Figure 7 C. GCE / GDY-Au TNPs exhibit excellent electrochemical conductivity. After MB-ssDNA is fixed on GCE / GDY-Au TNPs, the diameter of the semicircular domain in the Nyquist plot increases sharply and the Ret value increases, which may be attributed to the electrostatic repulsion between the negatively charged MB-ssDNA monolayer and [Fe(CN)6]3- / 4- and the increase in the electron transfer distance caused by it. Subsequently, after treatment with the Cas12a-crRNA target DNA triplet, most of the MB-ssDNA has been cut and washed off from the surface of the GCE / GDY-AuTNPs electrode due to the activation of the cleavage activity of Cas12a. As expected, Ret shows a significant decrease. The results show that the MB-ssDNA monolayer was successfully modified on the surface of the GCE / GDY-AuTNPs electrode and CRISPR / Cas12a trans-cleavage and cleavage of ssDNA was completed. In addition, the feasibility of the biosensor was evaluated using SWV, such as Figure 7 As shown in D, GCE and GCE / GDY-AuTNPs electrodes have no obvious current peaks, and after modification with MB-ssDNA, a significant current peak is generated near -0.2 V. However, after being treated with Cas12a-crRNA target DNA triplet, the current peak of MB drops sharply, further confirming the successful incubation of MB-ssDNA and the release of MB on the biosensor surface.

[0094] (5) Optimization of experimental conditions

[0095] The reaction temperature of LAMP not only affects the hybridization efficiency of primers (FIP and BIP), but also affects the activity of DNA polymerase. Therefore, the effect of amplification temperature on Mut DNA detection was investigated by testing samples at different LAMP temperatures. Figure 8 A), the electrical signal is best when the temperature is 65℃, indicating that the LAMP efficiency is highest at 65℃. Therefore, 65℃ is selected as the optimal temperature for LAMP. On the other hand, by optimizing the LAMP time, effective amplification can be obtained in a short time to the greatest extent. This study obtained the optimal amplification time by controlling the LAMP time from 10min to 30min (continuously increasing by 4min). Figure 8 B), the current value decreased with the increase of time until 22 min, after which the current response showed almost no significant change with the extension of time. Therefore, in the subsequent experiments, the LAMP time was set to 22 min.

[0096] In addition, the cleavage time of Cas12a determines the ability of MB to fall off, thereby determining the sensitivity of detecting Mut DNA. Therefore, the effect of cleavage time from 15min to 40min (continuously increasing by 5min) on the current value of the developed sensor was studied ( Figure 8 C), the current value decreases with time until 30 min, and then shows a stable trend, indicating that extending the cutting time after 30 min cannot effectively cause MB-ssDNA to fall off, so 30 min is selected as the optimal reaction time for Cas12a cleavage.

[0097] (6) Sensor detection performance

[0098] Based on the above results, the developed electrochemical biosensor was used to detect Mut DNA with a serial dilution of 10 times for detection performance analysis. Under the best optimized conditions, the SWV peak value increased as the target concentration decreased ( Fig. 9 A), plot the curve based on the Mut DNA concentration and the corresponding peak signal ( Fig. 9 B), it was found that there was a good linear relationship between the current value and the logarithmic MutDNA concentration when the target concentration was between 1 μM and 100 fM ( Figure 5 B illustration), the linear regression equation is Y=0.2893LgC-2.3346, the correlation coefficient R2=0.9942, the LOD is 17fM, and the signal-to-noise ratio (S / N) is 3, where S and N are the standard deviation of the analyte blank sample and the slope of the calibration curve, respectively.

[0099] Compared with previously reported analytical methods for detecting and quantifying nucleic acid targets (Table 2), the biosensor developed in this study showed a wide detection range and a low detection limit, thereby achieving the detection of target mutant DNA. This is due to the high carrier mobility provided by the GDY-Au TNPs sensing platform and the ability of Au TNPs to amplify electrical signals, and the ability of the connected LAMP to efficiently amplify target nucleic acids.

[0100] Table 2

[0101]

[0102] (7) Reproducibility, stability and specificity

[0103] To ensure commercial application, high sensor reproducibility is required. Therefore, five sets of sensor working electrodes were prepared and used to detect Mut DNA (100 nM) under the same experimental conditions, and the peak signals were recorded before and after the introduction of Cas12a cleavage ( Fig.10 A). The response current values ​​before and after cleavage were generally stable, with RSDs of 1.06%, respectively, indicating that the developed biosensor has good reproducibility.

[0104] For stability testing, the electrodes before and after Cas12a cleavage (Mut DNA concentration was 100 nM) were stored in a sealed box at 4 °C and tested every 3 days ( Fig.10 B), after 9 days, the average values ​​of the electrode electrical signals before and after Cas12a cutting decreased to 97.85% and 95.05% respectively relative to the initial values, and only decreased to 80.60% and 80.34% after 18 days. These results show that the developed biosensor has good stability.

[0105] In order to verify the specificity of the established method for distinguishing trace amounts of mutant DNA, Wt DNA (100 nM) was used as an interference, and different concentrations of Mut DNA (blank control, 1 pM, 100 pM, 10 nM, 1 μM) were mixed in. Then, the mixed samples were tested and the corresponding peak signals were monitored. The results of the tests without Wt DNA interference were compared, as shown in Figure 2 . Fig.10 As shown in Figure C, as the concentration of Mut DNA increases, the peak current gradually decreases, and the current value signal deviation generated by mixing and not mixing Wt DNA interference is not large. This shows that the specific amplification of LAMP primers and the ability of CRISPR / Cas12a system to guide the recognition of target DNA in crRNA double guarantee the specificity of this analysis method.

[0106] (8) Actual sample testing

[0107] The accuracy and clinical potential of the designed detection method were further explored using the standard sample recovery method. The results are listed in Table 3, with a maximum RSD of 8.28% and a recovery rate between 95.81% and 103.20%, indicating that the detection method proposed in this study is expected to be used for the detection of del E746-A750 mutations in EGFR genes in clinical samples.

[0108] Table 3

[0109]

[0110] The above-mentioned embodiments only express the specific implementation methods of the present application, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the protection scope of the present application. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the technical solution concept of the present application, and these all belong to the protection scope of the present application.

Claims

1. An electrochemical sensor for detecting EGFR gene mutation, characterized in that: It includes a sensor platform, a ligation-initiated LAMP target nucleic acid amplification system, and a Cas12a-crRNA duplex; The sensor platform comprises a working electrode and a composite nanolayer with conductive properties modified on the surface of the working electrode, wherein a DNA monolayer composed of a reporter gene is arranged on the composite nanolayer, and the reporter gene is methylene blue-single-stranded DNA; The ligation-initiated LAMP target nucleic acid amplification system comprises: a stem-loop LAMP probe LP, a stem-loop LAMP probe LP-PAM, a front inner primer FIP, and a back inner primer BIP. The ligation-initiated LAMP target nucleic acid amplification system is used to amplify the target nucleic acid through the ligation-initiated LAMP and obtain a DNA structure mixture; The Cas12a-crRNA duplex is used to specifically recognize the E746-A750 deletion mutant gene Mut DNA of the EGFR gene in the DNA structure mixture, and activates the trans-cleavage activity of Cas12a after recognition, and non-specifically cuts the reporter gene off from the working electrode; The composite nanolayer is a composite nanolayer of Graphene sheets modified with polylysine and gold nanoparticles with a triangular nanosheet morphology; The gene sequence of the stem-loop LAMP probe LP is: P / TTGATAGCGATTTATCGTCGTGACTGTTTGTAATAGGACAGAGCCCCGCACTTTCAGTCACGACGAT; The gene sequence of the stem-loop LAMP probe LP-PAM is: CGACAGCAGAGGATTTGTTGTGTGGAAGTGTGAGCGGATTTTCCTCTGCTGTCGTTTGCGGAGATGTT.

2. The electrochemical sensor for detecting EGFR gene mutation according to claim 1, characterized in that: The gene sequence of the amplified front inner primer FIP is: ATCGTCGTGACTGAAAGTGCGGGGCCTCTGTCCTATTAC; The gene sequence of the inner primer BIP after amplification is: CGACAGCAGAGGATTTGTTGTGTGGAAGTGTGAGCGGA.

3. The electrochemical sensor for detecting EGFR gene mutation according to claim 1, characterized in that: The gene sequence of crRNA in the Cas12a-crRNA duplex is: UAAUUUCUACUAAGUGUAGAUCGGAGAUGUUUUGAUAGCGA.

4. The electrochemical sensor for detecting EGFR gene mutation according to claim 1, characterized in that: The working electrode is a glassy carbon electrode.

5. A method for preparing an electrochemical sensor for detecting EGFR gene mutation according to any one of claims 1 to 4, characterized in that: The following steps are involved: Step A: preparing composite nanomaterials; Step B: using the composite nanomaterial prepared in step A to modify the working electrode, and connecting methylene blue-single-stranded DNA to the composite nanolayer to obtain a sensor platform; Step C: constructing a ligation-initiated LAMP target nucleic acid amplification system.

6. The method for preparing an electrochemical sensor for detecting EGFR gene mutation according to claim 5, characterized in that: The composite nanomaterial is a composite nanomaterial of flaky graphene modified with polylysine and gold nanoparticles with a triangular nanosheet morphology. The detailed steps of preparing the composite nanomaterial in step A include: Step A1: modifying the graphene sheet with polylysine; Step A2: preparing gold nanoparticles with triangular nanosheet morphology by using a seed growth method; Step A3: gold nanoparticles with a triangular nanosheet morphology are modified on the surface of polylysine-modified flaky graphyne by electrostatic adsorption to obtain a composite nanomaterial.

7. The method for preparing an electrochemical sensor for detecting EGFR gene mutation according to claim 5, characterized in that: Step B: The specific steps of obtaining the sensor platform are as follows: Step B1: adding a composite nanomaterial to the working electrode to obtain a working electrode modified with the composite nanomaterial; Step B2: The reporter gene is connected and fixed on the working electrode modified with the composite nanomaterial by reducing the thiol group to obtain a sensor platform.

Images