A SNP marker related to chicken twelve-week weight trait and application thereof

GWAS analysis revealed SNP markers related to chicken weight at 12 weeks of age, solving the problem of the lack of clear molecular markers in broiler breeding. This enabled early, rapid, and low-cost weight prediction and improvement, thereby increasing the efficiency of chicken breeding.

CN118853897BActive Publication Date: 2025-12-05CHINA AGRI UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202410839573.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-06-26
Publication Date
2025-12-05
Estimated Expiration
2044-06-26

AI Technical Summary

Technical Problem

There is a lack of clear and significant molecular markers in current broiler breeding, making it difficult to effectively improve the weight trait of chickens.

Method used

GWAS analysis of chicken hybrid populations using resequencing technology revealed an SNP marker at the rs1059568314 locus of GRCg6a104 in the genome. This marker is dominated by the G allele in high-weight chickens and by the A allele in low-weight chickens. Primer pairs SEQ ID NO.2 and SEQ ID NO.3 were designed to amplify and detect this locus for marker-assisted selection breeding.

Benefits of technology

It enables early, rapid, and low-cost prediction of chicken weight, thereby improving the weight of breeding populations, and has broad application prospects and economic value.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118853897B_ABST
    Figure CN118853897B_ABST
Patent Text Reader

Abstract

The application discloses a SNP marker (chr1: 170526265, located on the upstream of a SETDB2 gene) related to a twelve-week-old weight trait of a chicken and an application thereof. By determining and recording the twelve-week-old weight of a crossbreed chicken of a crossbreed population of the chicken, 1092 chickens are sequenced by using a resequencing technology, and further whole genome correlation analysis is carried out, so that a SNP (chr1: 170526265) site affecting the twelve-week-old weight is obtained. The SNP frequencies of the SNP site in low-weight chicken species and high-weight chicken species in resequencing are counted, and it is found that the SNP site has significant differences in the low-weight chicken species and the high-weight chicken species. In the high-weight chicken, G is a dominant allele, and in the low-weight chicken, A is a dominant allele. In the population with low weight, by selecting the individuals with the G allele of the site, the weight of the breeding population can be improved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular biology, specifically to a SNP marker associated with the weight trait of chickens at twelve weeks of age and its application. Background Technology

[0002] Chicken is one of the main meat varieties in China, characterized by high protein, low fat, and low cholesterol. In recent years, my country's chicken production has continued to grow, and improving muscle yield and chicken quality has been a long-term focus for breeding scientists. Classical breeding methods have made significant contributions to the improvement of agricultural animal production traits. With the continuous advancement of genomics work and the extensive development of genetic markers, breeding scientists can select chickens with good yield and quality characteristics for breeding based on specific genetic markers. These genetic markers can help breeding scientists more accurately assess and select chickens for genetic potential, accelerating the breeding process.

[0003] SNPs (Single Nucleotide Polymorphisms) are one of the most common forms of genetic variation in genetics. SNPs are characterized by their large quantity, high frequency, and low mutation rate, playing a crucial role in genetic research and molecular selection breeding. However, current molecular breeding practices for broiler chickens still lack molecular markers with clearly defined functions and significant effects. Therefore, identifying high-efficiency, accurate molecular markers is a current research focus. If we can find SNP molecular markers associated with target traits in chickens and ultimately elucidate the molecular mechanisms underlying these sites, it will greatly promote genetic improvement in chickens and bring breakthrough progress to the field of poultry breeding. Summary of the Invention

[0004] To address the shortcomings of existing technologies, this invention aims to provide a SNP marker associated with the 12-week-old weight trait in chickens and its application. Using resequencing technology, individuals from a hybrid population of 1092 chickens with only 12-week-old weight records were sequenced and subjected to GWAS analysis. This revealed a SNP locus significantly associated with 12-week-old weight: rs1059568314 (chr1:170526265) located at GRCg6a 104 in the genome. This locus contains three genotypes: GG, AA, and GA. The SNP frequencies of this locus were statistically analyzed in other low-weight and high-weight chicken breeds during resequencing. Significant differences in SNP frequency distribution were found between low-weight and high-weight breeds. In high-weight chickens, G was the dominant allele, while in low-weight chickens, A was the dominant allele. Since high-weight chickens have a higher weight than low-weight chickens, this SNP locus can be used as a molecular marker for the selection of superior chicken breeds. In a low-weight population, the population's weight can be increased by selecting individuals with the G allele.

[0005] To solve the above-mentioned technical problems, the technical solution provided by the present invention is as follows:

[0006] A SNP molecular marker associated with the body weight of chickens at twelve weeks of age.

[0007] The SNP molecular marker is located at chr1:170526265 in GRCg6a 104 of the genome, and the alleles of the SNP site are G and A;

[0008] The economic trait is body weight at twelve weeks of age. In high-weight chickens, G is the dominant allele, while in low-weight chickens, A is the dominant allele.

[0009] Preferred,

[0010] The SNP molecular marker is located at the 101st base in the nucleotide sequence shown in SEQ ID NO.1.

[0011] The application of the above-mentioned SNP molecular markers in the detection of weight traits in chickens at twelve weeks of age.

[0012] Preferably, it includes the following steps:

[0013] (1) Detect the genotype of the sample chickens at the SNP locus;

[0014] (2) Select sample chickens with G / G genotypes for breeding superior strains.

[0015] Preferred,

[0016] Step (1) can be performed by direct sequencing, or by first amplifying the gene fragment containing the SNP molecular marker and then detecting it. For example, primers can be designed to amplify the fragment containing the SNP molecular marker from the sequence shown in SEQ ID No. 1, and then the alleles at that site can be detected.

[0017] The above-mentioned SNP molecular markers are used in marker-assisted selection breeding to select chicken breeds with the genotype G / G for breeding.

[0018] Primer pairs used to amplify the above-mentioned SNP molecular markers are shown in SEQ ID NO.2 and SEQ ID NO.3.

[0019] The beneficial effects of this invention are:

[0020] This invention enables early, rapid, low-cost, and effective prediction of chicken weight by detecting SNP molecular markers, and has broad application prospects in chicken breed improvement, and can achieve excellent economic value. Attached Figure Description

[0021] The accompanying drawings are provided to further illustrate the invention and form part of the specification. They are used in conjunction with embodiments of the invention to explain the invention and do not constitute a limitation thereof. In the drawings:

[0022] Figure 1 shows the Manhattan plot of GWAS results for 12-week-old infants. Detailed Implementation

[0023] The preferred embodiments of the present invention will be described below with reference to the accompanying drawings. It should be understood that the following embodiments are given for illustrative purposes only and are not intended to limit the scope of the present invention. Those skilled in the art can make various modifications and substitutions to the present invention without departing from its spirit and essence.

[0024] This invention provides a SNP marker (chr1: 170526265, located upstream of the SETDB2 gene) associated with the weight trait of chickens at 12 weeks of age and its application. The SNP molecular marker is located at chr1: 170526265 in GRCg6a 104 of the genome, and the SNP molecular marker is located at the 101st base in the nucleotide sequence shown in SEQ ID NO.1; the alleles of the SNP site are G and A.

[0025] The economic trait is the chicken's body weight at 12 weeks of age. In high-weight chickens, G is the dominant allele, while in low-weight chickens, A is the dominant allele. In the lower-weight population, selecting individuals with the G allele can increase the chicken's body weight.

[0026] SEQ ID NO. 1(chr1:170526165-170526365)

[0027] gcagcagcaagagcaatcaacagcagtggtgtttagtaacccaggtgtttattgagtctttcagtttattatcttagctggaagc aaaagggctaaatacaccctcaaagcttgtctttatttttgccacttccccataggtgcccaactatggaaagaccctctgcca acccacaccacgagaggcactacatccccgag

[0028] Example 1: Genome-wide association analysis of body weight in chickens at 12 weeks of age

[0029] 1. Test materials

[0030] Using individuals from a hybrid chicken population as the research subjects, the body weight of 1092 individuals was measured at twelve weeks of age, and the measurement was strictly carried out in accordance with the internal standards of the chicken farm.

[0031] 2. Test Methods

[0032] 2.1 Phenotypic determination

[0033] When the chickens reach twelve weeks of age, each chicken is placed on a weighing device and waited for it to remain relatively calm and balanced. The displayed weight value is then recorded, along with its sex.

[0034] 2.2 Chicken whole-genome SNP genotyping method based on resequencing technology

[0035] Sequencing data were aligned to the GRCg6a 104 reference genome using GTX Align, and SNP loci were detected using Basevar. The genotype probability of all individuals was estimated using STITCH. For SNP loci obtained through genotyping, they were filtered based on MAF < 0.05, locus call rate < 0.95, and info score < 0.4, retaining a total of 7,901,521 high-quality SNPs.

[0036] The specific amplification steps were as follows: Blood tissue samples from the hybrid population were collected, and DNA was extracted using a total DNA extraction kit from Beijing Tiangen Biotech Co., Ltd. The extracted DNA concentration and purity were determined by measuring the OD values ​​(OD260 / OD280 and OD260 / OD230 ratios) using a NanoDrop 2000 spectrophotometer. DNA integrity was then assessed using agarose gel electrophoresis. Using the genome of the hybrid population samples as a template, primers were designed using Oligo7 software, and sequence amplification was performed using Novizan 2 × Taq Master Mix. The reaction system was as follows: 95℃, pre-denaturation for 3 min; 95℃, denaturation for 15 s, 60℃, annealing for 15 s, 72℃, extension for 15 s, 30 cycles; 72℃, complete extension for 5 min. Finally, agarose gel electrophoresis was used to determine the fragment size of the product.

[0037] Primer pair sequences for amplifying fragments containing the above SNP sites:

[0038] F: GCAGCAGCAAGAGCAATCAA (SEQ ID NO.2)

[0039] R: CTCGGGGATGTAGTGCCTCT (SEQ ID NO.3)

[0040] 2.3 Genome-wide association analysis

[0041] Genome-wide association analysis was performed on the body weight phenotype of 1092 chickens at 12 weeks of age using fastGWA.

[0042] 2.4 SNP loci significantly associated with body weight trait

[0043] Detection of significant loci at the genomic level, with significant loci identified based on FDR < 0.05.

[0044] 3. Results and Analysis

[0045] This invention uses 1092 chickens from a hybrid population as subjects. Using resequencing technology, 7,901,521 SNPs were obtained, and GWAS analysis was performed on the twelve-week-old body weight of the chickens. A SNP (chr1: 170526265) that was significantly associated with the twelve-week-old body weight of the chickens was identified, as shown in Figure 1.

[0046] Example 2: Frequency distribution of SNP (chr1: 170526265) in different chicken breeds

[0047] 1. Experimental Materials

[0048] Low-weight chicken breeds: Bearded Chicken (n=15), Beijing Oil Chicken (n=25) and Daweishan Miniature Chicken (n=33).

[0049] High-weight chicken breeds: Lingnan yellow-feathered broiler (n=16), white-feathered broiler (n=20), Kobo chicken (n=33) and recessive white-feathered chicken (n=113).

[0050] 2. Experimental Methods

[0051] 2.1 Data Collection

[0052] The whole-genome resequencing data from three low-weight chicken breeds and four high-weight chicken breeds in China were downloaded from the NCBI SRA database (https: / / ncbi.nlm.nih.gov / sra).

[0053] 2.2 SNP typing using GATK

[0054] The gVCF was constructed based on the GRCg6a104 reference genome using the GTX server gtx wgs command. Then, the gtx gi and gtx joint commands were used to perform joint variant detection on all gVCF samples and obtain genotype VCF files.

[0055] 2.3 SNP Filtration and Quality Control

[0056] After the combined variant detection was completed, SNPs were extracted using the SelectVariants tool in the GATK software package. Subsequently, the whole genome resequencing data were quality controlled using the VariantFiltration tool in the GATK software package according to the following hard filtering parameters: MQ < 40.0, FS > 60.0, SOR > 3.0, MQRankSum < -12.5, ReadPosRankSum < -8.0, QUAL < 30. After the above quality control, a total of 44,272,587 resequencing SNPs were obtained.

[0057] 2.4 Calculate the allele frequencies of chr1:170526265 in different chicken breeds.

[0058] Use vcftools --freq2 to calculate the allele frequencies of chr1:170526265 in different chicken breeds.

[0059] 3. Results and Analysis

[0060] The SNP frequency distribution of SNP (chr1: 170526265) in different low-weight and high-weight chicken breeds is shown in Table 1. Significant differences exist between the two breeds. G is the dominant allele in high-weight chickens, while A is the dominant allele in low-weight chickens.

[0061] Table 1. SNP frequencies (chr1: 170526265) in different low-weight and high-weight chicken breeds.

[0062] ;

[0063] Analysis revealed a SNP molecular marker associated with the weight trait of chickens at 12 weeks of age. In a low-weight population, breeding individuals with the G / G allele could increase the weight of the breeding population.

[0064] The contents not described in detail in this specification are existing technologies known to those skilled in the art.

[0065] Finally, it should be noted that the above descriptions are merely preferred embodiments of the present invention and are not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. The application of an SNP molecular marker in the detection of body weight traits in chickens at twelve weeks of age, characterized in that, The SNP molecular marker is located at chr1:170526265 of the GRCg6a genome, and the alleles of the SNP site are G and A.

2. The application according to claim 1, characterized in that, Includes the following steps: (1) Detect the genotype of the sample chickens at the SNP locus; (2) Select sample chickens with G / G genotypes for breeding superior strains.

3. The application according to claim 2, characterized in that, Step (1) can be performed by direct sequencing or by first amplifying the gene fragment containing the SNP molecular marker and then detecting it.

Citation Information

Patent Citations

  • Haplotype molecular marker related to chicken weight traits and application

    CN110951889A