Platycladene sesquiterpene synthase potps1, and encoding gene and application thereof

Abstract

The application relates to a biota sesquiterpene synthase PoTPS1 and a coding gene thereof, the full length of the gene is 1746 bp, the gene codes 582 amino acids, the molecular weight of the enzyme is 67.9 kDa, a pSP-GM1-URA yeast protein expression plasmid is used as a carrier, saccharomyces cerevisiae CEN.PK-5D-113 is used as a host, the biota sesquiterpene synthase PoTPS1 is realized in the heterologous expression of eukaryotic cells, and two kinds of beta-himachalene and cedrol sesquiterpene alcohols can be generated at the same time; a pET22b escherichia coli protein expression plasmid is used as a carrier, anti-freezing protein XXA is added as a fusion tag, escherichia coli BL21 (DE3) is used as a host, the biota sesquiterpene synthase PoTPS1 is realized in the heterologous expression of prokaryotic cells, and a sesquiterpene compound is generated by taking ammonium salt FPP as a substrate.

Description

Technical Field

[0001] This invention belongs to the fields of enzyme engineering and genetic engineering, specifically relating to a sesquiterpene synthase PoTPS1 derived from Platycladus orientalis, its encoding gene, and its applications. Background Technology

[0002] Terpenoids, or isoprene-like compounds, are among the oldest and most diverse small-molecule natural products in nature, originating from a wide range of sources and found in all life forms. To date, over 70,000 individual structures have been reported, and terpenoid molecules with different structures and stereochemicals play crucial roles in plants. The diversity of terpenoid structures is due to the synthesis of two C5 structural units, isopentenyl diphosphate (IPP) and dimethylallyl diphosphate (DMAPP), via the mevalonate pathway (MVA pathway) and deoxyxylulose phosphate pathway (MEP pathway), respectively. The coupling of IPP and DMAPP molecules forms a head-and-tail condensation 1,4 bond, resulting in greanyl diphosphate (GPP), farnesyl diphosphate (FPP), and greanylgreanyl diphosphate (GGPP). Under the action of various terpene synthases, corresponding monoterpenes (C10), sesquiterpenes (C15), and diterpenes (C20 and C25) are generated. Terpenes play a vital role in daily life and are widely used in cosmetics, fragrances, bactericides, and biopharmaceuticals for anticancer and antibacterial purposes.

[0003] β-Cedarene is the main component (75%) of Atlas cedarwood oil. It possesses numerous biological activities, such as antibacterial properties, antioxidant activity, potential applications in food, and anti-inflammatory and antibacterial activity. Additionally, β-himachalene exhibits insecticidal activity, making it a promising candidate for applications in agriculture, cosmetics, food, and pharmaceutical industries.

[0004] Chinese arborvitae (Platycladus orientalis (L.) Franco), also known as flat cypress, yellow cypress, and fragrant tree, is an evergreen tree belonging to the genus Platycladus in the family Cupressaceae. It is distributed throughout China except for Qinghai and Xinjiang. It has a long lifespan, with many trees being over a hundred years old. Chinese arborvitae is drought-tolerant and is often used for afforestation on sunny slopes, as well as for landscaping in courtyards. Its wood can be used for construction; the volatile oil extracted from the wood can be used in the production of fragrances and cosmetics. Its leaves are small, scale-like, with a fragrant aroma and a bitter taste, and are believed to have expectorant, antitussive, and hair-growth-promoting effects, as well as diuretic, stomach-strengthening, detoxifying, and blood-stasis-dispersing properties. The seeds also have calming and tonic effects. The potential medicinal, therapeutic, and industrial value of Chinese arborvitae is becoming increasingly apparent, but there is relatively little reported literature on this topic.

[0005] Currently, most β-cedrene on the market is extracted from trees, and the yield is low. Chemical synthesis processes are complex and environmentally polluting, making the development of a green synthesis route for β-cedrene crucial. Furthermore, there is very little literature on cedrene synthase, making the exploration of the function of cedrene synthase in plants a top priority. Summary of the Invention

[0006] One of the objectives of this invention is to address the shortcomings of existing synthetic technologies by providing a terpene sesquiterpene synthase, PoTPS1, which can be used to synthesize sesquiterpene compounds.

[0007] The second objective of this invention is to provide a genetically engineered bacterium that produces the above-mentioned terpene sesquiterpene synthase, which can be used to express sesquiterpene synthase to prepare sesquiterpenes / alcohols.

[0008] The first aspect of the present invention provides a sesquiterpene synthase, which is a protein as shown in (a) or (b) below:

[0009] (a) Platycladus orientalis sesquiterpene synthase PoTPS1, which is a protein derived from the Cupressaceae plant Platycladus orientalis with the amino acid sequence shown in SEQ ID NO.1;

[0010] (b) A protein with sesquiterpene synthase activity formed by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence of the arborvitae sesquiterpene synthase PoTPS1 as shown in SEQ ID NO.1.

[0011] In some embodiments of the present invention, the protein with sesquiterpene synthase activity is a protein with sesquiterpene synthase activity formed by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID NO.1.

[0012] A second aspect of the present invention provides a nucleotide molecule encoding a sesquiterpene synthase as described in the first aspect of the present invention, which is a gene as follows (c) or (d):

[0013] (c) The gene PoTPS1 encoding the terpene sesquiterpene synthase PoTPS1, the nucleotide sequence of which is shown in SEQ ID NO.2;

[0014] (d) A gene that hybridizes with the nucleotide sequence of the gene PoTPS1 in (c) under strict conditions and encodes a protein with sesquiterpene synthase activity.

[0015] A third aspect of the present invention provides a recombinant plasmid comprising nucleotide molecules as described in the second aspect of the present invention.

[0016] In some embodiments of the present invention, the recombinant plasmid further contains a constitutive strong promoter HXT7, a uracil auxotrophic screening tag URA, and the original plasmid pSP-GM1, denoted as pSP-GM1-URA-PoTPS1.

[0017] In some embodiments of the present invention, the recombinant plasmid further contains an inducible promoter T7 and the original plasmid pET22b, with an N-terminal fusion tag XXA and an C-terminal containing eight histidine selection tags, denoted as pET22b-XXA-PoTPS1.

[0018] The fourth aspect of the present invention provides a genetically engineered bacterium that produces sesquiterpene synthase, which is a recombinant host bacterium using a recombinant plasmid as a vector, the recombinant plasmid containing nucleotide molecules as described in the third aspect of the present invention.

[0019] In some embodiments of the present invention, the recombinant plasmid further contains a constitutive strong promoter HXT7, a uracil auxotrophic screening tag URA, and an original plasmid pSP-GM1, denoted as pSP-GM1-URA-PoTPS1; preferably, the genetically engineered bacteria is a recombinant Saccharomyces cerevisiae strain using the pSP-GM1-URA-PoTPS1 yeast protein expression plasmid as a vector and Saccharomyces cerevisiae as the host strain.

[0020] In some embodiments of the present invention, the recombinant plasmid further contains an inducible promoter T7 and the original plasmid pET22b, with an N-terminal fusion tag XXA and an C-terminal containing eight histidine selection tags, denoted as pET22b-XXA-PoTPS1; preferably, the genetically engineered bacterium is a recombinant Escherichia coli using the pET22b-XXA-PoTPS1 protein expression plasmid as a vector and Escherichia coli as the host bacterium.

[0021] The fifth aspect of the present invention provides the application of genetically engineered bacteria as described in the fourth aspect of the present invention in the expression of sesquiterpene synthases to prepare sesquiterpenes / alcohols.

[0022] In some embodiments of the present invention, the application includes inoculating the above-mentioned recombinant Saccharomyces cerevisiae into a glucose-containing fermentation medium for fermentation culture, and then separating and purifying the obtained fermentation culture broth to obtain β-Himalayene and cedrol.

[0023] In some embodiments of the present invention, using farnesium pyrophosphate (FPP) as a substrate, the process should include inoculating the above-mentioned recombinant Escherichia coli into LB medium for fermentation culture to obtain pure arborvitae sesquiterpene synthase PoTPS1; then, using farnesium pyrophosphate (FPP) as a substrate, performing an in vitro enzymatic reaction with the obtained pure arborvitae sesquiterpene synthase PoTPS1 to prepare β-Himalayene.

[0024] This invention relates to a terpene sesquiterpene synthase, PoTPS1, and its gene sequence. The gene is 1746 bp in length, encoding 582 amino acids, with a molecular weight of 67.9 kDa. Using the pSP-GM1-URA yeast protein expression plasmid as a vector and *Saccharomyces cerevisiae* CEN.PK-5D-113 as the host, heterologous expression of the terpene sesquiterpene synthase PoTPS1 in eukaryotic cells was achieved. The recombinant YCP-00 / pSP-GM1-URA-PoTPS1 can simultaneously generate two sesquiterpenes / alcohols: β-himachalene and cedrol. The yield in a 30 mL shake flask was 0.2487 mg / L of β-himachalene and 0.0946 mg / L of cedrol. The acquisition of this gene has profound significance for the study of terpene sesquiterpene compounds. Using the pET22b *E. coli* protein expression plasmid as a vector, and incorporating the antifreeze protein XXA as a fusion-promoting tag, and with *E. coli* BL21(DE3) as the host, heterologous expression of the terpene synthase PoTPS1 in prokaryotic cells was achieved. Sesquiterpene compounds were generated using farnesyl pyrophosphate (FPP) as a substrate. Therefore, exploring the function and sequence characteristics of this terpene synthase, as well as related terpene compounds, provides an important and comprehensive theoretical basis for the molecular aspects of terpene synthase genes in *Cuperiales* species. Attached Figure Description

[0025] The present invention will now be described in further detail with reference to the accompanying drawings:

[0026] Figure 1DNA agarose gel pattern (target band size 1746bp) was used to verify the YCP-00 / pSP-GM1-URA-PoTPS1 recombinant yeast strain; where M: standard DNA molecular ruler; lane 1 is the DNA sample of the PoTPS1-19896 gene.

[0027] Figure 2 The images show the GC-MS spectra of the products from the YCP-00 / pSP-GM1-URA-PoTPS1 recombinant yeast strain. A represents the GC spectrum of the fermentation product; B compares the mass spectrum of the peak at retention time 7.63 min (top) with the mass spectrum of β-himarcedrin in the NIST11 library (bottom); C compares the mass spectrum of the peak at retention time 9.15 min (top) with the mass spectrum of cedrol in the NIST11 library (bottom).

[0028] Figure 3 This is the pET22b-XXA-PoTPS1 plasmid map.

[0029] Figure 4 DNA agarose gel pattern was used to validate the BL21(DE3) / pET22b-XXA-PoTPS1 recombinant Escherichia coli strain (target band is 2349 bp, containing the fusion tag XXA and 8 histidine tags); where M: standard DNA molecular ruler; lane 1 is the XXA-PoTPS1-19896 gene sample.

[0030] Figure 5 SDS-PAGE gel electrophoresis patterns of the BL21(DE3) / pET22b-XXA-PoTPS1 recombinant E. coli strain to verify protein expression and purification (target protein molecular weight 88.5 kDa); where A is the SDS-PAGE gel electrophoresis pattern for verifying the expression of the fusion protein XXA-PoTPS1; B is the SDS-PAGE gel electrophoresis pattern for the purification of the fusion protein XXA-PoTPS1; M: standard amino acid molecular bar; lane 1 is the crude enzyme sample of XXA-PoTPS1 protein; lane 2 is the purified sample of XXA-PoTPS1 protein.

[0031] Figure 6 The diagram shows the kinetic curve of the enzymatic reaction of PoTPS1, a sesquiterpene synthase from Platycladus orientalis. Detailed Implementation

[0032] To facilitate understanding of the present invention, it will be described in detail below with reference to the accompanying drawings. However, before describing the present invention in detail, it should be understood that the present invention is not limited to the specific embodiments described. It should also be understood that the terminology used herein is for describing specific embodiments only and is not intended to be restrictive.

[0033] Unless otherwise defined, all terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. While any methods and materials similar to or equivalent to those described herein may also be used in the practice or testing of this invention, preferred methods and materials are now described.

[0034] I. Implementation Plan

[0035] As mentioned earlier, most commercially available β-cedrene is extracted from trees, and the yield is low. Chemical synthesis processes are complex and environmentally polluting; therefore, developing a green synthesis route for β-cedrene is crucial. However, there are very few literature reports on cedrene synthases, making the exploration of the function of cedrene synthases in plants paramount. In view of this, the inventors have conducted research, investigation, and screening of sesquiterpene synthases and their encoding genes.

[0036] Therefore, the sesquiterpene synthase involved in the first aspect of the present invention is Platycladus orientalis sesquiterpene synthase PoTPS1, which is a protein derived from the Platycladus orientalis plant with the amino acid sequence shown in SEQ ID NO.1, or a protein with sesquiterpene synthase activity formed by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID NO.1 of Platycladus orientalis sesquiterpene synthase PoTPS1.

[0037] In some embodiments of the present invention, the protein with sesquiterpene synthase activity is a protein with sesquiterpene synthase activity formed by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID NO.1.

[0038] The second aspect of the present invention relates to a nucleotide molecule (the gene encoding sesquiterpene synthase) that encodes the sesquiterpene synthase as described in the first aspect of the present invention, which is the gene PoTPS1 encoding the thuja sesquiterpene synthase PoTPS1, or a gene that hybridizes under stringent conditions with the nucleotide sequence of the gene PoTPS1 encoding the thuja sesquiterpene synthase PoTPS1 and encodes a protein having sesquiterpene synthase activity.

[0039] The nucleotide sequence of the gene PoTPS1, which encodes the terpene sesquiterpene synthase PoTPS1, is shown in SEQ ID NO.2.

[0040] The gene encoding the terpene synthase PoTPS1 in this invention was obtained from the cypress family plant *Platycladus orientalis*, collected on October 29, 2020, at an altitude of 23m within the park of Oriental Yuhong Building Materials Co., Ltd., Jinzhou Economic and Technological Development Zone, Liaoning Province. RNA was extracted from freshly collected *Platycladus orientalis* tissue and reverse transcribed into cDNA sequences to construct a cDNA library. Transcriptome sequencing was performed using BGISEQ, and the data were BLAST-aligned using NCBI (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi) to obtain the target gene containing conserved domains of the Terpene synthase family. This gene is 1746 bp in length, encoding 582 amino acids, and the enzyme protein has a molecular weight of 67.9 kDa.

[0041] To achieve the above technical solution, a third aspect of the present invention provides a recombinant plasmid comprising nucleotide molecules as described in the second aspect of the present invention.

[0042] In some embodiments of the present invention, the recombinant plasmid contains the gene PoTPS1 encoding the terpene sesquiterpene synthase PoTPS1, the constitutive strong promoter HXT7, the uracil auxotrophic screening tag URA, and the original plasmid pSP-GM1, denoted as pSP-GM1-URA-PoTPS1.

[0043] In this invention, the amino acid sequence of the tag URA is shown in SEQ ID NO.7, and the nucleotide sequence of the gene encoding the tag URA is shown in SEQ ID NO.8.

[0044] In some embodiments of the present invention, cDNA is used as the original plasmid, primers are designed to amplify the gene PoTPS1, and the target gene is constructed into the vector pSP-GM1 by enzyme digestion and ligation to obtain the recombinant plasmid pSP-GM1-PoTPS1; and the antifreeze protein XXA is fused with PoTPS1 by Gibson assembly to obtain the recombinant plasmid pET22b-XXA-PoTPS1.

[0045] In this invention, the amino acid sequence of the fusion-promoting tag XXA is shown in SEQ ID NO.9, and the nucleotide sequence of the gene encoding the fusion-promoting tag XXA is shown in SEQ ID NO.10.

[0046] The recombinant plasmid contains the gene PoTPS1 encoding the terpene sesquiterpene synthase PoTPS1, the inducible promoter T7, and the original plasmid pET22b. It contains a fusion tag XXA at ​​the N-terminus and an 8-histidine selection tag at the C-terminus, and is denoted as pET22b-XXA-PoTPS1.

[0047] In this invention, the amino acid sequence of the eight histidine selection tags is HHHHHHHH (SEQ ID NO.11), and the nucleotide sequence of the gene encoding the eight histidine selection tags is caccaccaccaccaccaccaccac (SEQ ID NO.12).

[0048] To achieve the above technical solution, the fourth aspect of the present invention provides a genetically engineered bacterium that produces sesquiterpene synthase, which is a recombinant host bacterium using a recombinant plasmid as a vector, wherein the recombinant plasmid contains nucleotide molecules as described in the third aspect of the present invention.

[0049] In some embodiments of the present invention, the genetically engineered bacteria is a recombinant Saccharomyces cerevisiae strain using the pSP-GM1-URA-PoTPS1 yeast protein expression plasmid as a vector and Saccharomyces cerevisiae CEN.PK-5D-113 (BioVector plasmid vector strain cell protein antibody gene deposit center - NTCC typical culture deposit center) as the host strain, denoted as YCP-00 / pSP-GM1-URA-PoTPS1.

[0050] In some embodiments of the present invention, the genetically engineered bacterium is a recombinant Escherichia coli using the pET22b-XXA-PoTPS1 protein expression plasmid as a vector and Escherichia coli BL21(DE3) (Beijing TransGen Biotech Co., Ltd.) as the host bacterium, denoted as BL21(DE3) / pET22b-XXA-PoTPS1.

[0051] The fifth aspect of the present invention relates to the use of genetically engineered bacteria as described in the fourth aspect of the present invention in the expression of sesquiterpene synthases to prepare sesquiterpenes / alcohols.

[0052] In some examples of the present invention, the above-mentioned recombinant Saccharomyces cerevisiae (e.g., YCP-00 / pSP-GM1-URA-PoTPS1) was inoculated into a glucose-containing fermentation medium (e.g., SC-Δura medium containing 20 g / L glucose) and fermented using glucose as a carbon source. Under the initiation of the HXT7 promoter, PoTPS1 synthase was first expressed. Then, the PoTPS1 synthase used the FPP generated during fermentation as a substrate to generate a fermentation broth containing β-himarcurilene and cedrol. The obtained fermentation broth was then separated and purified to obtain β-himarcurilene and cedrol.

[0053] Preferably, the specific composition of the SC-Δura medium containing 20 g / L glucose is as follows: 1.7 g / LYNB, 5 g / L (NH4)2SO4, 1.655 g / L amino acid mixture AA, 0.086 g / L His, and 0.173 g / L Leu.

[0054] Preferably, the fermentation conditions are: 30℃, 200rpm, and fermentation for 120h.

[0055] Those skilled in the art should understand that the above-described process of preparing β-Himalayene and cedrol by fermentation of recombinant Saccharomyces cerevisiae using glucose as a substrate is macroscopically a one-step fermentation culture to obtain a fermentation broth containing β-Himalayene and cedrol.

[0056] In some examples of the present invention, the above-mentioned recombinant Escherichia coli [e.g., BL21(DE3) / pET22b-XXA-PoTPS1] was inoculated into LB medium (e.g., LB medium containing the corresponding antibiotic) for induced expression culture, the protein was collected, and after cell disruption and purification, pure arborvitae sesquiterpene synthase PoTPS1 was obtained; then, using farnesium pyrophosphate (FPP) as a substrate, the obtained pure arborvitae sesquiterpene synthase PoTPS1 was subjected to an in vitro enzymatic reaction to obtain β-Himalayene.

[0057] Preferably, the LB medium has the following specific components: 10 g / L Trptone, 5 g / L Yeast extract, and 5 g / L NaCl; more preferably, the LB medium also contains the antibiotic Amp, and the content of the antibiotic Amp is 1000 μg / mL.

[0058] Preferably, the fermentation conditions are as follows: at 37°C and 180 rpm, the culture is carried out on a shaker until the OD600 is about 0.6 to 0.8. Then, the inducing agent isopropyl-β-D-thiogalactoside (IPTG) is added to a final concentration of 0.01 mM. Subsequently, the culture is carried out on a shaker at 16°C and 120 rpm / min for 18 to 24 h to induce protein expression.

[0059] II. Examples

[0060] The present invention will be specifically described below through specific embodiments. Unless otherwise specified, the experimental methods described below are standard laboratory methods. Unless otherwise specified, the experimental materials described below are commercially available.

[0061] Example 1: RNA extraction and transcriptome sequencing from the trunk and leaves of Platycladus orientalis trees

[0062] Freshly collected cypress trunks and leaves were selected, and total RNA was extracted using the Trizol method. The total RNA was then processed using either mRNA enrichment or rRNA removal methods. For mRNA enrichment, mRNA with polyA tails was enriched using magnetic beads with OligodT. For rRNA removal, rRNA was hybridized using a DNA probe, the DNA / RNA hybrid strands were selectively digested with RNase H, and the DNA probe was then digested with DNase I. The purified RNA was then obtained. The obtained RNA was fragmented using a fragmentation buffer, and reverse transcription was performed using random N6 primers to synthesize cDNA double-stranded DNA. The ends of the synthesized double-stranded DNA were padded and phosphorylated at the 5' end, and a sticky end with a protruding "A" was formed at the 3' end. A bubble-shaped adapter with a protruding "T" at the 3' end was then ligated. The ligation product was amplified by PCR using specific primers. The PCR product was thermally denatured into single strands, and then circularized using a bridging primer to obtain a single-stranded circular DNA library. Transcriptome sequencing was performed using the DNBSEQ platform, and the gene PoTPS-19896, which contains the conserved domains NSE / DTE and DDXXD of terpene synthase, was obtained based on relevant functional annotations and BLAST alignment.

[0063] Example 2: Construction of YCP-00 / pSP-GM1-URA-PoTPS1 recombinant yeast strain

[0064] After transcriptome sequencing, the PoTPS-19896 gene sequence (SEQ ID NO.2) was obtained and used as a primer for amplification of the target gene. The primer sequences are as follows:

[0065] Primer pSP-GM1-PoTPS1-F: GG ACTAGT ATGTCTAACTTGATGGGTGATCATAT(SEQ ID NO.13)

[0066] Primer pSP-GM1-PoTPS1-R: C GAGCTC TCAGACCTTAATTGGGTCGACAAT(SEQ ID NO.14)

[0067] Using cDNA as the original plasmid, the target gene PoTPS-19896 was amplified by PCR using two primers (SEQ ID NO.3 and SEQ ID NO.4). The total reaction volume was 50 μL, containing 25 μL of 2×PrimerStar Mix, 20 μL of ddH2O, 2 μL of primer pSP-GM1-PoTPS1-F, 2 μL of primer pSP-GM1-PoTPS1-R, and 1 μL of the original cDNA plasmid. The reaction conditions were: 98℃ pre-denaturation for 3 min, 98℃ denaturation for 10 s, 60℃ annealing for 15 s, and 72℃ extension for 2 min, for a total of 35 cycles. A final extension at 72℃ for 10 min was performed, and the product was stored at 4℃. After PCR, the product was detected by 1% agarose gel electrophoresis. After gel excision, the target fragment was recovered. The recovered target fragment and pSP-GM1 were digested with SpeI and SacI restriction enzymes. The enzyme digestion system consisted of 30 μL of the target gene or plasmid, 10 μL of ddH2O, 5 μL of 10×cut smart buffer, and 2.5 μL each of SpeI and SacI. Digestion was carried out at 37°C for 2 h. After digestion, the target fragment was recovered and ligated using T4 DNA ligase. The ligation system consisted of 14 μL of the target gene, 7 μL of the digested plasmid, 2.5 μL of T4 buffer, and 1.5 μL of T4 ligase. Ligation was carried out at 22°C for 2 h.

[0068] The transformation was carried out using the chemical transformation method with E. coli, and the steps are as follows:

[0069] (1) Take Trans 10 competent cells and place them on ice to melt. Add all 25 μL of the above ligation product and incubate on ice for 30 min.

[0070] (2) Heat shock at 42℃ for 30 seconds, followed immediately by ice bath for 2 minutes.

[0071] (3) Add 500 μL of antibiotic-free LB medium that has been pre-ice bathed, and revive at 37℃ and 180 rpm / min for 1 h.

[0072] (4) After the recovery is complete, centrifuge at 6000 rpm for 2 min, remove the supernatant, keep 100 μL, resuspend the bacterial cells, and spread them all on plates containing Amp resistance.

[0073] (5) Place in an incubator at 37°C and incubate overnight for about 12 to 16 hours.

[0074] Ten uniformly shaped single colonies were randomly selected from the cultured plates as the original plasmids for colony PCR.

[0075] After PCR, the band size of the product was checked by 1% agarose gel electrophoresis to determine if it was correct.

[0076] After extracting the recombinant plasmid, it was verified by first-generation sequencing, which proved that the sequencing was correct and that it could be used for subsequent fermentation.

[0077] Example 3: Conversion was carried out using brewer's yeast electroconversion method, and the steps are as follows:

[0078] (1) Inoculate 5 mL of sterile YPD medium with Saccharomyces cerevisiae CEN.PK-5D-113 and culture overnight at 30°C and 200 rpm / min.

[0079] (2) The pre-cultured cells were seeded into 30 mL Erlenmeyer flasks containing YPD medium, and the initial OD was... 600 =0.3, incubated at 30℃ for about 9 hours, until OD 600 =1.2 to 1.6 is sufficient.

[0080] (3) When the OD reaches the set value, pour the bacterial solution into a 50mL sterile centrifuge tube and centrifuge at 3000rpm for 3min at 4℃.

[0081] (4) Rinse once with 20 mL of pre-cooled sterile water and discard the supernatant.

[0082] (5) Wash once with 20 mL of pre-cooled sorbitol and discard the supernatant.

[0083] (6) Resuspend the cells in 16 mL of 1 M sorbitol, add 2 mL of 10×TE and 2 mL of 10×LiAc, and incubate at 30 °C and 200 rpm / min for 30 min.

[0084] (7) Add 200uL of 1M DTT and continue resuscitation for 15 minutes.

[0085] (8) After resuscitation, collect the bacterial cells by centrifugation at 3000 rpm for 3 min, and wash twice with 20 mL of sorbitol. (Make sure to wash away the DTT, otherwise it will affect the subsequent transformation efficiency.)

[0086] (9) After centrifugation, remove as much liquid as possible, resuspend the yeast cells in 200 μL of 1 M sorbitol, then dispense 50 μL into sterile EP tubes and place on ice for later use.

[0087] (10) Gently add 1 μL of the recombinant DNA constructed above to the prepared competent cells and transfer the liquid to a pre-cooled electroporation cup (0.2 cm gap).

[0088] (11) Place the electroporation cup in the electroporation apparatus, select program Sc2, 1.5KV for electroporation, and immediately add 1mL of 1M sorbitol to the electroporation cup after electroporation. After mixing the liquid, transfer the cells from the electroporation cup to 6mL of mixed solution (3mL YPD + 3mL 1M sorbitol) and revive them at 30℃, 200rpm / min for 1h.

[0089] (12) After the recovery is completed, centrifuge at 3000 rpm at 4℃, discard the supernatant, resuspend in 1 mL of sterile water, take 100 uL and spread it on SC-Ura plates, and incubate in a 30℃ incubator for 48 to 72 h.

[0090] Take out the cultured plate, randomly select single colonies with uniform morphology for colony PCR, and check whether the band size is correct by 1% agarose gel electrophoresis.

[0091] like Figure 1 As shown, the results indicate that the selected transformants have a single band around 1800bp, proving that the transformants are positive clones.

[0092] Example 4: Induced Fermentation

[0093] (1) The verified positive clones were inoculated into 5 mL of SC-Ura liquid medium and cultured overnight.

[0094] (2) Inoculate the seed culture into 50 mL of SC-Ura medium and incubate at 30℃ and 200 rpm / min for 24 h.

[0095] (3) 24 hours after inoculation, add 20% organic phase n-nonane to the fermentation broth and then continue to culture under the above conditions for 96 hours.

[0096] (4) After fermentation is complete, take 200 μL of n-nonane from the fermentation broth for GC-MS detection.

[0097] Example 5: Construction of protein expression vector pET22b-XXA-PoTPS1

[0098] Based on the PoTPS-19896 gene sequence SEQ ID NO.2, primers were designed to amplify the target gene. The primer sequences are shown in Table 1.

[0099] Table 1

[0100] Primer name Primer sequence Serial Number 22b-PoTPS1-F ATGTCTAACTTGATGGGTGATCATATGAAGATCAA SEQ ID NO.15 22b-PoTPS1-R TCAGTGGTGGTGGTGGTGGTGGTGGTGGACCTTAATTGGGTCG SEQ ID NO.16 22b-XXA-F TATACATATGCCAAAGTTGAGAGATGCTGCTGATCAAG SEQ ID NO.17 22b-XXA-R AGTTAGACATCATTTGATCTTCAGACAAAGCATCCT SEQ ID NO.18 22b-F CCACCACCACCACCACTGAGATCCGGGCTGCTAACAAA SEQ ID NO.19 22b-R TCAACTTTGGCATATGTATATCTCCTTCTTAAAGTTAAAC SEQ ID NO.20

[0101] according to Figure 3Based on the plasmid map, we amplified three fragments, PoTPS1, XXA, and Vector-22b, using the above six primers. The amplification method is detailed in Example 2 and will not be repeated here. After verifying the amplified fragments by agarose gel electrophoresis, the gel was cut and recovered. The recovered product was then degraded from the original plasmid. The system was as follows: 40 μL of gel-recovered fragment, 5 μL of 10×cutsmart buffer, 2 μL of DpnI, and 3 μL of ddH2O. After mixing the above liquids, the mixture was placed in a 37℃ incubator for 1 h and then PCR was performed for recovery. Using the Gibson homologous recombination assembly method, fragments PoTPS1 and XXA were ligated to the vector fragment Vector-22b. The ligation ratio was calculated using the following formulas (1)-(3):

[0102]

[0103] (3) a + b + c = 5

[0104] In the above formulas (1)-(3):

[0105] Ca: PoTPS1 concentration (ng / μL); Ma: PoTPS1 length (bp); a: PoTPS1 volume (μL)

[0106] Cb: XXA concentration (ng / μL); Mb: XXA length (bp); b: XXA volume (μL)

[0107] Cc: Vector-22b concentration (ng / μL); Mc: Vector-22b length (bp); c: Vector-22b volume (μL).

[0108] The volumes of PoTPS1, XXA, and Vector-22b were calculated according to the above formula, and then 5 ml of 2×Basic Seamless ligase was added and incubated at 45°C for 15 min. The ligation product was introduced into Trans10 competent cells, as detailed in Example 2.

[0109] Example 6: Expression of the protein PoTPS

[0110] (1) The recombinant expression vector pET22b-XXA-PoTPS1 constructed in Example 5 was introduced into *Escherichia coli* BL21(DE3) to obtain recombinant bacteria. The recombinant strain was then verified using agarose gel electrophoresis, as shown below. Figure 4 As shown, the target band is present at approximately 2400 bp, confirming the successful introduction of the recombinant plasmid pET22b-XXA-PoTPS1, which can be used for subsequent protein expression. Positive clones were screened using ampicillin plates (Amp, 100 mg / mL) and incubated overnight at 37°C.

[0111] (2) Inoculate the single clones on the plate into 5 mL of LB liquid medium (Amp, 100 mg / mL) and incubate at 37 °C, 180 rpm / min on a shaker for 12-16 h.

[0112] (3) The seed culture from step (2) was inoculated into 100 mL of LB liquid medium (Amp, 100 mg / mL) at a ratio of 1:50. The culture was then incubated at 37 °C and 180 rpm / min on a shaker until the OD600 reached approximately 0.6–0.8. Then, isopropyl-β-D-thiogalactoside (IPTG) was added to a final concentration of 0.01 mM. The culture was subsequently incubated at 16 °C and 120 rpm / min on a shaker for 18–24 h to induce protein expression.

[0113] (4) After the induction of expression is completed, the bacterial culture expressed in step (3) is centrifuged at 4500 rpm for 20 min at 4℃ to collect the bacterial cells. After centrifugation, the supernatant is discarded. The bacterial cells are resuspended in pre-cooled cell lysis buffer (50 Mm phosphate buffer, 300 mM NaCl, 5 mM β-ME, pH = 7.5), and lysozyme and protease inhibitor (PMSF) are added respectively.

[0114] (5) Disrupt the cells in the resuspension from step (4) using an amplitude transformer. Centrifuge at 35% power for 20 min at 4℃ and 12000 rpm. The supernatant obtained is the crude enzyme solution required for the experiment. The correct expression of the target protein PoTPS1 is verified by polyacrylamide (SDS) gel electrophoresis.

[0115] According to SDS-PAGE verification and comparison with the marker, a distinct specific band was found around 88kDa (e.g., Figure 5 As shown in Figure A, this demonstrates the successful expression of the fusion protein XXA-PoTPS1.

[0116] Example 7: Purification of protein PoTPS

[0117] (1) Chromatography column treatment: 5 mL of nickel column packing, rinse once with 20 mL of deionized water, and then rinse the nickel column with the cell lysis buffer in step (4) of Example 6, using 20 mL.

[0118] (2) The crude enzyme solution obtained above was filtered through a 0.22 μm filter membrane to remove impurities. The treated crude enzyme solution was added to a nickel column and mixed thoroughly. The effluent was then discarded.

[0119] (3) After loading, rinse the nickel column with 15 mL of cell lysis buffer to remove unsuccessfully loaded proteins and impurities, and discard the eluent.

[0120] (4) Add 20 ml of buffer containing 50 mM imidazole to the column to remove impurities and discard the eluent.

[0121] (5) Add 20 ml of buffer containing 100 mM imidazole to the column to remove impurities and discard the eluent.

[0122] (6) Add 20 mL of buffer containing 250 mM imidazole to the column to elute the target protein and collect the effluent.

[0123] (7) Add 20 mL of buffer containing 500 mM imidazole to the column to clean the nickel column by washing away the residual proteins.

[0124] (8) Add 20 mL of cell lysis buffer and deionized water to the nickel column in sequence to clean the nickel column; finally add 15 mL of 20% ethanol to preserve the nickel column.

[0125] (9) Place the collected protein from (6) into a 30kDa ultrafiltration tube and centrifuge at 4500rpm until 500μL of liquid remains in the tube. Add 15mL of cell lysis buffer to dilute the imidazole concentration in the protein. Continue centrifuging until about 500μL of protein remains in the tube.

[0126] (10) Take 10 μL of sample for SDS-PAGE gel electrophoresis verification.

[0127] (11) The results show (as shown in the figure) Figure 5 (As shown in B): Compared with the marker, the molecular weight was close to that of the monomer, and the purity was approximately 85%. Finally, the XXA-PoTPS1 protein was concentrated to 19 mg / mL, flash-frozen in liquid nitrogen, and stored at -80°C.

[0128] Example 8: Determination of in vitro catalytic and kinetic parameters

[0129] PoTPS1 is a sesquiterpene synthase, and Mg needs to be added during the reaction. 2+ As a cofactor, we chose MgCl2. The reaction system was as follows: 100 μg of purified protein (Platycladus orientalis sesquiterpene synthase PoTPS1) was mixed with 50 μM FPP in a 5 mL vial, 25 mM MgCl2 was added, and the volume was brought up to 2 mL with cell lysis buffer. 400 μL of n-nonane was then placed on top of the reaction system for product extraction. After reacting in a 30 °C metal bath for 1 h, the upper organic phase was collected, dehydrated with anhydrous sodium sulfate, and then used for GC-MS detection.

[0130] Using the above method for determining enzyme activity, we selected FPP at concentration gradients of 10-1000 μM as the substrate, added 5 μg of PoTPS1, and reacted at 30℃ for 10 min. Then, we terminated the reaction by adding 20 μL of 1M NaOH. The yield was detected by GC-MS, and the enzyme kinetic parameters Km and Kcat were calculated. Using Origin software, we fitted the product yield to the substrate concentration after 10 min of reaction. The kinetic curve of the sesquiterpene synthase PoTPS1 is shown below. Figure 6 As shown, the fitting results indicate that the Km value of PoTPS1 is 82.1999±2.0564μM, and the Kcat value is (1.212±0.598)×10 -3 s -1 .

[0131] Example 9: GC-MS detection of fermentation and catalytic products

[0132] (1) GC-MS detection method

[0133] Chromatographic column: HP-5ms; Ion source: EI, 230eV; Injection volume: 1μL; Injection temperature: 250℃; Detector temperature: 325℃; Column temperature: 250℃; Temperature program: Initial temperature: 100℃, increase to 240℃ at 10℃ / min, hold for 5 min, then increase to 300℃ at 30℃ / min, hold for 5 min.

[0134] (2) Yield was calculated using the internal standard method. A 50 mg / L standard was prepared using tetradecane as the internal standard. 135 μL of the sample was mixed with 15 μL of 50 mg / L tetradecane to achieve a final tetradecane concentration of 5 mg / L. The sample yield was calculated based on the ratio of the peak area of ​​the product to that of the standard.

[0135] Test results as follows Figure 2 The image shows the GC-MS spectra of the products from the YCP-00 / pSP-GM1-URA-PoTPS1 recombinant yeast strain. A represents the GC spectrum of the fermentation product; B compares the mass spectrum of the peak at retention time 7.63 min (top) with the mass spectrum of β-citrulline in the NIST11 library (bottom); C compares the mass spectrum of the peak at retention time 9.15 min (top) with the mass spectrum of cedrol in the NIST11 library (bottom).

[0136] The yields in a 30 mL shake flask were calculated to be 0.2487 mg / L for β-Himalayene and 0.0946 mg / L for cedrol.

[0137] Example 10: BLAST sequence alignment

[0138] The sesquiterpene synthase PoTPS1 sequence obtained in this invention (SEQ ID NO.1) was subjected to BLAST sequence alignment in NCBI (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi). Two proteins with at least 70% identity and sesquiterpene synthase activity were found. One is cedrol synthase derived from Taiwania cedar, with its amino acid sequence shown in SEQ ID NO.3 and its nucleotide sequence shown in SEQ ID NO.4; the other is α-humulene synthase derived from Japanese cedar, with its amino acid sequence shown in SEQ ID NO.5 and its nucleotide sequence shown in SEQ ID NO.6.

[0139] It should be noted that the embodiments described above are only for explaining the present invention and do not constitute any limitation on the present invention. The present invention has been described with reference to typical embodiments, but it should be understood that the words used therein are descriptive and explanatory terms, not limiting terms. Modifications can be made to the present invention within the scope of the claims, and revisions can be made to the present invention without departing from the scope and spirit of the present invention. Although the present invention described herein relates to specific methods, materials, and embodiments, it does not mean that the present invention is limited to the specific examples disclosed herein; on the contrary, the present invention can be extended to all other methods and applications with the same function.

Claims

1. The application of a sesquiterpene synthase in the preparation of sesquiterpenes / alcohols; characterized in that, The sesquiterpene synthase is Platycladus orientalis sesquiterpene synthase PoTPS1, which is a protein derived from Platycladus orientalis, a plant of the Cupressaceae family, with the amino acid sequence shown in SEQ ID NO.

1. The sesquiterpene / alcohol is β-hemicerin and / or cedrol.

2. The application according to claim 1, characterized in that, The sesquiterpene synthase was obtained by expression from genetically engineered bacteria that produce sesquiterpene synthase.

3. The application according to claim 2, characterized in that, The genetically engineered bacteria are recombinant Saccharomyces cerevisiae strains using the pSP-GM1-URA-PoTPS1 yeast protein expression plasmid as a vector and Saccharomyces cerevisiae as the host. The pSP-GM1-URA-PoTPS1 yeast protein expression plasmid contains a nucleotide molecule encoding a sesquiterpene synthase, a constitutive strong promoter HXT7, a uracil auxotrophic selection tag URA, and the original plasmid pSP-GM1. The nucleotide molecule encoding the sesquiterpene synthase is the gene PoTPS1 encoding the thuja sesquiterpene synthase PoTPS1, and its nucleotide sequence is shown in SEQ ID NO.

2.

4. The application according to claim 2, characterized in that, The genetically engineered bacterium is a recombinant *E. coli* strain using the pET22b-XXA-PoTPS1 protein expression plasmid as a vector and *E. coli* as the host bacterium. The pET22b-XXA-PoTPS1 protein expression plasmid contains a nucleotide molecule encoding a sesquiterpene synthase, an inducible promoter T7, and the original plasmid pET22b. It has an N-terminal fusion tag XXA and an 8-histidine selection tag at the C-terminus. The nucleotide molecule encoding the sesquiterpene synthase is the gene PoTPS1 encoding the thuja sesquiterpene synthase PoTPS1, and its nucleotide sequence is shown in SEQ ID NO.

2.

5. The application according to claim 1, characterized in that, The application includes inoculating the recombinant Saccharomyces cerevisiae of claim 3 into a glucose-containing fermentation medium for fermentation, and then separating and purifying the obtained fermentation broth to obtain β-Himalayene and cedrol.

6. The application according to claim 1, characterized in that, The application includes inoculating the recombinant Escherichia coli of claim 4 into LB medium for fermentation culture to obtain pure arborvitae sesquiterpene synthase PoTPS1; then, using farnesyl pyrophosphate ammonium salt (FPP) as a substrate, performing an in vitro enzymatic reaction with the obtained pure arborvitae sesquiterpene synthase PoTPS1 to prepare β-Himalayene.

Images