Application of a renal cancer prognosis marker TYMP and a TYMP inhibitor

Abstract

The present invention belongs to the field of biomedical technologies, and particularly relates to the application of a renal cancer prognosis marker TYMP and a TYMP inhibitor. The present invention discovers the renal cancer prognosis marker TYMP. Pioneeringly, the present invention explores the repurposing of the FDA-approved drug TAS-102 as a carrier, and discovers its important role in regulating ferroptosis of renal cancer and activating CD8+ T cell anti-tumor immunity in thymidine metabolism targeted thereby, enriching the understanding of the mechanism of action of the thymidine phosphorylase TYMP inhibitor TAS-102. The present invention discovers for the first time that TPI and TAS-102 can effectively inhibit the in vivo growth ability of a renal cancer mouse model, and can be used as a potential drug for treating renal cancer clinically, having important scientific significance and clinical application value. The present invention helps to provide new treatment targets and treatment drugs for clinically refractory renal cancer.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to the application of a renal cancer prognosis marker TYMP and a TYMP inhibitor. Background Art

[0002] Tipiracil hydrochloride (TPI) is a specific enzyme inhibitor of TYMP. It is combined with the 5-FU analogue trifluridine (TFD) to form the fluorouracil drug TAS-102, which has been approved by the FDA for third-line treatment of metastatic colorectal cancer and gastric cancer. However, the function and mechanism of TAS-102 in the development of renal cancer are completely unknown.

[0003] Existing research mainly focuses on the therapeutic application of TAS-102 in colorectal cancer and gastric cancer, and its function in renal cancer has not been reported; the main known mechanism of TAS-102 is similar to chemotherapy drugs, inhibiting angiogenesis and promoting cell apoptosis, and its role in promoting ferroptosis and tumor immunity has not been reported.

[0004] Abnormal activation of the HIF-VEGF pathway is a key event that promotes the development of renal clear cell carcinoma. Clinically, TKI targeted drugs developed for it have achieved significant therapeutic effects. In recent years, as a tumor with a high degree of immune cell infiltration, PD-1 / PD-L1 immunotherapy combined with targeted therapy has significantly improved the overall survival rate of patients, but it is still ineffective for about 40% of patients with advanced metastasis, and most patients who are effective in initial treatment will develop secondary drug resistance. Therefore, finding new intervention targets and treatment strategies for renal clear cell carcinoma is still a bottleneck that needs to be solved and broken through in this field. Summary of the invention

[0005] The present invention first provides a renal cancer prognosis marker, wherein the marker is TYMP.

[0006] In certain embodiments, the renal cancer is clear cell renal carcinoma.

[0007] The present invention also provides a composition for treating renal cancer, wherein the composition comprises a TYMP inhibitor.

[0008] In certain embodiments, the renal cancer is clear cell renal carcinoma.

[0009] In certain embodiments, the TYMP inhibitor comprises a shRNA that knocks down TYMP.

[0010] In certain embodiments, the sequence of the shRNA is shown in SEQ ID NO.1-SEQ ID NO.3.

[0011] In some embodiments, the SEQ ID NO.1: GCCTCCATTCTCAGTAAGAAA.

[0012] In some embodiments, the SEQ ID NO.2: GCTGGAGTCTATTCCTGGATT.

[0013] In some embodiments, the SEQ ID NO.3: CCTTGGATAAGCTGGAGTCTA.

[0014] In some embodiments, the TYMP inhibitor comprises TPI and TAS-102.

[0015] The present invention also provides a kit for diagnosing the prognosis of renal cancer, and the kit comprises a reagent for detecting TYMP;

[0016] In some embodiments, the reagent comprises primers;

[0017] In some embodiments, the primers comprise SEQ ID NO.4 - SEQ ID NO.5.

[0018] In some embodiments, the SEQ ID NO.4: GGTGTGGGTGACAAGGTCAG;

[0019] In some embodiments, the SEQ ID NO.5: GCAGCACTTGCATCTGCTC.

[0020] The present invention finally provides an application of a TYMP inhibitor in the preparation of a drug for treating renal cancer.

[0021] In some embodiments, the TYMP inhibitor comprises TPI, TAS-102 and shRNA for knocking down TYMP.

[0022] Compared with the prior art, the present invention has at least the following beneficial effects:

[0023] The present invention discovers the renal cancer prognosis marker TYMP. The present invention pioneerly explores using the FDA-approved drug TAS-102 as a carrier for new uses of old drugs, and discovers its important role in regulating ferroptosis of renal cancer and activating CD8+ T cell anti-tumor immunity in thymidine metabolism, enriching the understanding of the mechanism of action of the thymidine phosphorylase TYMP inhibitor TAS-102. The present invention discovers for the first time that TPI and TAS-102 can effectively inhibit the in vivo growth ability of a renal cancer mouse model and can be used as a potential drug for treating renal cancer clinically, which has important scientific significance and clinical application value. The present invention helps to provide new therapeutic targets and therapeutic drugs for clinically refractory renal cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1(a) shows the protein expression of TYMP in 4 pairs of renal cancer tissues detected by WB;

[0025] Figure 1(b) shows TYMP immunohistochemical staining of a renal cancer tissue microarray and statistical analysis of the tissue scores of TYMP;

[0026] Figure 1(c) shows prognostic analysis based on the tissue scores of TYMP;

[0027] Figure 2(a) shows the knockdown effects of TYMP detected by WB and qPCR respectively;

[0028] Figure 2(b) shows that knocking down TYMP inhibits the proliferation ability of renal cancer cells;

[0029] Figure 2(c) shows that knocking down TYMP inhibits the migration ability of renal cancer cells;

[0030] Figure 3(a) shows the expression of ferroptosis-related proteins detected by WB and qPCR respectively after knocking down TYMP;

[0031] Figure 3(b) shows the intracellular Fe2+ concentration in renal cancer cells detected by a fluorescent probe after knocking down TYMP;

[0032] Figure 3(c) shows the change in the amount of Lipid-ROS detected by flow cytometry after knocking down TYMP;

[0033] Figure 4(a) shows the growth rate detected after treating renal cancer cells with the TYMP inhibitor TPI / TAS-102;

[0034] Figure 4(b) shows the morphological changes of mitochondria detected by transmission electron microscopy after treating renal cancer cells with the TYMP inhibitor TPI / TAS-102;

[0035] Figure 4(c) shows the expression of ferroptosis-related proteins detected by WB after treating renal cancer cells with the TYMP inhibitor TPI / TAS-102;

[0036] Figure 5(a) shows confocal fluorescence images collected after staining renal cancer cells with the mitochondrial fluorescent indicator mito-tracker after knocking down TYMP or treating with the TYMP inhibitor TPI / TAS-102;

[0037] Figure 5(b) shows confocal fluorescence images collected after co-staining renal cancer cells with the mitochondrial fluorescent indicator mito-tracker and the mtDNA dye Picogreen after knocking down TYMP or treating with the TYMP inhibitor TPI / TAS-102;

[0038] Figure 6(a) shows the expression of interferon-related factors detected by qPCR in the TYMP knockdown group and the TYMP knockdown combined with ddC treatment group;

[0039] Figure 6(b) shows the expression of interferon-related factors in the TAS-102 treatment group and the TAS-102 combined with ddC treatment group detected by qPCR. (Note: ddC treatment is to remove mitochondrial DNA and reduce inflammatory stimulation signals);

[0040] Figure 7(a) shows the knockdown of Tymp in murine Renca cells and its effect on ferroptosis detected by WB;

[0041] Figure 7(b) shows that the knockdown of TYMP inhibits the in situ tumorigenic ability of Renca cells in the kidney;

[0042] Figure 7(c) shows CD4 and CD8 immunohistochemical staining of mouse tumor tissues with TYMP knockdown;

[0043] Figure 8(a) shows that intraperitoneal administration of TAS-102 inhibits the in situ tumorigenic ability of Renca cells in the kidney;

[0044] Figure 8(b) shows CD4 and CD8 immunohistochemical staining of mouse tumor tissues in the TAS-102 administration group. Detailed implementation manners

[0045] To make the technical problems, technical solutions and advantages to be solved by the present invention clearer, the following will be described in detail with reference to the accompanying drawings and specific embodiments.

[0046] Example 1: Discovery of the renal cancer marker TYMP

[0047] Referring to the results in Figure 1(a), Figure 1(b) and Figure 1(c), WB and immunohistochemical staining analysis show that TYMP is highly expressed in renal cancer tissues and can be used as an independent prognostic factor for renal cancer.

[0048] Specific implementation steps:

[0049] 1. Sample source:

[0050] (1) Immunohistochemistry: Tumor tissue samples (229 cases) and normal renal tissue samples (142 cases) of partial nephrectomy or radical nephrectomy in patients who came to our hospital for treatment and surgery during the period from 2016 to 2023 and were pathologically verified as renal clear cell carcinoma.

[0051] (2)Four pairs of lesion and paired normal renal tissue samples from patients who underwent radical nephrectomy in our department between December 2022 and September 2023 and were pathologically diagnosed with clear cell renal cell carcinoma. Within 10 - 15 minutes after the fresh tissue was removed from the body, it was placed in liquid nitrogen. After cryopreservation, part of it was used for protein extraction, and part was immersed in formalin for 24 hours, followed by dehydration and paraffin embedding procedures to construct paraffin tissue blocks and microarray chips. After the first part of the samples were used to construct tissue microarray chips, immunohistochemical staining experiments were performed to analyze the localization of TYMP protein and clarify the significance of its differential expression in combination with clinical information; the second part of the samples was used for Western Blot experiments to verify the protein expression.

[0052] 2. Figure 1(a): Western blot analysis of the expression differences of TYMP in tumors and adjacent tissues; Figures 1(b) - 1(c): Immunohistochemical analysis of the staining abundance of TYMP, and scoring was performed according to the calculation method of the product of staining intensity and the number of positive cells; combined with the clinical follow-up information of the patients, the correlation between prognostic differences and clinical characteristics was statistically analyzed.

[0053] Example 2 shRNA knockdown of TYMP

[0054] Referring to the results in Figures 2(a), 2(b), 2(c), 3(a), 3(b) and 3(c), knockdown of TYMP by shRNA inhibited the growth and migration ability of renal cancer cells; knockdown of TYMP by shRNA promoted ferroptosis of renal cancer cells.

[0055] Specific implementation steps:

[0056] 1. Sample source: The functions and behaviors of common renal cancer cell lines and normal renal tubular epithelial cells 293TN were verified. They were all purchased from the Peking Union Medical College Cell Bank and were all identified by STR.

[0057] 2. Figure 2(a): Interfere with TYMP in two cell lines with high expression, and the results of Western blot and qPCR were used to verify the effect of interfering with TYMP; Figure 2(b): Transfect the shTYMP - GFP plasmid to construct a stable interfering cell line, and observe the cell proliferation after 72h; Figure 2(c): Take 10,000 cells with stable interference of TYMP and plate them into the upper chamber of the transwell respectively, add serum-free medium, and observe the number of cells in the lower layer after 24h, and count the number of cells after crystal violet staining.

[0058] 3. Figure 3(a): Western blot and qPCR results were used to analyze the expression of key molecules related to ferroptosis after interfering with TYMP; Figure 3(b): Take 2000 cells from the control group and the treatment group, plate them in a confocal dish, and add Fe after 24h 2+After incubating with the staining reagent and Hoechst for 30 minutes, the morphology of ferrous ions was observed under a super-resolution microscope; Figure 3 (c): 10,000 control group and treatment group cells were selected, resuspended in PBS after digestion, and a Lipid-ROS detection reagent was added, and the proportion of ROS was analyzed by flow cytometry.

[0059] Example 3 Cell Experiment

[0060] Referring to the results in Figure 4 (a), Figure 4 (b), and Figure 4 (c), after treatment with TPI and TAS-102, the growth of renal cancer cells was significantly inhibited and the ferroptosis pathway was activated.

[0061] Specific implementation steps:

[0062] 1. Add the TYMP-targeted inhibitor TPI and the FDA-approved drug TAS-102. After determining the appropriate treatment concentration, carry out subsequent cell experiments.

[0063] 2. Figure 4 (a): In renal cancer cells overexpressing PLKO.1-GFP, add the drugs TPI (20 uM for 48 h) and TAS-102 (10 uM for 48 h) respectively, and observe cell proliferation; Figure 4 (b): After extracting cell proteins, verify the expression of ferroptosis-related proteins; Take 1×10 7 cells, treat them with TPI and TAS-102 respectively, and then observe the mitochondrial morphology under an electron microscope.

[0064] Example 4 Results of Confocal Fluorescence Image Acquisition

[0065] Referring to the results in Figure 5 (a) and Figure 5 (b), after knocking down TYMP with shRNA or treating with the TYMP inhibitors TPI / TAS-102, it led to abnormal mitochondrial morphology and promoted the release of mitochondrial DNA into the cytoplasm.

[0066] Specific implementation steps:

[0067] Figure 5 (a): After stably interfering with TYMP or adding TPI and TAS-102, add mitotracker-GFP and Hoechst into the cells. After incubating for 30 minutes, observe the mitochondrial morphology in the cells under a super-resolution microscope; Figure 5 (b): After stably interfering with TYMP or adding TPI and TAS-102, add mitotracker-RFP, Picogreen, and Hoechst into the cells. After incubating for 30 minutes, observe the mitochondrial morphology and the distribution of mitochondrial DNA in the cells under a super-resolution microscope.

[0068] Example 5 IFN Inflammatory Signaling Pathway Analysis

[0069] Referring to the results in Figures 6(a) and 6(b), the IFN inflammatory signaling pathway was activated after shRNA knockdown of TYMP or treatment with the TYMP inhibitor TAS-102.

[0070] Specific implementation steps:

[0071] Figures 6(a) and 6(b): After interfering with TYMP or adding TAS-102, the activation of the common type I interferon pathway was clarified by qPCR experiments, further demonstrating that cytoplasmic mitochondrial DNA stimulates the inflammatory signal phenotype. ddC was added to remove mitochondrial DNA, and the changes in inflammatory signals were demonstrated by qPCR experiments.

[0072] Example 6 Animal Experiment

[0073] A mouse Renca kidney orthotopic tumorigenesis model was established. Referring to the results in Figures 7(a), 7(b), 7(c), 8(a) and 8(b), shRNA knockdown of TYMP significantly inhibited the in vivo orthotopic tumorigenesis ability; immunohistochemical staining showed that knockdown of TYMP promoted the recruitment of CD4+ and CD8+ T cells in the tumor microenvironment; after intraperitoneal injection of TAS-102, the combined treatment group significantly inhibited the in vivo orthotopic tumorigenesis ability; immunohistochemical staining showed that TAS-102 promoted the recruitment of CD4+ and CD8+ T cells in the tumor microenvironment.

[0074] Specific implementation steps:

[0075] 1. Basic process of animal experiment: 4-week-old female BALB / C mice were selected as experimental subjects. The mice were used to construct a renal cancer model by orthotopic tumorigenesis and randomly divided into two groups, with 4 mice in each of the control group and the interference group. After Renca cells were cultured to 1×10 7 , they were mixed with Matrigel at a ratio of 1:1. After the mice were anesthetized with isoflurane, 200 μl of tumor cells were injected in situ using an insulin needle. After the model was established, the status of the mice was observed, and the mice were euthanized on the 24th day. The orthotopic tumors were taken for photography and weighing. After the tissues were fixed, immunohistochemistry was used to stain the mouse tissues. Drug administration plan: Three days after tumorigenesis, TAS-102 was intraperitoneally injected once every two days at a dose of 3 mg / kg, and the control group was injected with the same volume of PBS at the same frequency.

[0076] 2. Figure 7(a): Western blot experiment was used to analyze the efficiency of interfering with TYMP and the changes in ferroptosis-related proteins in renca cells; Figure 7(b): renca cells interfering with TYMP or the control group were injected into BALB / C mice. After 24 days of model establishment, the materials were taken, and the tumor size was analyzed and weighed and recorded; Figure 7(c): Immunohistochemical staining was used to analyze the recruitment of CD4- and CD8-positive T cells after interfering with TYMP.

[0077] 3. Figure 8 (a): On the third day after tumor formation in BALB / C mice, TAS-102 was injected, and samples were taken 24 days later to observe the tumor size and record the weight; Figure 8 (b): Immunohistochemical staining was used to analyze the recruitment of CD4- and CD8-positive T cells in the tumors of mice after the addition of TAS-102.

[0078] The above are the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.

Claims

1. Use of a TYMP inhibitor in the preparation of a drug for promoting ferroptosis of renal clear cell carcinoma cells, characterized in that: The TYMP inhibitor consists of TPI and TAS-102.

Images