GmSPL3b gene snp marker and application thereof

Abstract

This invention relates to a GmSPL3b gene SNP marker and its application, belonging to the fields of plant molecular biology and crop genetics and breeding technology. The SNP marker is used for molecular detection of soybean flowering and maturity stages. The SNP is a single nucleotide mutation at position 94 and / or position 116 of the first exon of the soybean GmSPL3b gene, forming a nucleotide sequence as shown in SEQ ID NO. 1 and / or SEQ ID NO. 2; the polymorphism of the single nucleotide mutation is A / G polymorphism. This invention enables precise genotyping at the seedling stage, efficiently breeding early-maturing soybean varieties adapted to high-latitude regions. It can directly serve as a precise target for gene editing, providing a clear basis for molecular design breeding. It allows for rapid screening of ideal genotypes in early generations, reducing field workload, shortening the breeding cycle, and accelerating the selection of new varieties.

Description

Technical Field

[0001] This invention belongs to the field of plant molecular biology and crop genetics and breeding technology, specifically relating to a GmSPL3b gene SNP marker and its application. Background Technology

[0002] Soybean is an important dual-purpose crop for grain and oil in my country. Its flowering and maturity periods are key agronomical traits that determine its ecological adaptability and yield potential, directly influencing planting patterns and production performance in different latitude regions. High-latitude regions have short photoperiods and limited growing seasons, requiring early-flowering and early-maturing varieties to ensure normal growth. In contrast, in mid- and low-latitude regions, late flowering and late maturation are beneficial for biomass accumulation and yield improvement. Therefore, precise regulation of the growth period and the selection of soybean varieties adapted to different ecological zones are important directions for current breeding work.

[0003] In molecular breeding practice, the use of functional molecular markers that co-segregate with target traits allows for efficient and accurate genotypic selection of breeding materials at an early stage, thereby shortening the breeding cycle and reducing environmental interference with phenotypic identification. The realization of this technical approach highly depends on the precise analysis of key genes regulating traits and their functional nucleotide variations.

[0004] In breeding practice, even a difference of just a few days in the growth period can have a decisive impact on the ecological adaptability of a variety. If the maturity period differs by more than 7 days, it often means that the variety is no longer suitable for planting in its original temperature zone, making it difficult to guarantee stable yield performance. Currently, although some major genes involved in growth period regulation have been identified, such as the major growth period gene E1, which plays a key role in regulating soybean growth period, the gene resources capable of finely regulating soybean growth period are still relatively limited. Especially with major growth period genes being relatively fixed, the fine regulation of growth period by minor genes is particularly important in production. Summary of the Invention

[0005] The purpose of this invention is to provide a molecular detection technique for identifying the flowering and maturity stages of soybean based on SNP markers of the GmSPL3b gene and their applications. This technique is based on findings from previous research. Previous research revealed that the E1 gene regulates the expression of GmSPL3b, and the E1 gene is a major gene regulating soybean growth period. GmSPL3b belongs to the SPL gene family and possesses a highly conserved DNA-binding SBP domain. In scenarios where the genetic background of E1, the major gene regulating growth period, is fixed, clarifying the haplotype differences of the downstream GmSPL3b gene is of irreplaceable value for achieving precise regulation of growth period and meeting the breeding needs of different ecological zones. However, whether there are key SNP sites in the GmSPL3b gene that can be applied in production and precisely regulate growth period remains unclear, hindering in-depth analysis of the mechanism of precise regulation of growth period and its application in breeding. Therefore, developing molecular markers based on key functional SNPs of GmSPL3b is of great significance for achieving precise breeding of soybeans at flowering and maturity stages and improving the ecological adaptability of varieties. It is also a technical problem that urgently needs to be solved in this field.

[0006] This invention relates to an application of SNP markers based on the GmSPL3b gene, wherein the SNP markers are used to identify soybean varieties at the flowering and maturity stages; the SNP is a nucleotide sequence as shown in SEQ ID NO.1 and / or SEQ ID NO.2 formed by a single nucleotide mutation at position 94 and / or position 116 in the first exon of the soybean GmSPL3b gene; the polymorphism of the single nucleotide mutation is manifested as A / G polymorphism at position 94 and A / G polymorphism at position 116.

[0007] Furthermore, the A / G polymorphism at position 94 and / or position 116 affects the flowering and maturity period of soybeans. The A / G polymorphism is a mutation where A>G at positions 94 and 116. Individuals carrying the GG genotype have earlier flowering and maturity periods than individuals carrying the AA genotype.

[0008] Furthermore, the SNP sites include:

[0009] (a) The A / G polymorphism corresponding to position 94 of the sequence shown in SEQ ID NO.1 or SEQ ID NO.2 results in the mutation of amino acid arginine R to glycine G at position 32 of the GmSPL3b protein, i.e., R32G amino acid substitution; (b) The A / G polymorphism corresponding to position 116 of the sequence shown in SEQ ID NO.1 or SEQ ID NO.2 results in the mutation of amino acid 39 of the GmSPL3b protein from lysine K to arginine R, i.e., K39R amino acid substitution.

[0010] 4. The application according to claim 1 or 3, characterized in that the detection system used for identifying soybean varieties by their flowering and maturity periods includes any of the following forms: (i) Primer pairs that specifically amplify the SNP sites; (ii) Gene chips or microarrays designed for SNP sites; (iii) Reagents for high-throughput sequencing to detect the SNP sites; (iv) Reagents for mass spectrometry detection of the SNP sites; or (v) Any combination of the above.

[0011] Furthermore, the primer pair for specifically amplifying the SNP site is:

[0012] GmSPL-Hap-S:ACCTATGGACGAAAGTTGGAGT

[0013] GmSPL-Hap-AS: AGGGTTGATTGGAAAGGGCAA;

[0014] Furthermore, the identification of soybean varieties based on their flowering and maturity periods is carried out according to the following steps:

[0015] (1) Extract genomic DNA from the soybean sample to be tested; (2) The genomic DNA of the soybean sample to be tested was detected by a detection system to determine the nucleotide type of the soybean sample to be tested corresponding to the 94th and / or 116th positions of the sequence shown in SEQ ID NO.1 or SEQ ID NO.2 in the GmSPL3b gene;

[0016] (3) Sequencing analysis of the PCR products. In application scenarios where the soybean to be tested has a non-functional or weakly functional e1 allele background, if the soybean to be tested is found to have an A / A genotype at positions 94 and 116 of the first exon of the GmSPL3b gene, then it is determined to be GmSPL3b. -Hap1 Haplotype, the GmSPL3b -Hap1 The haplotype exhibits late flowering and late maturity characteristics; if the tested soybean is found to have a G / G genotype at positions 94 and 116 of the first exon of the GmSPL3b gene, it is identified as GmSPL3b. -Hap2 Haplotype, the GmSPL3b -Hap2 The haplotype exhibits early flowering and early maturity characteristics.

[0017] Furthermore, the identification of soybean varieties with flowering and maturity periods refers to the identification of early-maturing soybean varieties grown in high-latitude regions (north of 44°N), or the early prediction of soybean flowering and maturity periods under non-functional e1 background, as well as the use of SNP markers to assist in the breeding of early-maturing soybean varieties.

[0018] The primer set based on the SNP marker of the GmSPL3b gene of the present invention was identified. The primer set is GmSPL-Hap-S: ACCTATGGACGAAAGTTGGAGT; GmSPL-Hap-AS: AGGGTTGATTGGAAAGGGCAA.

[0019] A kit containing the primer set based on the GmSPL3b gene SNP markers described in this invention.

[0020] Furthermore, the kit includes one or more of the following: primer pairs for specifically amplifying the SNP site, gene chips or microarrays for specifically recognizing the SNP site, reagents for high-throughput sequencing to detect the SNP site, and reagents for mass spectrometry to detect the SNP site.

[0021] This invention is based on key functional SNP sites of the GmSPL3b gene, which can accurately distinguish different functional haplotypes of the gene and achieve precise identification of soybean growth period under different E1 gene background information, providing a practical tool for soybean molecular marker-assisted breeding and gene editing target design.

[0022] This invention provides a detection technique for identifying the flowering and maturity stages of soybean based on SNP markers in the GmSPL3b gene. This technique is based on the specific detection of single nucleotide polymorphisms (SNPs) in the soybean GmSPL3b gene. The SNP sites are located in the first exon of the soybean GmSPL3b gene, specifically at positions 94 and / or 116 of the nucleotide sequence shown in SEQ ID NO. 1 or SEQ ID NO. 2. Specifically, the A / G polymorphism at position 94 results in a mutation of arginine (R) to glycine (G) at position 32 of the GmSPL3b protein, i.e., R32G amino acid substitution; the A / G polymorphism at position 116 results in a mutation of lysine (K) to arginine (R) at position 39 of the GmSPL3b protein, i.e., K39R amino acid substitution.

[0023] SEQ ID NO.1: GmSPL3b -Hap1

[0024] ATGGACGAAAGTTGGAGTGAGGGAAAAAGGAGCATGAGTTACAAGGAGGAGGATGAGTACGAAGAAGAGGAAGAGGAGGAGGTGAGTGAGTATAGAGATGATGGTAGGAAAAAGAAGGTGGTGAGTAGTAAGAGAGGGTCCAAAGCTGGAGGCTCAGTGCCACCTTCATGTCAAGTTGATGGTTGTAGCGCTGATCTAAGTGAAGCTAAGCCCTACCATAGGCGTCACAAGGTTTGTGAGTACCATGCCAAGGCTCCTGCCGTACTCATTGGAGACCAGCACCAACGGTTTTGCCAACAATGTAGTAGGTTTCATGAGCTATCAGAATTCGATGACTCAAAAAGGAGTTGCAGAAGACGTTTGGCTGGACATAATGAGAGGCGTCGCAAAAATGCATCTGAATACCACGAACTTTGA

[0025] SEQ ID NO.2: GmSPL3b -Hap2

[0026] ATGGACGAAAGTTGGAGTGAGGGAAAAAGGAGCATGAGTTACAAGGAGGAGGATGAGTACGAAGAAGAGGAAGAGGAGGAGGTGAGTGAGTATGGAGATGATGGTAGGAAAAAGAGGGTGGTGAGTAGTAAGAGAGGGTCCAAAGCTGGAGGCTCAGTGCCACCTTCATGTCAAGTTGATGGTTGTAGCGCTGATCTAAGTGAAGCTAAGCCCTACCATAGGCGTCACAAGGTTTGTGAGTACCATGCCAAGGCTCCTGCCGTACTCATTGGAGACCAGCACCAACGGTTTTGCCAACAATGTAGTAGGTTTCATGAGCTATCAGAATTCGATGACTCAAAAAGGAGTTGCAGAAGACGTTTGGCTGGACATAATGAGAGGCGTCGCAAAAATGCATCTGAATACCACGAACTTTGA

[0027] The amino acid variations caused by the SNP sites in the GmSPL3b gene did not occur in the conserved SBP domain and the nuclear localization signal (NLS).

[0028] The combined polymorphism of the two SNP loci affects the flowering and maturity stages of soybean, and this effect has specific application scenarios for the E1 genotype: In scenarios with a functional E1 gene background, the polymorphism of the two SNP loci has no significant effect on the flowering and maturity stages of soybean; in scenarios with a non-functional E1 gene background (including recessive alleles such as e1-as and e1-b3a), the polymorphism of the GmSPL3b genotype... -Hap1 Soybeans with haplotypes (both SNP sites are A) are more likely to carry GmSPL3b- Hap2 The flowering and pod-setting of soybeans with haplotypes (both SNP sites are G) are significantly delayed.

[0029] Based on the SNP sites identified in this invention, the SNP sites can be detected using any of the following methods: primer pairs that specifically amplify the SNP sites; gene chips or microarrays containing the SNP sites; reagents for high-throughput sequencing to detect the SNP sites; reagents for mass spectrometry to detect the SNP sites; or combinations of the above methods.

[0030] This invention provides a technique for identifying the flowering and maturity periods of soybeans. Based on the E1 genotype information of the soybean to be tested, and under specific application scenarios, the flowering and maturity traits of the soybean to be tested are identified according to the detection results. The identification criteria are as follows: when the soybean to be tested has a non-functional or weakly functional e1 allele background, if the soybean to be tested is detected to have an A / A genotype at positions 94 and 116, it is determined to be GmSPL3b. -Hap1 Haplotype, the GmSPL3b -Hap1 The haplotype exhibits late flowering and late maturity characteristics; if the tested soybean is detected to have the G / G genotype at both positions 94 and 116, it is determined to be GmSPL3b. -Hap2 Haplotype, the GmSPL3b -Hap2 The haplotype exhibits early flowering and early maturity characteristics; when the soybean to be tested has a functional E1 gene background, the SNP site polymorphism of the GmSPL3b gene is not significantly correlated with flowering and maturity traits.

[0031] Primer pairs or kits containing the SNP molecular markers described in this invention can be used for rapid detection of haplotypes of the soybean GmSPL3b gene, providing a convenient tool for early screening during the flowering and maturity stages of soybeans. They can be used in conjunction with conventional molecular biology techniques such as PCR amplification, sequencing, and gene chips.

[0032] The present invention has the following beneficial effects:

[0033] 1. Provide precise breeding markers: Based on the key SNP in the GmSPL3b gene that determines the flowering trait, molecular markers that can accurately distinguish between early-flowering and late-flowering haplotypes have been developed to achieve precise genotyping during the seedling stage.

[0034] 2. Clearly define the genetic context of the application: Using this marker in specific E1 genotype application scenarios, especially in applications with an E1 background, significantly improves the specificity and reliability of selection.

[0035] 3. Promote the breeding of high-latitude varieties: By screening soybean varieties carrying GmSPL3b-Hap2, early-maturing soybean varieties adapted to high-latitude regions can be bred efficiently, solving the problem of growth period adaptation in this region.

[0036] 4. Provide gene editing targets: The SNPs used are functional sites that can be directly used as precise targets for gene editing, providing a clear basis for molecular design breeding.

[0037] 5. Significantly improves breeding efficiency: Ideal genotypes can be quickly screened in early generations, reducing field work, shortening the breeding cycle, and accelerating the selection of new varieties. Attached Figure Description

[0038] Figure 1Sequence variation, phenotypic effects, and geographic distribution of GmSPL3b gene variant haplotypes; A. Haplotype variation in the coding region (CDS) sequence of the GmSPL3b gene; Schematic diagram showing the distribution of DNA variant sites identified in the GmSPL3b gene CDS sequence; The number of germplasm materials carrying the corresponding haplotype and their subspecies classification are labeled next to the panel. S represents wild soybean; L represents local varieties; C represents improved varieties; Figures B and C. Genetic diversity reduction (ROD) and population differentiation index (Fst value) in the 400 kb genome region surrounding GmSPL3b in wild soybean, local varieties, and improved varieties; The red dashed line indicates the physical location of GmSPL3b; D. Haplotype frequency distribution. Pie charts show the proportions of each haplotype in wild soybean (n=95), local varieties (n=1019), and bred varieties (n=1684); the initial flowering time (E) and pod maturity time (F) associated with the GmSPL3b haplotype under the E and F e1 allele backgrounds; the effects of haplotypes on flowering time and pod maturity were assessed by population genetic association analysis under the E1 and e1 allele backgrounds, and pairwise comparisons were performed using the Wilcoxon test; multiple comparisons were corrected using the FDR method; different letters indicate significant differences between groups (p < 0.05); the Y-axis values ​​represent the best linear unbiased prediction (BLUP) values ​​for multi-year, multi-location flowering phenotypes; the distribution of the four allele combinations of G. GmSPL3b and E1 in six different ecological regions of China; pie charts show the four alleles of GmSPL3b. -Hap1 (E1), GmSPL3b -Hap2 (E1), GmSPL3b -Hap1 (e1) and GmSPL3b -Hap2 (e1) Proportion in six soybean producing regions (regions I to VI) in China; circle size corresponds to sample size, and each sector reflects haplotype composition;

[0039] Figure 2 A diagram showing the amino acid differences between the two haplotypes of GmSPL3b and their positional relationship with key structural domains; The diagram shows GmSPL3b... -Hap1 With GmSPL3b -Hap2 The protein sequences were aligned, with the SBP domain marked with a box; NLS sites marked with blue parallel lines; amino acid substitution sites between haplotypes marked with red; and both differential sites were located outside the SBP domain and NLS sites.

[0040] Figure 3The diagram shows the effect of proteins encoded by two haplotypes of the GmSPL3b gene on the promoter activity of the downstream gene GmMDE06. A. Schematic diagram of the vector structure used for co-infiltration transient expression experiments in *Nicotiana benthamiana* leaves; B. Typical images of firefly luciferase fluorescence signals after introducing the specified reporter and effector vectors into *Nicotiana benthamiana* leaves; C. Quantitative analysis of the relative reporter gene activity (LUC / REN) in *Nicotiana benthamiana* leaves expressing the specified reporter and effector vectors in Figure B. Different lowercase letters indicate statistically significant differences obtained based on one-way ANOVA combined with LSD multiple comparison test (P < 0.05). Detailed Implementation

[0041] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the spirit of the contents disclosed in the present invention will be described in detail below. After understanding the embodiments of the present invention, any person skilled in the art can make changes and modifications based on the technology taught in the present invention without departing from the spirit and scope of the present invention.

[0042] The illustrative embodiments and descriptions of the present invention are used to explain the present invention, but are not intended to limit the present invention.

[0043] Unless otherwise specified, the following examples are all conventional methods.

[0044] The effectiveness of the present invention was verified through the following experiments:

[0045] (I) Population analysis reveals that GmSPL3b is subject to artificial selection during domestication.

[0046] This embodiment performed haplotype analysis on 2,898 sequenced germplasm resources, including wild soybean (Glycine soja), local varieties, and improved varieties (National Center for Biotechnology Information https: / / ngdc.cncb.ac.cn / soyomics / genome_variation). Two missense single nucleotide polymorphisms (SNPs) were detected in the first exon of GmSPL3b, resulting in amino acid substitutions at R32G and K39R, respectively. Figure 1 A). The amino acid variation caused by this SNP site in the GmSPL3b gene did not occur in the conserved SBP domain or nuclear localization signal (NLS). Figure 2 Approximately 400 kb of genomic regions, including GmSPL3b, were selected for genetic diversity reduction (ROD) and F... st Value analysis showed that approximately 400 kb of genomic regions, including GmSPL3b, underwent a certain degree of selective clearance. Figure 1(B, C) indicates that GmSPL3b underwent artificial selection during domestication. -Hap1 and GmSPL3b -Hap2 Both haplotypes are present in wild soybean, local varieties, and improved varieties, but in different proportions. Figure 1 D). GmSPL3b -Hap1 It occurred more frequently in local varieties and improved varieties (77.7% in local varieties and 75.9% in improved varieties), while GmSPL3b- Hap2 The frequency of occurrence was relatively low in local and improved varieties (22.3% in local varieties and 24.1% in improved varieties). This result indicates that both haplotypes have been used in soybean breeding, with GmSPL3b being the most common. -Hap1 It has a wider range of applications.

[0047] (ii) Functional association analysis revealed a significant association between haplotypes of GmSPL3b and flowering time.

[0048] To assess the functional impact of natural variations in GmSPL3b on flowering and maturation, a population genetic association analysis was performed. Figure 1 E, F). To exclude the influence of E1 site variations, all resequencing germplasm was divided into two groups: those carrying functional E1 alleles and those carrying non-functional or weakly functional alleles (including recessive alleles e1-as and e1-b3a). Under the E1 background, regardless of the GmSPL3b haplotype, soybean varieties carrying both haplotypes showed no difference in initial flowering time and pod maturity; conversely, under the e1 background, varieties carrying GmSPL3b... -Hap1 Germplasm and GmSPL3b carrier -Hap2 Compared to other germplasms, it exhibits a significantly delayed initial flowering date and a later pod maturity date. Therefore, the initial flowering date and pod maturity date are associated with the GmSPL3b haplotype in the e1 background, but in a genetic background with a functional E1 gene, the GmSPL3b haplotype is not related to the initial flowering date and pod maturity.

[0049] (iii) GmSPL3b -Hap2 Haplotypes are widely used in high-latitude regions.

[0050] This invention analyzes the geographical distribution of GmSPL3b and E1 allele combinations in different ecological regions of China. Figure 1G). Soybean germplasm suitable for cultivation in low-latitude regions (ecological zones III–VI) mainly carries the functional E1 allele. Since the variation of GmSPL3b has limited impact on flowering and maturity in the presence of the functional E1 allele, this invention focuses on the geographical distribution of GmSPL3b allelic variation under the e1 background. Soybean germplasm suitable for cultivation in high-latitude regions (ecological zones I and II) carries both E1 and e1 alleles, and the e1 / E1 ratio gradually increases from ecological zone II to ecological zone I. Furthermore, in the presence of the e1 allele, GmSPL3b… -Hap2 / GmSPL3b -Hap1 The ratio also gradually increases from ecozone II to ecozone I. Simultaneously carrying GmSPL3b -Hap2 The soybean germplasm of type e1 appears frequently in ecoregion I. This observation indicates that GmSPL3b... -Hap2 The (e1) allele combination was subject to natural selection, which helped wild soybeans adapt to higher latitude regions.

[0051] (iv) Molecular experiments confirmed the existence of functional differences between the two haplotypes.

[0052] To determine the differences in molecular function between the two GmSPL3b haplotypes, this invention performed dual-luciferase reporter gene assays in *Nicotiana benthamiana* leaves to assess the transcriptional activation activity of the corresponding proteins of the two haplotypes. This invention uses the promoter of the downstream gene GmMDE06 of GmSPL3b to drive the reporter gene LUC (proGmMDE06:LUC) as a reporter gene vector, and constructs two effector vectors, each driven by the CaMV 35S promoter to drive GmSPL3b. -Hap1 or GmSPL3b -Hap2 GmSPL3b -Hap1 and GmSPL3b -Hap2 Both can enhance the activity of the GmMDE06 promoter. Figure 3 (A–C). It is worth noting that GmSPL3b -Hap2 It showed significantly higher performance than GmSPL3b -Hap1 activity ( Figure 3 (A–C). These results suggest that G32R and R39K substitutions may reduce the transcriptional activity of GmSPL3b, thereby decreasing the expression levels of its downstream genes in soybean and leading to late flowering.

Claims

1. An application based on GmSPL3b gene SNP markers, characterized in that, The SNP markers are used to identify soybean varieties at the flowering and maturity stages; the SNPs are nucleotide sequences, as shown in SEQ ID NO.1 and / or SEQ ID NO.2, formed by single nucleotide mutations at positions 94 and 116 in the first exon of the soybean GmSPL3b gene; the polymorphism of the single nucleotide mutations is manifested as A / G polymorphism at position 94 and A / G polymorphism at position 116.

2. The method for using a GmSPL3b gene SNP marker according to claim 1, characterized in that, The A / G polymorphism at positions 94 and 116 affects the flowering and maturity of soybeans. The A / G polymorphism refers to the mutation where A>G at positions 94 and 116. Individuals carrying the GG genotype have earlier flowering and maturity periods than individuals carrying the AA genotype.

3. An application based on GmSPL3b gene SNP markers according to claim 1 or 2, characterized in that, The SNP sites include: (a) The A / G polymorphism corresponding to position 94 of the sequence shown in SEQ ID NO.1 or SEQ ID NO.2 results in the mutation of amino acid arginine R to glycine G at position 32 of the GmSPL3b protein, i.e., R32G amino acid substitution; (b) The A / G polymorphism corresponding to position 116 of the sequence shown in SEQ ID NO.1 or SEQ ID NO.2 results in the mutation of amino acid 39 of the GmSPL3b protein from lysine K to arginine R, i.e., K39R amino acid substitution.

4. The application according to claim 1 or 3, characterized in that, The detection system used to identify the flowering and maturity periods of soybean varieties includes any of the following forms: (i) Primer pairs that specifically amplify the SNP sites; (ii) Gene chips or microarrays designed for SNP sites; (iii) Reagents for high-throughput sequencing to detect the SNP sites; (iv) Reagents for mass spectrometry detection of the SNP sites; or (v) Any combination of the above.

5. The application according to claim 4, characterized in that, The primer pair specifically amplifying the SNP site is as follows: GmSPL-Hap-S:ACCTATGGACGAAAGTTGGAGT GmSPL-Hap-AS: AGGGTTGATTGGAAAGGGCAA.

6. The application according to claim 4, characterized in that, The identification of soybean varieties based on their flowering and maturity periods is carried out according to the following steps: (1) Extract genomic DNA from the soybean sample to be tested; (2) The genomic DNA of the soybean sample to be tested was detected using a detection system to determine the nucleotide types at positions 94 and 116 of the sequence shown in SEQ ID NO.1 or SEQ ID NO.2 in the GmSPL3b gene of the soybean sample to be tested; (3) Sequencing analysis of the PCR products. In application scenarios where the soybean to be tested has a non-functional or weakly functional e1 allele background, if the soybean to be tested is found to have an A / A genotype at positions 94 and 116 of the first exon of the GmSPL3b gene, then it is determined to be GmSPL3b. -Hap1 Haplotype, the GmSPL3b -Hap1 The haplotype exhibits late flowering and late maturity characteristics; if the tested soybean is found to have a G / G genotype at positions 94 and 116 of the first exon of the GmSPL3b gene, it is identified as GmSPL3b. -Hap2 Haplotype, the GmSPL3b -Hap2 The haplotype exhibits early flowering and early maturity characteristics.

7. The application according to claim 1, characterized in that, The identification of soybean varieties with flowering and maturity periods refers to the identification of early-maturing soybean varieties grown in high-latitude regions, or the early prediction of soybean flowering and maturity periods under non-functional e1 background, as well as the use of SNP markers to assist in the breeding of early-maturing soybean varieties.

8. The primer set based on the GmSPL3b gene SNP marker as described in claim 1, characterized in that, The primer sets are GmSPL-Hap-S: ACCTATGGACGAAAGTTGGAGT; GmSPL-Hap-AS: AGGGTTGATTGGAAAGGGCAA.

9. A kit comprising the primer set based on the GmSPL3b gene SNP marker as described in claim 8.

10. The kit for primer sets based on GmSPL3b gene SNP markers according to claim 9, characterized in that, The kit includes one or more of the following: primer pairs for specifically amplifying the SNP site, a gene chip or microarray containing the SNP site, reagents for high-throughput sequencing to detect the SNP site, and reagents for mass spectrometry to detect the SNP site.

Images