Molecular markers related to the number of ears per unit area of ​​wheat and their applications

By detecting SNP sites on wheat chromosome 4A and using KASP marker technology, the problem of low heritability of wheat spike number per unit area was solved, realizing an efficient breeding method that improved wheat spike number per unit area and yield.

CN118879917BActive Publication Date: 2026-06-30INSTITUTE OF CROP SCIENCE CHINESE ACADEMY OF AGRICULTURAL SCIENCES +1

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
INSTITUTE OF CROP SCIENCE CHINESE ACADEMY OF AGRICULTURAL SCIENCES
Filing Date
2024-08-26
Publication Date
2026-06-30

AI Technical Summary

Technical Problem

In existing technologies, the heritability of the number of ears per unit area in wheat is low and affected by planting density, resulting in a limited number of genes that can be effectively used in breeding, making it difficult to effectively increase the number of ears per unit area to improve yield.

Method used

By detecting SNP sites (nucleotides G or T) on wheat chromosome 4A, KASP marker technology is used to identify or assist in identifying the number of wheat ears per acre, and breeding selection is carried out, selecting TT homozygous wheat as parents for breeding.

Benefits of technology

This technology enables rapid and accurate identification and breeding of wheat spikes per mu (unit of land area), increasing the number of spikes per unit area and enhancing the potential for wheat yield.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_2
    Figure SMS_2
  • Figure SMS_3
    Figure SMS_3
Patent Text Reader

Abstract

This invention discloses molecular markers related to the number of ears per unit area in wheat and their applications. This invention belongs to the field of biotechnology, specifically relating to molecular markers related to the number of ears per unit area in wheat and their applications. The method for identifying or assisting in the identification of the number of ears per acre in wheat includes detecting the genotype of a SNP locus in the genome of the wheat to be tested, and identifying or assisting in the identification of the number of ears per acre based on the genotype. The SNP locus is a single SNP locus on wheat chromosome 4A, with nucleotide type G or T, and is the 51st nucleotide of sequence 4 in the sequence listing. The number of ears per acre in the tested wheat with the SNP genotype TT is higher or a candidate higher than that in the tested wheat with the SNP genotype GG. The identification method and its primer composition of this invention can be used in wheat breeding and have broad application prospects.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to molecular markers related to the number of ears per unit area of ​​wheat and their applications. Background Technology

[0002] Wheat is one of my country's important food crops, and increasing wheat yield per unit area is a perpetual pursuit for breeders. Since the 1980s, wheat varieties bred in my country have mainly shown an increase in harvest index, along with a significant increase in the number of grains per spike and thousand-grain weight. However, the number of spikes per unit area has tended to stabilize (with a slight decrease in the Guanzhong Plain of Shaanxi Province), and it shows a strong positive correlation with the harvest index. Studies have shown that there are restrictive relationships among the three factors of yield. At present, increasing the number of grains per spike to improve yield carries a high risk. The coefficient of variation for thousand-grain weight is relatively small, making improvement more difficult. The genetic diversity of the number of spikes per unit area is relatively rich. Increasing the number of spikes is relatively easier to achieve while enhancing lodging resistance, and it has a greater impact on yield improvement. The number of spikes per unit area is a quantitative trait, which is greatly influenced by the environment. Compared with the number of grains per spike and thousand-grain weight, its heritability is moderate, between 0.6 and 0.8.

[0003] Currently, QTL reports on the number of ears per unit area in wheat span multiple chromosomes, distributed on wheat chromosomes 1A, 1D, 2B, 3B, 4A, 5A, 5D, 6A, 6D, and 7D. Cui et al. used two RIL populations to study wheat ear traits, locating a total of 14 QTLs related to the number of ears per unit area, located on chromosomes 1A, 2B, 3B, 4A, 5A, 5D, 6A, 6D, and 7D, and concluded that ear length is the main factor affecting the number of ears per unit area. Deng et al. used 166 F2 populations constructed from 05210 and Laizhou953 to perform genetic analysis on wheat ear traits. After two years of two-point experiments, they located a QTL (QSn.sdau-4B) related to the number of ears per unit area near 4BL, which simultaneously affects the number and size of ears. Zhai used the RIL population constructed by Yunmai8679 and Jing411 to perform genetic analysis using a 90K SNP high-density genetic map, identifying five stable QTL loci associated with the number of ears per unit area. Cao et al. summarized previous research progress, finding a total of 40 QTLs related to the number of ears per unit area distributed across the remaining 17 chromosomes (excluding wheat chromosomes 3D, 4D, 6B, and 6D), with uneven distribution across different chromosomes, mainly on chromosomes 3A, 5A, 7A, and 7D. Although a large number of wheat ear number QTL loci have been located, only a few genes have been cloned. Due to their low heritability and dependence on planting density, the number of genes truly applicable to wheat breeding is very limited. Therefore, discovering new ear number per acre genes (QTLs) and developing tightly linked markers will provide support for breeding varieties with high ear number per acre.

[0004] KASP markers have been widely used to detect SNP loci in crops such as wheat, rice, and maize, enabling high-throughput genotyping without the need for electrophoresis. Using wheat SNP microarray genotyping data for QTL mapping and genome-wide association analysis, linked SNPs can be converted into KASP markers, which can then be directly applied to marker-assisted selection breeding. Summary of the Invention

[0005] The problem this invention aims to solve is how to identify or assist in identifying the number of wheat ears per acre and to carry out wheat breeding.

[0006] To address the above technical problems, this invention first provides a method for identifying or assisting in the identification of wheat spike count per acre, comprising detecting the genotype of a SNP locus in the genome of the wheat to be tested, and identifying or assisting in the identification of wheat spike count per acre based on the genotype. The SNP locus is a site on wheat chromosome 4A, and its nucleotide type is G or T, specifically the 51st nucleotide of sequence 4 in the sequence listing. The genotype is GG or TT, where GG is homozygous for the G SNP locus, and TT is homozygous for the T SNP locus.

[0007] The genome sequence of the common wheat variety Chinese Spring (IWGSC_RefSeq_v1.0) (https: / / urgi.versailles.inra.fr / jbrowseiwgsc / gmod_jbrowse / ?data=myData / IWGSC_RefSeq_v1.0) was used as the reference genome. The SNP site was located at 545107221 bp on wheat chromosome 4A (specifically, position 51 of sequence 4 in the sequence listing).

[0008] As one implementation method, the method for identifying or assisting in the identification of wheat ears per acre may include the following steps:

[0009] (1) Using the genomic DNA of the wheat to be tested as a template, KASP molecular marker detection was performed using a primer composition; the primer composition consisted of primer A, primer B and primer C;

[0010] Primer A is a single-stranded DNA molecule whose nucleotide sequence is sequence 1 in the sequence listing or whose nucleotide sequence is the single-stranded DNA at positions 22-46 of sequence 1 in the sequence listing;

[0011] Primer B is a single-stranded DNA molecule whose nucleotide sequence is sequence 2 in the sequence listing or whose nucleotide sequence is the single-stranded DNA at positions 22-46 of sequence 2 in the sequence listing;

[0012] Primer C is a single-stranded DNA molecule whose nucleotide sequence is sequence 3 in the sequence listing;

[0013] (2) After completing step (1), perform fluorescence detection to determine the genotype of the SNP in the wheat to be tested;

[0014] (3) Identify the number of ears per mu of wheat to be tested based on the genotype results: The number of ears per mu of wheat to be tested with the genotype TT of the SNP is higher than the number of ears per mu of wheat to be tested with the genotype GG of the SNP.

[0015] This invention also provides a method for wheat breeding.

[0016] The wheat breeding method provided by the present invention includes detecting the genotype of the SNP locus in the wheat genome, selecting wheat with the SNP genotype TT as the parent for breeding, wherein the TT genotype is the homozygous type of the SNP locus T.

[0017] As an implementation method, wheat breeding methods may include the following steps:

[0018] (1) Using the genomic DNA of the wheat to be tested as a template, the above primer set was used to perform KASP reaction detection;

[0019] (2) After completing step (1), perform fluorescence detection to determine the genotype of the SNP site in the wheat to be tested;

[0020] (3) Select TT genotype wheat as a wheat breed with high ear count per mu.

[0021] The KASP reaction PCR amplification system is as follows (total volume 5.0 μl): 2.0 μl 50 ng / μl template DNA, 1.5 μl 2×KASP reaction mix, 0.0336 μl primer mix (Assay mix), and 1.4664 μl ddH2O.

[0022] 2×KASP reaction mix reagent: The AQP genotyping universal kit (18241211 / 2218) manufactured by Beijing Jiacheng Biotechnology Co., Ltd. was used. The product contains fluorescent probe A, fluorescent probe B, quencher probe A, quencher probe B, HiGeno DNA Polymerase, PCR buffer, and dNTPs. For detailed principles and product information, please see: http: / / www.jasongen.com / newsdetail.aspx?channel_id=1017&id=1.

[0023] The primer set was prepared as follows: 12.0 μM primer F1, 12.0 μM primer F2, 30.0 μM primer R, with the remainder being water; and the concentrations of primer F1 and primer F2 in the PCR amplification system were both 0.1344 μM, and the final concentration of primer R in the PCR amplification system was 0.336 μM.

[0024] The above PCR amplification reactions were performed on a PTC-200 PCR instrument using a Touch-down PCR amplification program as follows: 94℃ pre-denaturation for 15 min; (Touch-down program) 94℃ denaturation for 30 s, 61℃ annealing for 60 s, 72℃ extension for 30 s, 11 cycles, with the annealing temperature decreasing by 0.6℃ per cycle; (Amplification program) 94℃ denaturation for 30 s, 55℃ annealing for 60 s, 72℃ extension for 30 s, 26 cycles; 72℃ extension for 5 min; stored at 10℃.

[0025] The above method for determining the genotype of the SNP in the wheat sample can be as follows: After the PCR reaction, a fluorescence signal reader (Omega) and a fluorescence detection system (Araya) are used to convert the fluorescence signal into analyzable values ​​to read the fluorescence data of the reaction products. Genotyping is performed by reading the fluorescence values ​​at the terminal ends. The fluorescence scanning results are graphically displayed using the R software package. T-type bases exhibit FAM fluorescence and are distributed near the x-axis; G-type bases exhibit HEX fluorescence and are distributed near the y-axis; samples with no detected signal are distributed near the origin.

[0026] The application of the above methods in wheat breeding also falls within the scope of protection of this invention.

[0027] This invention also provides the application of a substance for detecting KASP polymorphisms or genotypes in the wheat genome in any of the following:

[0028] (1) To identify or assist in identifying the number of wheat ears per mu;

[0029] (2) Wheat breeding;

[0030] (3) Prepare products for identifying or assisting in the identification of the number of wheat ears per mu;

[0031] (4) Prepare products for wheat breeding;

[0032] The SNP site is a site on wheat chromosome 4A, and its nucleotide type is G or T, which is the 51st nucleotide of sequence 4 in the sequence listing.

[0033] This invention also provides products for detecting polymorphisms or genotypes of SNP sites in the wheat genome.

[0034] The product provided by this invention for detecting polymorphisms or genotypes of SNP sites in the wheat genome contains the aforementioned substances for detecting polymorphisms or genotypes of SNP sites in the wheat genome, and the product may be any one of the following:

[0035] C1) Products that detect single nucleotide polymorphisms or genotypes related to the number of ears per acre in wheat;

[0036] C2) Products used to identify or assist in identifying the number of wheat ears per mu (unit of land area);

[0037] C3) Products used in wheat breeding.

[0038] In the above applications, methods, and products, the substance may be a reagent and / or instrument required to determine the polymorphism or genotype of the SNP site by at least one of the following methods: DNA sequencing, restriction fragment length polymorphism, single-strand conformation polymorphism, denaturing high-performance liquid chromatography, and SNP chips. The SNP chips include chips based on nucleic acid hybridization reactions, chips based on single-base extension reactions, chips based on allele-specific primer extension reactions, chips based on one-step reactions, chips based on primer ligation reactions, chips based on restriction endonuclease reactions, chips based on protein-DNA binding reactions, and chips based on fluorescent molecule-DNA binding reactions.

[0039] Optionally, the substance may be D1), D2), or D3):

[0040] D1) The substance described is a primer composition for amplifying wheat genomic DNA fragments including the SNP sites;

[0041] D2) The substance described is a PCR reagent containing the primer composition described in D1);

[0042] D3) The substance is a kit containing the primer composition described in D1) or the PCR reagent described in D2).

[0043] Optionally, the amplification may be PCR amplification. The primer composition consists of primer A, primer B, and primer C.

[0044] The kit described in D3 may also include KASP Master Mix.

[0045] In the above applications, methods, and products, the primer composition may or may not be labeled with a marker. The marker refers to any atom or molecule that can be used to provide a detectable effect and can be linked to a nucleic acid. Markers include, but are not limited to, dyes; radioactive markers, such as 32P; binding moieties, such as biotin; haptens, such as digoxigenin (DIG); luminescent, phosphorescent, or fluorescent moieties; and fluorescent dyes alone or in combination with moieties whose emission spectra can be inhibited or shifted by fluorescence resonance energy transfer (FRET). The marker can provide a signal detectable by fluorescence, radioactivity, colorimetry, gravimetric determination, X-ray diffraction or absorption, magnetism, enzyme activity, etc. The marker can be a charged moiety (positive or negative charge) or, optionally, charge-neutral. The marker can include nucleic acid or protein sequences or combinations thereof, provided that the sequence containing the marker is detectable. In some embodiments, nucleic acids are detected directly without labeling (e.g., direct sequence reading). The primer composition described herein may be a primer composition consisting of single-stranded DNA with nucleotide sequences of positions 22-46 of Sequence 1 in the sequence listing, single-stranded DNA with nucleotide sequences of positions 22-46 of Sequence 2 in the sequence listing, and single-stranded DNA with nucleotide sequences of Sequence 3 in the sequence listing. Alternatively, the primer composition may be a primer set consisting of single-stranded DNA shown in Sequence 1, Sequence 2, and Sequence 3 in the sequence listing. Sequence 1 in the sequence listing consists of 46 nucleotides, with nucleotides 1-21 being the FAM adapter sequence (as a marker) and nucleotides 22-46 being the specific sequence; Sequence 2 in the sequence listing consists of 46 nucleotides, with nucleotides 1-21 being the HEX adapter sequence (as a marker) and nucleotides 22-46 being the specific sequence.

[0046] The present invention also provides a DNA molecule, the nucleotide sequence of which is shown in Sequence 4 of the sequence listing.

[0047] The applications of the aforementioned DNA molecules also fall within the scope of protection of this invention. Specifically, the applications may be any of the following:

[0048] 1) To identify or assist in identifying the number of wheat ears per mu (unit of land area);

[0049] 2) Wheat breeding;

[0050] 3) Prepare products for identifying or assisting in the identification of the number of wheat ears per acre;

[0051] 4) Prepare products for wheat breeding.

[0052] Optionally, in the above applications, the DNA molecule serves as a detection target.

[0053] The substance that detects the SNP site polymorphism and genotype can be combined with other substances (such as substances that detect single nucleotide polymorphisms or genotypes of other molecular markers related to wheat spike number per acre) to prepare a product for identifying wheat varieties with high spike number per acre.

[0054] In this article, the breeding objectives may include breeding wheat with a high number of ears per acre.

[0055] In this article, the wheat referred to can be a wheat inbred line or a hybrid offspring of two wheat inbred lines, such as a hybrid offspring of wheat Zhongmai 578 and Jimai 22. The wheat can also be a pure line.

[0056] This invention constructed a recombinant inbred line (RIL) population comprising 262 families using Zhongmai 578 and Jimai 22. Subsequently, a genetic map constructed using a 50K microarray was used to perform QTL analysis on the number of ears per acre in this RIL population using a deep learning algorithm. A stable QTL, located between markers AX-95138908 and AX-111157272 on chromosome 4A (500.35-585.55 Mb), was identified, explaining 4.04-11.00% of the phenotypic variation. This QTL, named QSN-caas.4A, was converted to a tightly linked KASP marker with the gene TraesCS4A03G236300 (545.11 Mb) within the same interval. Further, by extracting DNA from wheat leaves, rapid and accurate genotyping of the number of ears per acre trait in wheat of different genotypes can be achieved, enabling high-throughput marker-assisted breeding and significantly improving detection costs and efficiency. Attached Figure Description

[0057] Figure 1 Genotyping results of 166 wheat varieties using the KASP marker KASP-4A.36300. Blue indicates the TT genotype of Jimai 22, red indicates the GG genotype of Zhongmai 578, and pink indicates failed detection. Detailed Implementation

[0058] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0059] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0060] Unless otherwise specified, all quantitative experiments in the following examples are performed in triplicate.

[0061] The Zhongmai 578 and Jimai 22 mentioned in the following examples have been described in: Dan LIU, De-hui ZHAO, Jian-qi ZENG, Rabiu Sani SHAWAI, Jing-yang TONG, Ming LI, Fa-ji LI, Shuo ZHOU, Wen-li HU, Xian-chun XIA, Yu-bing TIAN, Qian ZHU, Chun-ping WANG, De-sen WANG, Zhong-hu HE, Jin-dong LIU, Yong ZHANG, Identification of genetic loci for grain yield-related traits in the wheat population Zhongmai 578 / Jimai22, Journal of Integrative Agriculture, Volume 22, Issue 7, 2023, Pages 1985-1999, ISSN 2095-3119, https: / / doi.org / 10.1016 / j.jia.2022.12.002. The biological material is available to the public from the applicant and is intended solely for the purpose of repeating experiments of this invention and may not be used for any other purpose.

[0062] The 166 wheat varieties in the following examples have been documented in: Dan LIU, De-hui ZHAO, Jian-qi ZENG, Rabiu Sani SHAWAI, Jing-yang TONG, Ming LI, Fa-ji LI, Shuo ZHOU, Wen-li HU, Xian-chun XIA, Yu-bing TIAN, Qian ZHU, Chun-ping WANG, De-sen WANG, Zhong-hu HE, Jin-dong LIU, Yong ZHANG, Identification of genetic loci for grain yield-related traits in the wheat population Zhongmai 578 / Jimai 22, Journal of Integrative Agriculture, Volume 22, Issue 7, 2023, Pages 1985-1999, ISSN 2095-3119, https: / / doi.org / 10.1016 / j.jia.2022.12.002. The biological material is available to the public from the applicant and is intended solely for the purpose of repeating experiments of this invention and may not be used for any other purpose.

[0063] The following examples used SPSS 11.5 statistical software to process the data. The experimental results are expressed as mean ± standard deviation. One-way ANOVA was used. P < 0.05 (*) indicates a significant difference, P < 0.01 (**) indicates a highly significant difference, and P < 0.001 (***) indicates a highly significant difference.

[0064] Example 1: Discovery of a high spike number gene QTL in wheat material Zhongmai 578 / Jimai 22 and acquisition of its KASP marker.

[0065] I. Obtaining the phenotype

[0066] A recombinant inbred line (RIL) population comprising 262 families was constructed using Zhongmai 578 and Jimai 22. The Zhongmai 578 / Jimai 22 RIL population was planted in Dezhou, Shandong; Xinxiang, Henan; and Shijiazhuang, Hebei in the 2022-2023 season. A completely randomized block design with three replicates was employed. All trials were conducted in plots of 3.0 m × 1.2 m, with 6 rows and a row spacing of 0.2 m, maintaining a planting density of 270 plants / m². 2Agronomic management was carried out according to local experimental conditions. 40cm×40cm rectangular frames were randomly placed in the non-border areas of each plot, and the number of ears within each frame was manually counted. At the same time, cameras (Sony α7II and DJIPocket 2) were used to take overhead photos of the rectangular frames from above the canopy to obtain RGB images of ears at 0.16m / 2 in each plot. A YOLOX model was established to obtain the number of ears per 0.16 square meters, which was then uniformly converted to 1 square meter.

[0067] Genomic DNA was extracted from the young leaves of 262 families in the RIL population using a modified CTAB method (Murray et al., 1980). DNA concentration was determined using a NanoDrop 2000c spectrophotometer, and the DNA samples were adjusted to a standard concentration of 50 ng / µl. DNA quality was then assessed using 0.8% agarose gel electrophoresis. SNP genotyping was performed on qualified DNA samples using an Illumina 50K SNP chip.

[0068] II. Linkage Graph Construction

[0069] After removing heterozygous markers and markers with a deletion rate greater than 10% among parents using 50K, redundant markers were removed using the IciMapping 4.1bin function. Then, linkage groups were constructed based on the genetic distance and chromosomal location information between markers.

[0070] III. QTL Analysis

[0071] QTL analysis was performed using the IciMapping 4.1 ICIM-ADD method, with a LOD value of 2.5. A stable QTL was located on chromosome 4A and named QSN-caas.4A. The flanking markers were located between AX-95138908 and AX-111157272 (500.35-585.55 Mb). Under different environmental conditions, it explained 4.04-11.00% of the phenotypic variation, including a SNP locus associated with the spike number per acre trait, which was named QSN-caas.4A. The SNP locus QSN-caas.4A is located at position 51 of sequence 4, and its nucleotide type is G or T. The nucleotide sequence of sequence 4 is located at physical positions 545107170bp-545107272 on chromosome 4A of wheat IWGSC Refseq v1.0. In the sequence listing, k in sequence 4 represents g or t. The gene TraesCS4A03G236300 (545.11Mb) within its region was converted into the tightly linked KASP marker KASP-4A.36300 for molecular marker-assisted selection breeding.

[0072] IV. Obtaining the identification primer set for the KASP-4A.36300 marker

[0073] A primer set for detecting SNP polymorphic sites (i.e., the KASP marker KASP-4A.36300) based on KASP technology was designed, referred to as the KASP primer set. The KASP primer set consists of two upstream primers (primer A and primer B) and one downstream primer (primer C), and the specific sequences are shown in Table 1.

[0074] Table 1. KASP primer sequence information for detecting the QTL QSN-caas.4A of high ear count per mu.

[0075]

[0076] Note: GAAGGTGACCAAGTTCATGCT For FAM tag sequence A, GAAGGTCGGAGTCAACGGATT The HEX tag sequence is B.

[0077] Primer A is a primer with a FAM fluorescent tag sequence (underlined bases) at the 5' end, and primer C amplifies the fragment of SNP site T. The fluorescent signal of the FAM group can be read using an ELISA reader or a real-time PCR instrument.

[0078] Primer B is a primer with a HEX fluorescent tag sequence (underlined bases) at the 5' end, and primer C amplifies the fragment of SNP site G. The fluorescent signal of the HEX group can be read using an ELISA reader or a real-time PCR instrument.

[0079] Sequence 4: 5'-CGAGGTCTTGCACGTACGAGTAAAATCTGTTTTTCTAAGCAAATACGTGTkCTCGTTCACTCCTACCGGCCTCC CAGATACTGAAAACTTGGTCAAGCCAA-3'.

[0080] The KASP marker KASP-4A.36300 was used to determine the different allelic types of QSN-caas.4A at the physical location 545.11 bp (SNP locus KASP-4A.36300) on chromosome 4A, which is related to the number of ears per mu (unit of area) of wheat. This SNP locus KASP-4A.36300 has a G / T base difference, and these two allelic types were named QSN-caas.4Aa and QSN-caas.4Ab, respectively. The allelic type carrying FAM fluorescence and distributed near the x-axis is QSN-caas.4Aa (abbreviated as TT genotype), and the nucleotide of the SNP locus is T; the allelic type carrying HEX fluorescence and distributed near the y-axis is QSN-caas.4Ab (abbreviated as GG genotype), and the nucleotide of the SNP locus is G.

[0081] 5. KASP amplification system and genotyping

[0082] Genomic DNA was extracted from each wheat variety. Using the genomic DNA as a template, PCR amplification was performed using the corresponding KASP-labeled primers to obtain PCR amplification products. Among them, the PCR amplification products carrying the fluorescent sequence FAM showed red fluorescence under illumination, while the PCR amplification products carrying the fluorescent sequence HEX showed blue fluorescence under illumination.

[0083] The PCR amplification system described above is as follows (total volume 5.0 μl): 2.0 μl 50 ng / μl template DNA, 1.5 μl 2×KASPreaction mix, 0.0336 μl primer mix (Assay mix), and 1.4664 μl ddH2O.

[0084] 2×KASP reaction mix reagent: The AQP genotyping universal kit (18241211 / 2218) manufactured by Beijing Jiacheng Biotechnology Co., Ltd. was used. The product contains fluorescent probe A, fluorescent probe B, quencher probe A, quencher probe B, HiGeno DNA Polymerase, PCR buffer, and dNTPs. For detailed principles and product information, please see: http: / / www.jasongen.com / newsdetail.aspx?channel_id=1017&id=1.

[0085] The above primer mix formula is as follows: 12.0 μM primer F1, 12.0 μM primer F2, 30.0 μM primer R, with the remainder being water; and the concentrations of primer F1 and primer F2 in the above PCR amplification system are both 0.1344 μM, and the final concentration of primer R in the PCR amplification system is 0.336 μM.

[0086] The above PCR amplification reactions were performed on a PTC-200 PCR instrument using a Touch-down PCR amplification program as follows: 94℃ pre-denaturation for 15 min; (Touch-down program) 94℃ denaturation for 30 s, 61℃ annealing for 60 s, 72℃ extension for 30 s, 11 cycles, with the annealing temperature decreasing by 0.6℃ per cycle; (Amplification program) 94℃ denaturation for 30 s, 55℃ annealing for 60 s, 72℃ extension for 30 s, 26 cycles; 72℃ extension for 5 min; stored at 10℃.

[0087] The PCR amplification products were processed in Pherastar. plus Genotyping was performed using a fluorescent microplate reader with fluorescence illumination, and then in KlusterCaller. TM The software reads the genotyped data and performs genotyping at the KASP-4A.36300 locus.

[0088] Example 2: Application of KASP marker KASP-4A.36300 and identification primers in identifying the number of ears per mu (unit of land area) of wheat. The experimental materials consisted of 166 wheat varieties, and the specific information is shown in Table 2.

[0089] 1. A study on the phenotype of wheat spike count per mu (unit of land area).

[0090] Sixty-six wheat varieties from the Huang-Huai wheat region were planted in Xinxiang and Zhoukou, Henan Province in 2018-2019, with irrigation and water-saving treatments implemented in both cities, resulting in four environmental phenotypic data points. In 2019-2020, they were planted in Xinxiang and Luohe, Henan Province, with irrigation and water-saving treatments implemented in both cities, again resulting in four environmental phenotypic data points. The experiment employed a completely randomized block design with three replicates. All trials were conducted in plots measuring 3.0 meters long and 1.2 meters wide, with six rows spaced 0.2 meters apart, maintaining a planting density of 270 plants / m². 2 Field management was carried out according to local practices. A spike count identification model was established using deep learning YOLOX.

[0091] 2. KASP amplification and genotyping of the SNP locus KASP-4A.36300 in wheat samples.

[0092] Genomic DNA was extracted from young leaves of 166 families using a modified CTAB method.

[0093] The genotypes of the SNP locus KASP-4A.36300 in 166 wheat varieties were identified using step 5 of Example 1, the KASP amplification system, and genotyping. The genotype analysis results are shown in Table 2.

[0094] Table 2. Genotyping results of 166 wheat varieties and spikelet number phenotypes at 0.25 square meters under 8 environmental conditions.

[0095]

[0096]

[0097]

[0098]

[0099]

[0100]

[0101] Note: NA represents deletion; ? represents unknown genotype.

[0102] The results are shown in Table 2 and Figure 1 . Figure 1In this context, TT indicates that the genotype of the SNP site QSN-caas.4A in wheat material is TT, GG indicates that the genotype of the SNP site QSN-caas.4A in wheat material is GG, and CK is a blank control in the reaction system without the addition of template DNA.

[0103] Of the 166 wheat varieties, 43 varieties had the TT genotype (fluorescent signal in blue, i.e., the nucleotide at the SNP site QSN-caas.4A is T), and 94 varieties had the GG genotype (fluorescent signal in red, i.e., the nucleotide at the SNP site QSN-caas.4A is G).

[0104] Table 3 shows that the number of ears per mu (10,000s / mu) of wheat germplasm carrying the QSN-caas.4Aa allele type TT in the eight environments was 50.67, 49.11, 34.00, 36.80, 50.14, 52.02, 35.35 and 40.47, respectively, which was higher than that of wheat germplasm carrying the QSN-caas.4Ab allele type GG, with the same number of ears per mu (10,000s / mu) being 44.25, 45.17, 32.36, 32.09, 45.98, 47.54, 33.78 and 36.13, respectively. The gene effect of QSN-caas.4A in six of the eight environments showed significant differences (P<0.05).

[0105] Table 3. Statistical analysis results of gene type and ear number per mu for SNP locus QSN-caas.4A

[0106]

[0107]

[0108] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. A method for identifying or assisting in the identification of the number of wheat ears per mu (unit of land area), characterized in that: This includes detecting the genotype of SNP sites in the genome of the wheat to be tested, and identifying or assisting in identifying the number of wheat ears per acre based on the genotype. The SNP site is an SNP site on the wheat chromosome 4A, and its nucleotide type is G or T, which is the 51st nucleotide of sequence 4 in the sequence listing.

2. A method for breeding wheat spike count per mu (unit of land area), characterized by: The method includes detecting the genotype of the SNP in claim 1 in the wheat genome, selecting wheat with the genotype TT of the SNP as a parent for breeding, wherein TT is a homozygous type of the SNP being T.

3. The application of the method according to claim 1 or 2 in wheat ear count breeding.

4. The application of substances used to detect SNP polymorphisms or genotypes in the wheat genome in any of the following: (1) To identify or assist in identifying the number of wheat ears per mu; (2) Breeding of wheat ear count per mu; (3) Prepare products for identifying or assisting in the identification of the number of wheat ears per mu; (4) Prepare products for wheat ear count breeding; The SNP site is a SNP site on wheat chromosome 4A, and its nucleotide type is G or T, which is the 51st nucleotide of sequence 4 in the sequence listing.

5. The application according to claim 4, characterized in that: The substance is either D1), D2), or D3). D1) The substance is a primer composition for amplifying wheat genomic DNA fragments including the SNP sites; D2) The substance is a PCR reagent containing the primer composition described in D1); D3) The substance is a kit containing the primer composition described in D1) or the PCR reagent described in D2).

6. The application according to claim 5, characterized in that: The primer composition consists of primer A, primer B and primer C; Primer A is a single-stranded DNA molecule whose nucleotide sequence is sequence 1 in the sequence listing or whose nucleotide sequence is the single-stranded DNA at positions 22-46 of sequence 1 in the sequence listing; Primer B is a single-stranded DNA molecule whose nucleotide sequence is sequence 2 in the sequence listing or whose nucleotide sequence is the single-stranded DNA at positions 22-46 of sequence 2 in the sequence listing; The primer C nucleotide sequence is a single-stranded DNA molecule of sequence 3 in the sequence listing.

7. The method according to claim 1 or 2, or the application according to claim 4, characterized in that: The genotype of the SNP is GG or TT, where GG is the homozygous type of the SNP with the genotype G, and TT is the homozygous type of the SNP with the genotype T; the number of ears per mu of the wheat being tested with the genotype TT of the SNP is higher or a candidate higher than that of the wheat being tested with the genotype GG of the SNP.