A SNP molecular marker for identifying arabinoxylan content of wheat and application thereof

Abstract

The application discloses a SNP molecular marker for identifying the content of wheat arabinoxylan and application thereof. The application belongs to the technical field of biology and specifically comprises detecting the polymorphism or genotype (allele) of an SNP site in a wheat genome to be measured, and identifying or assisting in identifying the content of wheat arabinoxylan according to the genotype, wherein the SNP site is a site on a 4D chromosome of wheat, the nucleotide type of which is A or G, and the 36th nucleotide in sequence 1 in a sequence table. The application can be used for predicting the content of wheat arabinoxylan and for wheat breeding. The substance for detecting the polymorphism and genotype of the above SNP site can be combined with other substances (such as a substance for detecting a single nucleotide polymorphism or genotype of another molecular marker related to the content of wheat arabinoxylan) to prepare a product for identifying wheat arabinoxylan with high content.

Description

Technical Field

[0001] This invention belongs to the field of plant breeding, specifically relating to an SNP molecular marker for identifying the content of arabinoxylan in wheat and its application. Background Technology

[0002] Wheat (Triticum aestivum L.) is one of my country's most important food crops, providing humans with carbohydrates, protein, dietary fiber, vitamins, and minerals. Its continued healthy development is of great significance to ensuring my country's food security. Arabinoxylans (AX), a major component of dietary fiber in wheat grains, is mainly found in the aleurone layer of wheat kernels. Based on differences in water solubility, it is divided into two categories: water-extractable arabinoxylans (WE-AX) and water-unextractable arabinoxylans (WU-AX), collectively referred to as total arabinoxylans (TOT-AX). AX is an important factor in the quality of whole wheat. Furthermore, in terms of processing quality, AX plays a crucial role in milling quality, dough rheological properties, baking, and other processing qualities. In terms of physiological functions, AX can also promote the growth of beneficial intestinal bacteria, enhance immune system activity, provide antioxidant effects, and lower blood sugar levels, significantly enhancing human immunity.

[0003] The AX content varies considerably among different tissues and varieties (lines) of wheat, and is significantly influenced by genotype, indicating that it is a quantitative trait controlled by multiple genes, suggesting that improving dietary fiber content through molecular breeding is feasible. With the development of wheat 9K, 50K, 90K, and 660K microarrays and next-generation sequencing technologies, SNP markers have been widely used. However, SNP marker information mainly comes from microarrays or resequencing, which is too costly for large-scale application. Using wheat SNP microarray genotype data for QTL mapping and GWAS analysis, and converting linked SNPs into KASP markers, can facilitate efficient, low-cost, and precise MAS breeding of complex agronomic traits in wheat. Currently, QTL mapping and GWAS analysis have identified multiple QTLs and associated loci affecting grain TOT-AX and WE-AX content. Among them, the QTL located on chromosome 1BL has been consistently detected in different studies, and the SNP marker closely linked to this QTL has been successfully developed into a KASP marker and confirmed in different studies. Therefore, identifying genetic loci affecting AX content and developing KASP markers that affect AX content for breeding purposes is of great significance for wheat quality improvement.

[0004] Jimai 22 is a high-yielding, multi-resistant, and high-quality medium-gluten wheat variety, with a cumulative planting area exceeding 21 million hectares, ranking first in the country for 13 consecutive years. It is suitable for planting in suitable areas of Henan and Anhui provinces in the northern and southern parts of the Huang-Huai winter wheat region. Zhongmai 578 is a high-yielding, multi-resistant, and high-quality strong-gluten wheat variety, with quality comparable to imported Canadian wheat. In 2020, it set a record for high yield of high-quality strong-gluten wheat (841.5 kg / mu) and passed national approval in June 2021. It is suitable for planting in irrigated areas in the northern part of the Huang-Huai winter wheat region. Zhongmai 578 and Jimai 22 are varieties with medium AX content. A recombinant inbred line (RIL) population including 262 families was constructed using Zhongmai 578 and Jimai 22. Summary of the Invention

[0005] The problem to be solved by this invention is how to identify or assist in the identification of wheat arabinoxylan content using high throughput.

[0006] To address the above technical problems, this invention first provides a method for identifying or assisting in the identification of wheat arabinoxylan content, including detecting the genotype of SNP sites in the genome of the wheat to be tested, and identifying or assisting in the identification of wheat arabinoxylan content based on the genotype. The SNP site is a site on wheat chromosome 4D, and its nucleotide type is A or G, which is the 36th nucleotide of sequence 1 in the sequence listing.

[0007] The genotype is AA or GG, where AA is a homozygous form of the SNP with nucleotide A, and GG is a homozygous form of the SNP with nucleotide G. The arabinoxylan content of the tested wheat with the SNP genotype GG is superior to that of the tested wheat with the SNP genotype AA.

[0008] The reference genome sequence of the wheat variety Chinese Spring RefSeq v1.0 (https: / / urgi.versailles.inra.fr / blast_iwgsc / ) was used as the reference genome, and the SNP site was located at 96,148,463 bp on wheat chromosome 4D (specifically, position 36 of sequence 1 in the sequence listing).

[0009] As one implementation, the method for identifying or assisting in the identification of wheat arabinoxylan content may include the following steps:

[0010] (1) Using the genomic DNA of the wheat to be tested as a template, KASP labeling detection was performed using a primer composition; the primer composition consisted of primer A, primer B and primer C;

[0011] Primer A is a single-stranded DNA molecule whose nucleotide sequence is sequence 2 in the sequence listing or whose nucleotide sequence is the single-stranded DNA at positions 22-42 of sequence 2 in the sequence listing;

[0012] Primer B is a single-stranded DNA molecule whose nucleotide sequence is sequence 3 in the sequence listing or whose nucleotide sequence is single-stranded DNA at positions 22-42 of sequence 3 in the sequence listing;

[0013] Primer C is a single-stranded DNA molecule whose nucleotide sequence is sequence 4 in the sequence listing;

[0014] (2) After completing step (1), perform fluorescence detection to determine the genotype of the SNP in the wheat to be tested;

[0015] (3) The content of arabinoxylan in the wheat to be tested was determined based on the genotype results: the content of arabinoxylan in the wheat to be tested with the genotype GG of the SNP was better than that in the wheat to be tested with the genotype AA of the SNP.

[0016] The application of the above methods in wheat breeding also falls within the scope of protection of this invention.

[0017] This invention also provides the application of a substance for detecting KASP polymorphisms or genotypes in the wheat genome in any of the following:

[0018] (1) To identify or assist in the identification of wheat arabinoxylan content;

[0019] (2) Wheat breeding;

[0020] (3) Prepare products for identification or auxiliary identification of wheat arabinoxylan content;

[0021] (4) Prepare products for wheat breeding;

[0022] This invention also provides a method for wheat breeding.

[0023] The wheat breeding method provided by the present invention includes detecting the genotype of the SNP locus in the wheat genome, selecting wheat with the genotype of the SNP being GG as the parent for breeding, wherein GG is the homozygous type of the SNP being G.

[0024] As an implementation method, wheat breeding methods may include the following steps:

[0025] (1) Using the genomic DNA of the wheat to be tested as a template, PCR amplification was performed using the above primer set;

[0026] (2) After completing step (1), perform fluorescence detection to determine the genotype of the SNP site in the wheat to be tested;

[0027] (3) Select wheat germplasm with GG genotype for breeding superior wheat with high arabinoxylan content.

[0028] In the above method, the primer dissolution and preparation method can be as follows: First, dilute the three primers to 100 μM with ddH2O, and then prepare the primer working solution as follows: 12 μL of primer A, 12 μL of primer B, 30 μL of primer C, and 46 μL of ddH2O. This solution is used as the KASP-labeled primer working solution and stored at -20℃ for later use.

[0029] In the above method, the PCR reaction system can be: 2.0 μl KASP 2×Master Mix (ABclonal), 0.048 μl KASP primers (3 primers mixed, total concentration 50 μM, where the molar ratio of the two upstream primers A and B to the downstream primer C is 2:2:5), and 1.952 μl template DNA (50 ng / μl). The primers were synthesized by Beijing Tianyi Huiyuan Biotechnology Co., Ltd. In the above method, PCR amplification can be performed on a high-throughput PCR instrument. Amplification was performed using a 384-well PCR instrument (BIO-RAD, S1000TM ThermalCycler).

[0030] In the above method, the PCR reaction procedure can be as follows:

[0031] Step 1: Pre-denaturation at 94℃ for 15 min;

[0032] Step 2: Denaturation at 94℃ for 20 seconds, annealing for 20 seconds (the first annealing temperature is 65℃, and the temperature is reduced by 1℃ for each cycle) for a total of 10 cycles;

[0033] Step 3: Denaturation at 94℃ for 20 seconds, annealing at 57℃ for 1 minute, for a total of 32 cycles;

[0034] The method described above for determining the genotype of the SNP in the wheat sample is as follows: After the PCR reaction, the fluorescence signal is detected using an automated focusing fluorescence multi-mode microplate reader (PHERAstar Plus, BMG Labtech GmbH, Germany), and genotyping is performed using Klustercaller v3.4 (LGC, Hoddesdon, UK). For the K_AX-110966723 marker (SNP site AX-110966723), A base type exhibits FAM fluorescence, distributed near the y-axis; G base type exhibits HEX fluorescence, distributed near the x-axis; samples with no detected signal are distributed near the origin.

[0035] This invention also provides products for detecting polymorphisms or genotypes of SNP sites in the wheat genome.

[0036] The product provided by this invention for detecting polymorphisms or genotypes of SNP sites in the wheat genome contains any of the aforementioned substances for detecting polymorphisms or genotypes of SNP sites in the wheat genome.

[0037] C1) Products that detect single nucleotide polymorphisms or genotypes related to wheat arabinoxylan content;

[0038] C2) Products used for identification or auxiliary identification of wheat arabinoxylan content;

[0039] C3) Products used in wheat breeding.

[0040] In the above applications, methods, and products, the substance may be a reagent and / or instrument required to determine the polymorphism or genotype of the SNP site by at least one of the following methods: DNA sequencing, restriction fragment length polymorphism, single-strand conformation polymorphism, denaturing high-performance liquid chromatography, and SNP chips. The SNP chips include chips based on nucleic acid hybridization reactions, chips based on single-base extension reactions, chips based on allele-specific primer extension reactions, chips based on one-step reactions, chips based on primer ligation reactions, chips based on restriction endonuclease reactions, chips based on protein-DNA binding reactions, and chips based on fluorescent molecule-DNA binding reactions.

[0041] Optionally, the substance is D1), D2), or D3):

[0042] D1) The substance described is a primer composition for amplifying wheat genomic DNA fragments including the SNP sites;

[0043] D2) The substance described is a PCR reagent containing the primer composition described in D1);

[0044] D3) The substance is a kit containing the primer composition described in D1) or the PCR reagent described in D2).

[0045] Optionally, the amplification may be PCR amplification. The primer composition consists of primer A, primer B, and primer C.

[0046] The kit described in D3 may also include KASP 2×Master Mix.

[0047] In the above applications, methods, and products, the primer composition may or may not be labeled with a marker. The marker refers to any atom or molecule that can be used to provide a detectable effect and can be linked to a nucleic acid. Markers include, but are not limited to, dyes; radioactive markers, such as 32P; binding moieties, such as biotin; haptens, such as digoxigenin (DIG); luminescent, phosphorescent, or fluorescent moieties; and fluorescent dyes alone or in combination with moieties whose emission spectra can be inhibited or shifted by fluorescence resonance energy transfer (FRET). The marker can provide a signal detectable by fluorescence, radioactivity, colorimetry, gravimetric determination, X-ray diffraction or absorption, magnetism, enzyme activity, etc. The marker can be a charged moiety (positive or negative charge) or, optionally, charge-neutral. The marker can include nucleic acid or protein sequences or combinations thereof, provided that the sequence containing the marker is detectable. In some embodiments, nucleic acids are detected directly without labeling (e.g., direct sequence reading). The primer composition described herein may be a primer composition consisting of single-stranded DNA with nucleotide sequences of positions 22-42 of sequence 2 in the sequence listing, single-stranded DNA with nucleotide sequences of positions 22-42 of sequence 3 in the sequence listing, and single-stranded DNA with nucleotide sequences of sequence 4 in the sequence listing. Alternatively, the primer composition may be a primer set consisting of single-stranded DNA shown in sequence 2, sequence 3, and sequence 4 in the sequence listing. Sequence 2 in the sequence listing consists of 42 nucleotides, with nucleotides 1-21 being the FAM sequence (as a marker) and nucleotides 22-42 being the specific sequence; Sequence 3 in the sequence listing consists of 42 nucleotides, with nucleotides 1-21 being the HEX sequence (as a marker) and nucleotides 22-42 being the specific sequence.

[0048] The present invention also provides a DNA molecule, the nucleotide sequence of which is shown in Sequence 1 of the sequence listing.

[0049] The applications of the aforementioned DNA molecules also fall within the scope of protection of this invention. Specifically, the applications are those found in any of the following:

[0050] (1) To identify or assist in the identification of wheat arabinoxylan content;

[0051] (2) Wheat breeding;

[0052] (3) Prepare products for identification or auxiliary identification of wheat arabinoxylan content;

[0053] (4) Prepare products for wheat breeding.

[0054] Optionally, in the above applications, the DNA molecule serves as a detection target.

[0055] The substance that detects the SNP site polymorphism and genotype can be combined with other substances (such as substances that detect single nucleotide polymorphisms or genotypes of other molecular markers related to wheat arabinoxylan content) to prepare a product for identifying wheat varieties with wheat arabinoxylan content.

[0056] In this document, the purpose of the breeding may include developing high-yielding wheat. The wheat may be a pure line or an inbred line.

[0057] In this article, the arabinoxylan content includes two types: water-extractable arabinoxylans (WE-AX) and water-unextractable arabinoxylans (WU-AX).

[0058] The total arabinoxylan (TOT-AX) and WE-AX contents were determined by the phloroglucinol-colorimetric method described by Hernandez-Espinosa et al. of CIMMYT Laboratory (Quantification of the total and water-extractable pentosan content in wheat flour using a higher-throughput version of the phloroglucinolcolorimetric assay, 2023).

[0059] The TOT-AX content (mg) = (△Asample-b) × V1 × V2 × 1000 ÷ (a × F × A1 × A2)

[0060] WE-AX content (mg) = (△Asample - b) × V1 × 1000 ÷ (a × F × A1)

[0061] △Asample = The difference in absorbance of the sample at 552nm and 510nm used for analysis (A 552 -A 510 )

[0062] a = The slope of the xylose standard curve. This value varies depending on the curve.

[0063] b = the intercept of the xylose standard curve. This value varies depending on the curve.

[0064] F = the mass of whole wheat flour used for analysis (20 mg);

[0065] V1 = Volume used for extracting arabinoxylan (1000 μL);

[0066] A1 = The volume (75 μL) used to extract the sample for the colorimetric reaction;

[0067] V2 = The volume (1800 μL) used to dilute the sample after the sulfuric acid dissolution step;

[0068] A2 = The volume (300 μL) used to dilute the sample after the sulfuric acid dissolution step;

[0069] 1000 = Used to convert results from mg / mg to mg / g.

[0070] The KASP marker developed in this invention can be effectively used to screen and identify wheat varieties with high arabinoxylan content. It can also be used to aggregate target genes, increase wheat arabinoxylan content in offspring lines, improve breeding efficiency, and reduce costs caused by phenotypic testing. Attached Figure Description

[0071] Figure 1 The plots of QgTOT-AX.caas-4D and QgWE-AX.caas-4DLOD curves located in the Zhongmai 578 × Jimai 22RIL population.

[0072] Figure 2 Genotyping results of 161 wheat varieties using the KASP marker K_AX-110966723. In (a), red fluorescence indicates the AA genotype and blue fluorescence indicates the GG genotype; (b) shows the TOT-AX and WE-AX contents of the 161 wheat germplasms. Detailed Implementation

[0073] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0074] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0075] Unless otherwise specified, the quantitative experiments in the following examples are all repeated three times, and the results are averaged.

[0076] The wheat varieties Zhongmai 578, Jimai 22 and 161 in the following examples have been described in: Liu D, Zhao DH, Zeng JQ, Shawai RS, Tong JY, Li Ming, Li FJ, Zhou S, Hu WL, Xia XC, Tian YB, Zhu Q, Wang CP, Wang DS, He ZH, Liu JD*, Zhang Y* (2023) Identification of genetic loci for grain yield-related traits in the wheat population Zhongmai 578 / Jimai22. Journal of Integrative Agriculture. 22(7), 1985-1999. The biological material is available to the public from the applicant and is used only for repeating the experiments of the present invention and shall not be used for any other purpose.

[0077] The following examples use SAS v9.4 statistical software to process the data. The experimental results are expressed as mean ± standard deviation. The ANOVA test was performed using the Proc GLM program. P < 0.05 (*) indicates a significant difference, P < 0.01 (**) indicates a highly significant difference, and P < 0.001 (***) indicates a highly significant difference.

[0078] Example 1: Discovery of QTLs for arabinoxylan content in Jimai 22 and acquisition of its linked KASP marker.

[0079] I. Acquisition of Phenotypic and Genotypic Data on Arabicaxylan Content

[0080] The Zhongmai 578 / Jimai 22RIL population (262 families) was planted in Xinxiang, Henan (34°53′N, 113°23′E) in 2020-2021, and in Xinxiang, Henan and Dezhou, Shandong (37°45′N, 116°37′E) in 2021-2022. A Latin square design with three replicates, 6 rows, row length 3.0m, row width 0.2m, and 270 seeds per square meter were mechanically sown. Agronomic management was carried out according to local experimental conditions.

[0081] The total arabinoxylan (TOT-AX) and WE-AX contents of each sample strain were determined by the phloroglucinol-colorimetric method described by HERNANDEZ-ESPINOSA et al. (2023) of CIMMYT laboratory, with modifications made to the sample weighing part.

[0082] Weigh 20 mg of whole wheat flour into a 2 ml centrifuge tube (Safe-lock Eppendorf), repeat twice, pre-extract TOT-AX from the sample using 1 M H2SO4 solution, and extract WE-AX from the sample using distilled water. Then, mix the AX-dissolved solution with the extraction solution (110 mL glacial acetic acid, 2.3 mL concentrated hydrochloric acid, 5.4 mL 10% (w / v) phloroglucinol-ethanol solution, 1.0 mL 1.75% (w / v) glucose solution), and react at 99 °C and 700 rpm for 23 min. After the reaction, quickly place it on ice to cool for 3-5 min. Quickly pipette 300 μL of the reaction solution into an ELISA 96-well plate (Corning, Lot: 02418001), and measure the absorbance at 552 nm and 510 nm respectively. To eliminate the influence of hexose, the difference between the two (△Asample) is used as the absorbance value. Calculate the AX content according to the xylose standard curve and formulas (1) and (2):

[0083] TOT-AX content (mg) = (△Asample-b) × V1 × V2 × 1000 ÷ (a × F × A1 × A2)

[0084] WE-AX content (mg) = (△Asample - b) × V1 × 1000 ÷ (a × F × A1)

[0085] △Asample = The difference in absorbance of the sample at 552nm and 510nm used for analysis (A 552 -A 510 )

[0086] a = The slope of the xylose standard curve. This value varies depending on the curve.

[0087] b = the intercept of the xylose standard curve. This value varies depending on the curve.

[0088] F = the mass of whole wheat flour used for analysis (20 mg);

[0089] V1 = Volume used for extracting arabinoxylan (1000 μL);

[0090] A1 = The volume (75 μL) used to extract the sample for the colorimetric reaction;

[0091] V2 = The volume (1800 μL) used to dilute the sample after the sulfuric acid dissolution step;

[0092] A2 = The volume (300 μL) used to dilute the sample after the sulfuric acid dissolution step;

[0093] 1000 = Used to convert results from mg / mg to mg / g.

[0094] Genomic DNA was extracted from young leaves of 262 families using a high-low salt pH method. DNA concentration was determined using a NanoDrop 2000c spectrophotometer, and the DNA samples were adjusted to a standard concentration of 50 ng / µl. DNA quality was then assessed using 0.8% agarose gel electrophoresis, and qualified DNA samples were used for SNP genotyping. SNP analysis was performed using a 50K SNP chip developed in collaboration between the Institute of Crop Science, Chinese Academy of Agricultural Sciences, and Affymetrix Axiom.

[0095] II. Linkage Graph Construction

[0096] Genotyping of the family and two parents was performed using the CapitalBio Corporation (http: / / www.capitalbio.com) wheat 50K SNP chip, containing a total of 55,224 SNPs. The genotyping data was filtered according to the following criteria: markers with no polymorphism between parents, a deletion rate >20%, and a minimum allele frequency (MAF) <30% were removed, leaving 9354 high-quality polymorphic markers. IciMapping v4.2 was used for further analysis. http: / / www.isbreeding.net / The BIN function in the software processed the filtered polymorphic markers, grouping markers with the same genotype into the same bin. Thirty-four linkage groups were constructed, comprising 1501 bins. Genetic linkage maps were drawn using JoinMap v4.0 and MapChart v2.32 software (https: / / www.wur.nl / en / show / Mapchart.htm).

[0097] III. QTL Analysis

[0098] QTLs were detected using the complete interval mapping method in IciMapping v4.2, with a LOD threshold of 2.5. Two stable QTLs were located on wheat chromosome 4D, jointly influencing the content of TOT-AX and WE-AX, and were named QgTOT-AX.caas-4D and QgWE-AX.caas-4D. Figure 1The flanking markers are AX-109429915 and AX-110468740, with a physical range of 92.2–118.6 Mb. They explained 6.9–19.6% of the phenotypic variation across the three environments (Table 1). The SNP site AX-110966723 at physical location 96148463 bp on wheat chromosome 4D was significantly correlated with wheat TOT-AX and WE-AX content; therefore, it was converted to the KASP marker K_AX-110966723 for marker-assisted selection breeding. The SNP site AX-110966723 is located at position 36 of sequence 1, and its nucleotide type is A or G. The nucleotide sequence of sequence 1 is the sequence at physical location 96148463 bp–96148533 bp on wheat chromosome 4D. In the sequence listing, 'r' in sequence 1 indicates A or G.

[0099] Table 1. QTLs of the effect of the Zhongmai 578 × Jimai 22RIL population on AX content using the complete interval plotting method

[0100]

[0101] Note: LOD a The logarithm of the maximum likelihood ratio; PVE b Indicates the phenotypic variability; Add c The value indicates an additive effect; a positive value indicates that the superior allelic variation comes from Zhongmai 578, and a negative value indicates that the superior allelic variation comes from Jimai 22.

[0102] IV. Obtaining the primer set and genotyping of the KASP marker K_AX-110966723

[0103] A primer set based on KASP technology was designed to detect the SNP polymorphism site K_AX-110966723 using the KASP marker, referred to as the KASP primer set. The KASP primer set consists of two upstream primers (primer A and primer B) and one downstream primer (primer C), and the specific sequences are shown in Table 2.

[0104] Table 2. Primer sequence information for the KASP marker K_AX-110966723 used to identify common small allele variations.

[0105] Primer name Position in the sequence list Sequence (5'-3') A Sequence 2 GAAGGTGACCAAGTTCATGCTTGCTGGTCAGATATGTAGCGT B Sequence 3 GAAGGTCGGAGTCAACGGATTTGCTGGTCAGATATGTAGCGC C Sequence 4 GCCATACTACATTGTGCCACG

[0106] Note: GAAGGTGACCAAGTTCATGCT For FAM tag sequence A, GAAGGTCGGAGTCAACGGATT The HEX tag sequence is B.

[0107] Primer A is a primer with a FAM fluorescent tag sequence (underlined bases) at the 5' end, and primer C amplifies the fragment with SNP site K_AX-110966723 as T. The fluorescent signal of the FAM group can be read by an enzyme-linked immunosorbent assay (ELISA) reader or a real-time PCR instrument.

[0108] Primer B is a primer with a HEX fluorescent tag sequence (underlined bases) at the 5' end, and primer C amplifies the fragment where the SNP site K_AX-110966723 is C. The fluorescent signal of the HEX group can be read using an ELISA reader or a real-time PCR instrument.

[0109] The KASP marker K_AX-110966723 was used to detect different allelic types of wheat QSN-caas.4D at the physical location 96148463 bp on chromosome 4D (SNP site AX-110966723). This SNP site AX-110966723 represents an A / G base difference, and these two allelic types were named QSN-caas.4Da and QSN-caas.4Db, respectively. The allelic type carrying FAM fluorescence and located near the x-axis is QSN-caas.4Da (abbreviated as AA genotype), with the SNP site containing nucleotide A; the allelic type carrying HEX fluorescence and located near the y-axis is QSN-caas.4Db (abbreviated as GG genotype), with the SNP site containing nucleotide G.

[0110] KASP reaction process:

[0111] (1) Using the genomic DNA of the wheat to be tested as a template, PCR amplification was performed using the above primer set;

[0112] (2) After completing step (1), perform fluorescence detection to determine the genotype of the SNP site in the wheat to be tested;

[0113] (3) Select wheat germplasm with GG genotype for breeding superior wheat with high arabinoxylan content.

[0114] In the above method, the primer dissolution and preparation method can be as follows: First, dilute the three primers to 100 μM with ddH2O, and then prepare the primer working solution as follows: 12 μL of primer A, 12 μL of primer B, 30 μL of primer C, and 46 μL of ddH2O. This solution is used as the KASP-labeled primer working solution and stored at -20℃ for later use.

[0115] In the above method, the PCR reaction system can be: 2.0 μl KASP 2×Master Mix (ABclonal), 0.048 μl KASP primers (a mixture of 3 primers with a total concentration of 50 μM, wherein the molar ratio of the two upstream primers A and B to the downstream primer C is 2:2:5), and 1.952 μl template DNA (50 ng / μl). The primers were synthesized by Beijing Tianyi Huiyuan Biotechnology Co., Ltd. In the above method, PCR amplification can be performed on a high-throughput PCR instrument.

[0116] Amplification was performed using a 384-well PCR instrument (BIO-RAD, S1000TM Thermal Cycler).

[0117] In the above method, the PCR reaction procedure can be as follows:

[0118] Step 1: Pre-denaturation at 94℃ for 15 min;

[0119] Step 2: Denaturation at 94℃ for 20 seconds, annealing for 20 seconds (the first annealing temperature is 65℃, and the temperature is reduced by 1℃ for each cycle) for a total of 10 cycles;

[0120] Step 3: Denaturation at 94℃ for 20 seconds, annealing at 57℃ for 1 minute, for a total of 32 cycles;

[0121] The method described above for determining the genotype of the SNP in the wheat sample is as follows: After the PCR reaction, the fluorescence signal is detected using an automated focusing fluorescence multi-mode microplate reader (PHERAstar Plus, BMG Labtech GmbH, Germany), and genotyping is performed using Klustercaller v3.4 (LGC, Hoddesdon, UK). For the K_AX-110966723 marker (SNP site AX-110966723), A base type exhibits FAM fluorescence, distributed near the y-axis; G base type exhibits HEX fluorescence, distributed near the x-axis; samples with no detected signal are distributed near the origin.

[0122] VI. Application of KASP marker K_AX-110966723 and its primer set in the identification of wheat arabinoxylan content

[0123] The experimental materials consisted of 161 wheat varieties (lines), including 139 main varieties promoted in the Huang-Huai wheat region and 22 foreign varieties. Specific information is shown in Table 3.

[0124] 1. Phenotypic determination of arabinoxylan content in 161 wheat varieties (lines)

[0125] Sixty-one wheat varieties (lines) were planted in four environments in Xinxiang, Henan (34°53′N, 113°23′E) and Gaoyi, Hebei (37°33′N, 114°26′E) during the 2020-2021 and 2021-2022 seasons, respectively. A randomized block design was used, with 40 seeds sown per row at 1m lengths and a row spacing of 20cm. Two biological replicates were performed for each variety. Field management followed local standard procedures. After normal harvesting and threshing, whole wheat flour was ground using a CT293 Cyclotec™ mill (Foss Tecator, Denmark) with a 0.5mm sieve and stored at -20℃. The contents of TOT-AX and WE-AX in the whole wheat flour of the 161 wheat varieties (lines) were determined by the phloroglucinol-colorimetric method. The results are shown in Table 3.

[0126] 2. Genotyping of wheat varieties using the K_AX-110966723 marker-based primer set.

[0127] The genotypes of all wheat experimental materials were detected using KSAP primers labeled K_AX-110966723. The results are shown in Table 3 and... Figure 2 .

[0128] Table 3 and Figure 2 In the text, AA indicates that the genotype of the wheat material at SNP site AX-110966723 is AA, GG indicates that the genotype of the wheat material at SNP site AX-110966723 is GG, and CK is a blank control without template DNA added to the reaction system. Of the 161 wheat varieties, 70 varieties had genotype AA (fluorescent signal is red, i.e., the nucleotide at SNP site AX-110966723 is A), and 89 varieties had genotype GG (fluorescent signal is blue, i.e., the nucleotide at SNP site AX-110966723 is G). Figure 2 (a)

[0129] Table 3. Genotyping results and TOT-AX and WE-AX content results of 161 wheat varieties (lines).

[0130]

[0131]

[0132]

[0133]

[0134]

[0135]

[0136] Note:a NA: Unidentified genotype; the material name with b number is HK1 / 6 / NVSR3 / 5 / BEZ / TVR / 5 / CFN / BEZ / / SU92 / CI13645 / 3NAI60.

[0137] Table 4 shows that the mean TOT-AX content of wheat germplasm carrying the QSN-caas.4Db allele type GG was 69.1 mg / g, which was higher than that of wheat germplasm carrying the QSN-caas.4Da allele type AA (mean 66.3 mg / g), a difference of 4.2%, reaching a significant difference (P<0.05). The mean WE-AX content of wheat germplasm carrying the QSN-caas.4Db allele type GG was 7.1 mg / g, which was higher than that of wheat germplasm carrying the QSN-caas.4Da allele type AA (mean 6.7 mg / g), a difference of 6.0%, reaching a significant difference (P<0.05). Figure 2 (b)

[0138] Table 4. Statistical analysis results of gene type and TOT-AX and WE-AX content of SNP locus AX-110966723.

[0139]

[0140] In summary, the molecular marker AX-110966723 of this invention can be used to assist in the identification of the content of arabinoxylan, the main component of dietary fiber in wheat grains, and has promising applications in the field of wheat breeding.

[0141] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. A method for identifying or assisting in the identification of wheat arabinoxylan content, characterized in that: This includes detecting the genotype of SNP sites in the wheat genome to be tested, and identifying or assisting in the identification of wheat arabinoxylan content based on the genotype. The SNP site is a site on wheat chromosome 4D, and its nucleotide type is A or G, which is the 36th nucleotide of sequence 1 in the sequence listing.

2. Application of substances for detecting SNP polymorphisms or genotypes in the wheat genome in any of the following: (1) To identify or assist in the identification of wheat arabinoxylan content; (2) Breeding for wheat with high arabinoxylan content; (3) Prepare products for identification or auxiliary identification of wheat arabinoxylan content; (4) To prepare breeding products with wheat arabinoxylan content; The SNP site is a site on wheat chromosome 4D, and its nucleotide type is A or G, which is the 36th nucleotide of sequence 1 in the sequence listing.

3. The application according to claim 2, characterized in that: The substance is either D1), D2), or D3). D1) The substance is a primer composition for amplifying wheat genomic DNA fragments including the SNP sites; D2) The substance is a PCR reagent containing the primer composition described in D1); D3) The substance is a kit containing the primer composition described in D1) or the PCR reagent described in D2).

4. The application according to claim 3, characterized in that: The primer composition consists of primer A, primer B and primer C; Primer A is a single-stranded DNA molecule whose nucleotide sequence is sequence 2 in the sequence listing or is a single-stranded DNA molecule whose nucleotide sequence is positions 22-42 of sequence 2 in the sequence listing; Primer B is a single-stranded DNA molecule whose nucleotide sequence is sequence 3 in the sequence listing or whose nucleotide sequence is single-stranded DNA at positions 22-42 of sequence 3 in the sequence listing; The primer C nucleotide sequence is the single-stranded DNA molecule of sequence 4 in the sequence listing.

5. The method according to claim 1 or the application according to claim 2, characterized in that: The genotype of the SNP locus is AA or GG, where AA is the homozygous type of the SNP being A, and GG is the homozygous type of the SNP being G; the arabinoxylan content of the tested wheat with the SNP genotype GG is higher than that of the tested wheat with the SNP genotype AA.

6. A method for breeding wheat with high arabinoxylan content, characterized in that: The method includes detecting the genotype of the SNP in claim 1 in the wheat genome, selecting wheat with the genotype GG of the SNP as a parent for breeding, wherein AA is a homozygous type of the SNP being A.

7. The application of the method according to claim 1 or 6 in the breeding of wheat arabinoxylan content.

Images