Application of CircRNA Markers Derived from Peripheral Blood Mononuclear Cells in the Diagnosis of Diabetic Retinopathy

Through circular RNAhsa_circ_0053004 as a biomarker, combined with real-time fluorescence quantitative PCR technology, an early diagnosis kit was developed, solving the problem of lack of early diagnosis methods in the existing technology, and achieving rapid and accurate diagnosis and potential therapeutic targets for diabetic retinopathy.

CN118895356BActive Publication Date: 2025-08-19AFFILIATED PEOPLES HOSPITAL OF NINGBO UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411232006.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-09-04
Publication Date
2025-08-19
Estimated Expiration
2044-09-04

AI Technical Summary

Technical Problem

The prior art lacks biomarkers with high sensitivity and specificity for early diagnosis of diabetic retinopathy, making it difficult to reverse the structural and functional impairment of the retinal, and the existing methods are mainly aimed at advanced patients.

Method used

The circular RNAhsa_circ_0053004 was used as a biomarker to detect its expression level through real-time fluorescence quantitative PCR technology, and an early diagnosis kit was developed for the early diagnosis of type 2 diabetes retinopathy.

Benefits of technology

The early rapid and accurate diagnosis of diabetic retinopathy was achieved, with the area under the ROC curve of 0.8123, sensitivity of 84%, specificity of 66%, and new targets for clinical treatment.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118895356B_ABST
    Figure CN118895356B_ABST
Patent Text Reader

Abstract

The present invention discloses a biomarker, a detection reagent and its application related to diabetic retinopathy. The biomarker related to diabetic retinopathy includes circ_0053004, and the nucleotide sequence of circ_0053004 is shown in SEQ ID No. 1. In the present invention, the change in the expression level of circ_0053004 is significantly correlated with the occurrence of diabetic retinopathy. It can be used as a biomarker for the early diagnosis of diabetic retinopathy, regularly assessing the progression of diabetic retinopathy and the recurrence after treatment, and providing an important reference basis for the early diagnosis, prognosis and early intervention treatment of diabetic retinopathy. It has great practical clinical value, can intervene and treat early, and reduce unnecessary treatment and expenses for patients who are not at high risk of recurrence.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the fields of genetic engineering and clinical medicine, and relates to a biomarker related to diabetic retinopathy, a detection reagent and uses thereof. Background Art

[0002] Retinopathy refers to changes in the retina caused by various factors, such as hemorrhage, exudation, abnormal cell count, or edema. It is classified into many categories and is quite complex. Common ones include retinal detachment, macular degeneration, ocular trauma, diabetic retinopathy, endophthalmitis, intraocular foreign bodies, congenital eye diseases such as retinopathy of pregnancy (ROP), and intraocular parasites.

[0003] Diabetic retinopathy is one of the major microvascular complications of diabetes and a major cause of blindness. Currently, it is known that the onset of diabetic retinopathy is associated with factors such as inflammation, oxidative stress, abnormal cytokine expression, and gene methylation, but the specific pathogenesis remains unclear. Long-term hyperglycemia, hypoxia, and oxidative stress in the retina of diabetic patients can cause a decrease in the number of retinal microvascular pericytes, thickening of the basement membrane, and proliferation of endothelial cells. Abnormal retinal microcirculation leads to increased retinal vascular leakage and degenerative changes in the optic nerve, which progress to proliferative diabetic retinopathy, with retinal neovascularization, vitreous hemorrhage, fibrous membrane formation, and retinal detachment. The onset of proliferative diabetic retinopathy is relatively insidious, with vision loss occurring in the late stages. Many patients suffer vision loss due to late detection and untimely treatment.

[0004] To date, treatments for diabetic retinopathy, such as laser photocoagulation, intravitreal injection of anti-VEGF drugs or corticosteroids, and vitreoretinal surgery, have primarily been used for patients in the more advanced stages of the disease. However, these treatments are difficult to reverse the structural and functional damage to the retina and can only restore and maintain partial vision. Therefore, early diagnosis and timely treatment are crucial for disease control and prognosis. However, current biomarkers for determining the progression of retinopathy are also very limited. Therefore, a blood protein marker with high sensitivity and specificity is needed to improve the ability to diagnose diabetic retinopathy in the early stages. Currently, there is a lack of effective biomarkers as risk factors for diabetic retinopathy and clinical indicators for determining prognosis.

[0005] Circular RNAs (circRNAs) are a new class of endogenous noncoding RNAs formed by backsplicing of pre-RNAs. Their covalently closed loop structure lacks a 5' cap or 3' poly(A) tail, making them highly resistant to exonucleases. They are typically stable, abundant, and conserved RNA molecules with complex tissue- and stage-specific expression patterns. Although the mechanisms underlying circRNA generation and function are not fully understood, reports indicate their involvement in regulating a variety of fundamental human pathologies, including cardiovascular disease, systemic lupus erythematosus, neurological diseases, and tumors. CircRNAs possess strong tissue- or developmental-stage specificity, enhanced stability, and tolerance to temperature fluctuations, making them ideal diagnostic molecular markers and therapeutic targets. CircRNAs can play a role in disease susceptibility detection, diagnosis, treatment, and prognosis, making them highly valuable research targets. Therefore, the discovery and screening of circRNA biomarkers for diabetes and its complications holds great significance and value for the early prevention and treatment of diabetic retinopathy. Summary of the Invention

[0006] To overcome the above-mentioned deficiencies of the prior art, the present invention provides a biomarker that can conveniently and effectively diagnose or prevent early diabetic retinopathy, a product for detecting the biomarker, and its application in diagnosing or preventing early diabetic retinopathy.

[0007] To achieve the above object, the present invention adopts the following technical solutions:

[0008] A first aspect of the present invention is to provide a biomarker associated with diabetic retinopathy, wherein the biomarker includes circ_0053004.

[0009] Furthermore, the nucleotide sequence of the circular RNA hsa_circ_0053004 is shown in SEQ ID No. 1:

[0010] SEQ ID No. 1:

[0011] AGTTCTAGCTGATCAGTGCTACCTGTGCTCTGGAAACCCGCTCTGCGTTCCTGCTG

[0012] GAGGTGGCCTCCCCTCCGCCCCAGACAAGAAGAGGCCCTCAGCCCTCCCCGTC

[0013] TCAGAGAGCCCTGAGAGGAGGCCCAGTCCAGAGCTCTTCCTCCGTTCCCAGTCCA

[0014] CTTCTCTAGGGCCAGTAGCAGACACCAGCCAGTATGCCGAGGAACCAGGGCTTCT

[0015] CCGAGCCCGAATACTCGGCCGAGTACTCAGCCGAGTACTCCGTCAGCCTGCCCTC

[0016] CGACCCTGACCGCGGGGTGGGCCGGACCCATGAAATCTCGGTCCGGAACTCGGGC

[0017] TCCTGCCTGTGCCTGCCTCGCTTCATGCGGCTGACTTTCGTGCCGGAGTCCTTGGA

[0018] GAACCTCTACCAGACCTACTTCAAAAGGCAGCGCCACGAGACCCTGCTGGTGCTG

[0019] GTGGTCTTTGCAGCCCTCTTTGACTGCTACGTGGTGGTCATGTGTGCTGTGGTCTT

[0020] CTCCAGCGACAAGCTGGCTTCCCTCGCCGTGGCTGGAATTGGACTGGTGTTGGAC

[0021] ATCATCCTCTTCGTGCTCTGCAAAAAGGGGCTGCTCCCGGACCGGGTCACCCGCA

[0022] GAGTGCTGCCCTACGTGCTGTGGCTGCTCATAACCGCCCAGATCTTCTCCTACCTG

[0023] GGCCTGAACTTCGCGCGTGCCCACGCGGCTAGTGACACGGTGGGCTGGCAGGTCT

[0024] TCTTTGTCTTCTCCTTCTTCATCACGCTGCCCCTCAGCCTCAGCCCCATCGTGATCA

[0025] TCTCCGTGGTCTCCTGTGTGGTGCACACGTTGGTCCTGGGGGTCACCGTGGCCCA

[0026] GCAGCAGCAGGAGGAGCTCAAGGGGATGCAGCTGCTGCGGGAGATCCTGGCCAA

[0027] CGTCTTCCTCTACCTGTGCGCCATCGCTGTGGGCATCATGTCCTACTACATGGCTGA

[0028] CCGCAAGCACCGCAAGGCCTTCCTGGAGGCCCGCCAGTCGCTGGAGGTGAAGAT

[0029] GAACCTGGAAGAGCAGAGCCAGCAGCAGGAGAACCTCATGCTTTCCATCCTGCCC

[0030] AAGCACGTGGCTGACGAGATGCTGAAAGACATGAAGAAAGACGAGAGCCAGAAG

[0031] GACCAGCAGCAGTTCAACACCATGTACATGTACCGTCACGAGAACGTCAGCATCC

[0032] TCTTTGCCGACATCGTGGGCTTTACCCAGCTGTCTTCTGCCTGCAGTGCCCAGGAG

[0033] CTTGTGAAGCTGCTCAACGAGCTCTTTGCCCGCTTTGACAAGCTGGCAGCTAAATA

[0034] CCACCAGCTGCGGATTAAGATCCTGGGCGACTGCTACTACTGCATCTGCGGCTTGC

[0035] CCGACTACCGGGAGGACCACGCCGTCTGCTCCATCCTCATGGGGCTGGCCATGGT

[0036] GGAGGCCATCTCGTATGTGCGGGAGAAGACCAAGACTGGGGTGGACATGCGTGTG

[0037] GGGGTGCACACGGGCACCGTGCTGGGGGGCGTCCTGGGCCAGAAGCGCTGGCAG

[0038] TACGACGTGTGGTCGACTGATGTCACTGTAGCCAACAAGATGGAGGCCGGCGGCA

[0039] TCCCTGGGCGCGTGCACATCTCCCAGAGCACCATGGACTGCCTGAAAGGGGAGTT

[0040] TGATGTGGAGCCAGGCGATGGGGGCAGCCGCTGTGATTACCTAGAAGAGAAGGGT

[0041] ATTGAAACCTACCTCATCATTGCCTCCAAGCCAGAGGTGAAGAAAACAGCCACCC

[0042] AGAATGGCCTCAATGGCTCGGCCCTGCCCAATGGAGCACCAGCTTCCTCAAAGTC

[0043] CAGCTCCCCTGCCCTCATTGAGACCAAGGAGCCCAACGGGAGTGCCCACAGCAGT

[0044] GGGTCCACGTCGGAGAAGCCCGAGGAGCAGGATGCCCAGGCCGACAACCCCTCA

[0045] TTCCCCAACCCACGCCGGAGGCTGCGCCTGCAGGACCTGGCTGACCGAGTGGTGG

[0046] ATGCCTCTGAAGATGAGCACGAGCTCAACCAGCTGCTCAACGAGGCCCTGCTTGA

[0047] GCGAGAGTCCGCCCAAGTAGTAAAGAAGAGAAACACCTTCCTCTTGTCCATGCGG

[0048] TTCATGGACCCCGAGATGGAAACCCGCTACTCGGTGGAGAAGGAGAAGCAGAGT

[0049] GGGGCTGCCTTCAGCTGCTCCTGCGTCGTCCTGCTCTGCACGGCCCTGGTCGAGAT

[0050] ACTCATCGACCCCTGGCTAATGACAAACTATGTGACCTTCATGGTGGGGGAGATTC

[0051] TGCTCCTCATCCTGACCATCTGCTCCCTGGCTGCCATCTTTCCCCGGGCCTTTCCTA

[0052] AGAAGCTTGTGGCCTTCTCAACTTGGATTGACCGGACCCGCTGGGCCAGGAACAC

[0053] CTGGGCCATGCTCGCCATCTTCATCCTGGTGATGGCAAATGTCGTGGACATGCTCA

[0054] GCTGTCTCCAGTACTACACGGGACCCAGCAATGCAACGGCAGGGATGGAAACGGA

[0055] GGGCAGCTGCCTGGAGAACCCCAAGTATTACAACTATGTGGCCGTGCTGTCCCTCA

[0056] TCGCCACCATCATGCTGGTGCAGGTCAGCCACATGGTGAAGCTCACGCTCATGCTG

[0057] CTCGTCGCAGGCGCCGTGGCCACCATCAACCTCTATGCCTGGCGTCCCGTCTTTGA

[0058] TGAATACGACCACAAGCGTTTTCGGGAGCACGACTTACCTATGGTGGCCTTAGAGC

[0059] AGATGCAAGGATTCAACCCTGGGCTCAATGGCACTGACAGGCTGCCCCTGGTGCC

[0060] TTCCAAGTACTCTATGACGGTGATGGTGTTCCTCATGATGCTCAGCTTCTACTACTT

[0061] CTCCCGCCACGTAGAAAAACTGGCACGGACACTTTTCTTGTGGAAGATTGAGGTC

[0062] CACGACCAGAAGGAACGTGTCTATGAGATGCGACGCTGGAACGAGGCCTTGGTCA

[0063] CCAACATGTTGCCTGAGCACGTGGCACGCCATTTCCTGGGGTCCAAGAAGAGAGA

[0064] TGAGGAGCTGTATAGCCAGACGTATGATGAGATTGGAGTCATGTTTGCCTCCCTGC

[0065] CCAACTTTGCTGACTTCTACACAGAGGAGAGCATCAACAATGGGTGGTATTGAGTGT

[0066] CTGCGTTTCCTCAATGAAATCATCTCAGATTTTGACTCT

[0067] Furthermore, the expression of the biomarker in diabetic patients and patients with diabetic retinopathy showed significant differences.

[0068] Furthermore, the biomarkers are expressed significantly differently in patients with diabetic retinopathy at different stages; specifically, the stages include a mild diabetic retinopathy group, a moderate diabetic retinopathy group, a severe diabetic retinopathy group, and a diabetic retinopathy group.

[0069] The second aspect of the present invention is to provide a reagent for detecting the expression level of circ_0053004 for use in preparing a product for early diagnosis of type 2 diabetic retinopathy.

[0070] Furthermore, the early diagnosis product includes an early diagnosis reagent or an early diagnosis kit.

[0071] Furthermore, the early diagnosis kit includes the biomarker circ_0053004.

[0072] Furthermore, the early diagnosis kit also includes an amplification primer pair for specifically amplifying the biomarker circ_0053004, an internal reference gene GAPDH primer, and an amplification system.

[0073] Furthermore, the specific amplification primers include an upstream primer and a downstream primer.

[0074] Furthermore, the nucleotide sequence of the upstream primer is shown as SEQ ID No. 2, and the nucleotide sequence of the downstream primer is shown as SEQ ID No. 3.

[0075] SEQ ID No.2:5'-GCCCAACTTTGCTGACTTCTA-3';

[0076] SEQ ID No. 3: 5'-GTTTCCAGAGCACAGGTAGCA-3'.

[0077] Furthermore, the nucleotide sequence of the upstream primer of the internal reference gene GAPDH is shown in SEQ ID NO:4; the nucleotide sequence of the downstream primer is shown in SEQ ID NO:5.

[0078] SEQ ID No.4:5'-ATGGAAATCCCATCACCATCTT-3';

[0079] SEQ ID No. 5: 5'-CGCCCCACTTGATTTTGG-3'.

[0080] Preferably, the amplification system is a real-time fluorescence quantitative PCR amplification system, including Ex Taq enzyme, dNTP Mixture, Mg 2+ , Tli RNaseH and TB Green.

[0081] Compared with the prior art, the present invention has the following technical effects:

[0082] (1) The present invention discovered for the first time that hsa_circ_0053004 can be used as a diagnostic biomarker for diabetic retinopathy. It is specifically highly expressed in diabetic retinopathy, but not in normal human tissues or diabetic tissues. By detecting the expression level of this marker in subjects, the occurrence of early diabetic retinopathy can be quickly and accurately determined.

[0083] (2) The hsa_circ_0053004 was amplified using the specific amplification primers provided by the present invention, and the amplification results were analyzed. The area under the ROC curve for diabetic patients and diabetic retinopathy patients was 0.8123, the sensitivity was 84%, and the specificity was 66%, indicating that the primers have high sensitivity and strong specificity.

[0084] (3) The research results of the present invention also show that compounds that interfere with hsa_circ_0053004 can inhibit the growth of diabetic retinopathy, providing a new target for the clinical treatment of diabetic retinopathy. Compounds that interfere with hsa_circ_0053004 can be used in the preparation of diabetic retinopathy drugs. BRIEF DESCRIPTION OF THE DRAWINGS

[0085] Figure 1 shows the expression profiles of circRNAs in PBMCs from patients with DR and DM. A. Volcano plot: red indicates differentially upregulated circRNA expression, blue indicates differentially downregulated circRNA expression, and gray indicates no significant differences in circRNA expression. B. Heat map: The horizontal axis represents samples, and the vertical axis represents circRNA expression. Different circRNA expression levels are represented by different colors, with red representing genes with higher expression levels and blue representing genes with lower expression levels.

[0086] Figure 2 This is a GO enrichment classification histogram. The horizontal axis represents the GO classification, and the vertical axis represents -log10 (pvalue). The larger the -log10 (pvalue) value, the higher the GO enrichment.

[0087] Figure 3 This is a KEGG scatter plot. Enrichment represents the number of differentially expressed genes in the KEGG group divided by the total number of genes. A larger Enrichment value indicates a higher degree of enrichment.

[0088] Figure 4 hsa_circ_0053004 expression levels in PBMCs and aqueous humor.

[0089] A. hsa_circ_0053004 expression level in PBMCs.

[0090] B. Expression level of hsa_circ_0053004 in aqueous humor.

[0091] Expression levels of hsa_circ_0053004 in different CD.DR stages.

[0092] * represents p < 0.05, ** represents p < 0.01, and *** represents p < 0.001.

[0093] Figure 5 Receiver operating characteristic curve analysis of Hsa_circ_0053004 in peripheral blood mononuclear cells of DR patients.

[0094] Figure 6 shows the receiver operating characteristic curve analysis of hsa_circ_0053004 in peripheral blood

[0095] A. Receiver operating characteristic curves of the marker hsa_circ_0053004 in peripheral blood mononuclear cells of patients with diabetic retinopathy and diabetes.

[0096] B. Receiver operating characteristic curve of the marker hsa_circ_0053004 in peripheral blood mononuclear cells of patients with non-proliferative diabetic retinopathy and diabetes.

[0097] C. Receiver operating characteristic curve of the marker hsa_circ_0053004 in peripheral blood mononuclear cells of patients with proliferative diabetic retinopathy and diabetes.

[0098] D. Receiver operating characteristic curve of the marker hsa_circ_0053004 in peripheral blood mononuclear cells of patients with mild non-proliferative diabetic retinopathy and diabetic patients.

[0099] E. Receiver operating characteristic curve of the marker hsa_circ_0053004 in peripheral blood mononuclear cells of patients with moderate proliferative diabetic retinopathy and diabetic patients.

[0100] F. Receiver operating characteristic curves of the marker hsa_circ_0053004 in peripheral blood mononuclear cells of patients with severe proliferative diabetic retinopathy and diabetic patients.

[0101] Figure 7 Circ_0053004 regulates endothelial dysfunction in hRMECs in vitro.

[0102] A. hRMECs were exposed to different gradients of glucose for 24 h.

[0103] B. qRT-PCR detected the expression level of circ_0053004 in NG group, OS (20mM mannitol), and HG (20mM Mglucose).

[0104] C. RT-PCR detection of circ_0053004 siRNA knockdown efficiency.

[0105] D. Transwell was used to evaluate the invasion and migration ability of hRMECs in different treatment groups.

[0106] E. Tube formation assay to evaluate the tube-forming ability of hRMECs in different treatment groups. Scale bar = 100 μm. n = 3. * indicates p < 0.05, ** indicates p < 0.01, and *** indicates p < 0.001.

[0107] Figure 8 This figure shows the network diagram and validation of hsa_circ_0053004 target miRNAs. The size of the circles in the figure represents the number of target miRNAs, and the color of the circles represents the function of the target miRNAs. The expression of hsa_circ_0053004 target miRNAs was validated in high-glucose-treated human retinal microvascular endothelial cells. Data are expressed as mean ± standard error of the mean (SEM). * indicates p < 0.05, ** indicates p < 0.01, and *** indicates p < 0.001. DETAILED DESCRIPTION

[0108] In order to screen biomarkers that can be used for the diagnosis of retinopathy, the present invention collects blood (plasma) samples from patients with diabetic retinopathy and blood (plasma) samples from patients with diabetes, comprehensively analyzes the protein expression profiles of the samples, screens for proteins that show significant differences in levels between the two groups in the training set, and further analyzes the diagnostic efficacy of the differentially expressed proteins, thereby discovering biomarkers suitable for the diagnosis and treatment of retinopathy.

[0109] In the present invention, the term "biomarker" means a gene or its expression product that is differentially present (i.e., increased or decreased) in a biological sample from a subject or a group of subjects having a first phenotype (e.g., having a disease) compared to a biological sample from a subject or a group of subjects having a second phenotype (e.g., not having the disease). A biomarker can be differentially present at any level, but is generally present at a level that is increased by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 100%, at least 110%, at least 120%, at least 130%, at least 140%, at least 150%, at least 160%, at least 170%, at least 180%, at least 190%, at least 200%, at least 210%, at least 220%, at least 230%, at least 240%, at least 250%, at least 260%, at least 270%, at least 280%, at least 290%, at least 300%, at least 310%, at least 310%, at least 320%, at least 330%, at least 340%, at least 350%, at least 360%, at least 370%, at least 380%, at least 390%, at least 400%, at least 410%, at least 420%, at least 430%, at least 440%, at least 450%, at least 460%, at least 470%, at least 480%, Preferably, the biomarker is differentially present at a level that is at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% (i.e., absent). Preferably, the biomarker is differentially present at a level that is statistically significant (i.e., p-value less than 0.05 and / or q-value less than 0.10, as determined using Welch's T-test or Wilcoxon's rank-sum test).

[0110] In the present invention, common terms and their English abbreviations are shown in the following table:

[0111]

[0112]

[0113] 1. Experimental Methods

[0114] 1. Research subjects

[0115] This study will recruit participants from June 2022 to December 2023. All participants were informed of the study content and risks and provided informed consent before the study. This study adheres to the provisions of the Declaration of Helsinki and has been reviewed and approved by the ethics committee.

[0116] 1.1 Inclusion criteria

[0117] (1) Regardless of gender, age > 30 years old, and able to cooperate with and complete all examinations related to this study.

[0118] (2) Patients diagnosed with type 2 diabetes according to the diagnostic criteria of the American Diabetes Association.

[0119] 1.2 Exclusion criteria

[0120] (1) Patients with type 1 diabetes.

[0121] (2) Those with poor general condition, such as cerebral infarction, myocardial infarction, uncontrollable hypertension, liver and kidney dysfunction, etc.

[0122] (3) People with systemic diseases that may affect gene expression, such as malignant tumors, some autoimmune diseases, viral infections, etc.

[0123] (4) Patients who are in the acute infection stage.

[0124] (5) Patients who have undergone retinal laser photocoagulation, anti-vascular endothelial growth factor injection, or vitrectomy in the past.

[0125] (6) Patients who have undergone other intraocular surgeries other than cataract surgery.

[0126] (7) People suffering from diseases affecting the retina, such as age-related macular degeneration, retinal vein occlusion, etc.

[0127] (8) People suffering from diseases that affect the optic nerve, such as glaucoma, eye trauma, etc.

[0128] 1.3 Study Subject Grouping and Clinical Data Collection

[0129] According to the international staging system for diabetic retinopathy, the subjects were divided into a DM group and a DR group. The DR group was further divided into a mild NPDR group, a moderate NPDR group, a severe NPDR group, and a PDR group. All subjects' names, gender, age, duration of diabetes, BMI, blood lipid profile, and blood glucose profile were recorded.

[0130] 2. Experimental Methods

[0131] 2.1 Microarray Results Screening

[0132] This study used our group's previous high-throughput circular RNA microarray results to screen for differentially expressed genes for subsequent analysis. Differentially expressed genes were defined as circular RNAs with a P < 0.05 and a fold difference of 2 or greater.

[0133] 2.2 Total RNA extraction

[0134] All consumables used in this experiment were enzyme-free in advance.

[0135] 2.2.1 Total RNA extraction from peripheral blood mononuclear cells

[0136] (1) Collect 2-3 ml of peripheral blood from the subject into an anticoagulant blood collection tube.

[0137] (2) Add 1*PBS phosphate buffer equal to the volume of the above peripheral blood into the blood collection tube to dilute it and mix it upside down.

[0138] (3) Add human peripheral blood lymphocyte separation solution to a 15 ml centrifuge tube in advance. The volume of the separation solution should be 3 / 4 of the total volume of the diluted peripheral blood.

[0139] (4) Slowly add the diluted peripheral blood into the above centrifuge tube.

[0140] (5) Centrifuge at 1500 rpm for 40 minutes at room temperature.

[0141] (6) Take out the centrifuge tube containing the peripheral blood PBS separation solution after centrifugation, and carefully draw out the white flocs in the middle layer into a 15 ml centrifuge tube that has been pre-added with 1*PBS phosphate buffer.

[0142] (7) Centrifuge at 1700 rpm for 10 minutes at room temperature.

[0143] (8) Discard the supernatant, add 1 ml of TRIzol lysis buffer, pipette repeatedly until there is no obvious precipitation, and then transfer to a 1.5 ml EP tube.

[0144] (9) After lysis at room temperature for 5 minutes, the subsequent RNA extraction can be carried out directly, or it can be transferred to -80℃ for short-term storage.

[0145] (10) Add 0.2 ml of RNA extraction reagent (provided by TranZolUpPlus RNA kit) and shake vigorously at room temperature for 5 minutes.

[0146] (11) Centrifuge at 12,000 g for 15 minutes at 4°C.

[0147] (12) Transfer the upper colorless aqueous phase to a new 1.5 ml EP tube, add an equal volume of isopropanol, pipette and mix thoroughly, and place in a 4 °C refrigerator for 30 min.

[0148] (13) Centrifuge at 12,000 g for 10 minutes at 4°C.

[0149] (14) Discard the supernatant and add 1 ml of anhydrous ethanol to the white precipitate at the bottom and mix by pipetting repeatedly.

[0150] (15) Centrifuge at 12,000 g for 1 minute at 4°C.

[0151] (16) Discard the supernatant again, add 1 ml of anhydrous ethanol, and mix by pipetting repeatedly.

[0152] (17) Centrifuge at 12,000 g for 5 minutes at 4°C.

[0153] (18) Discard the supernatant and let it dry at room temperature.

[0154] (19) Add an appropriate amount of DEPC water and pipette repeatedly to mix evenly.

[0155] (20) Measure the total RNA concentration and purity. Take 1 μl to measure the OD value and store the remaining RNA at -80°C.

[0156] 2.2.2 Total RNA extraction from aqueous humor

[0157] In this experiment, a SmallRNA extraction kit was used to extract total RNA from aqueous humor.

[0158] (1) Before surgery, 100-150 μl of aqueous humor was drawn from the anterior chamber under sterile conditions. The sample was centrifuged at 12,000 g for 20 minutes at 4°C, and the impurities at the bottom were removed and frozen at -80°C until use.

[0159] (2) Since the amount of aqueous humor in one eye is small and the RNA content is low, to ensure the extraction efficiency, 100 μl of aqueous humor was collected from each eye and randomly mixed into one sample from three eyes in the same group for subsequent experiments.

[0160] (3) Take 300 μl of aqueous humor sample and transfer it to a 2.0 ml EP tube.

[0161] (4) Add 900 μl of lysis buffer Buffer BLS for small RNA to the above EP tube and pipette repeatedly until there is no obvious precipitation.

[0162] (5) Let it stand at room temperature for 5 minutes to allow for complete lysis.

[0163] (6) Add 0.2 ml of RNA extraction reagent (provided by TranZolUpPlus RNA kit) to the above lysate and shake vigorously at room temperature for 5 minutes.

[0164] (7) Centrifuge at 12,000 g for 15 minutes at 4°C.

[0165] (8) Transfer the supernatant to another 2.0 ml EP tube, slowly add 2 times the volume of the supernatant with anhydrous ethanol, and pipette evenly.

[0166] (9) Immediately transfer the above mixed solution into the dedicated EP tube provided by the kit in batches, let it stand at room temperature for 2 minutes, centrifuge it at 12000 rpm at room temperature for 1 minute, and discard the filtrate.

[0167] (10) Add 600 μl of Buffer RWA for small RNA to the above EP tube, let it stand at room temperature for 2 minutes, centrifuge at 12000 rpm at room temperature for 1 minute, and discard the filtrate.

[0168] (11) Add 650 μl of Buffer RWA for small RNA to the above EP tube, let it stand at room temperature for 2 minutes, centrifuge at 12000 rpm at room temperature for 1 minute, and discard the filtrate.

[0169] (12) Add 650 μl of Buffer RWA for small RNA to the above EP tube again, let it stand at room temperature for 2 minutes, centrifuge at 12000 rpm at room temperature for 1 minute, and discard the filtrate.

[0170] (13) Place the above EP tube in a new 2.0 ml EP tube, let it stand at room temperature for 2 minutes, and centrifuge it at 12000 rpm for 2 minutes at room temperature.

[0171] (14) Place the above EP tube in a new 1.5 ml EP tube, add 15 μl RNase Free Water to the center of the adsorption column, let it stand at room temperature for 2 minutes, centrifuge at 12000 rpm at room temperature for 2 minutes, elute the total RNA, and pipette evenly.

[0172] (15) Measure the total RNA concentration and purity. Take 1 μl of the aliquot to measure the OD value and store the remaining RNA at -80°C.

[0173] 2.2.3 RNA extraction from adherent cells

[0174] (1) Discard the original culture medium and wash twice with sterile 1*PBS phosphate buffer.

[0175] (2) Add 1 ml of TRIzol lysis buffer to each well and place it horizontally on ice for 5 minutes to allow the lysis buffer to fully cover the cells. Use a pipette to repeatedly pipette until there is no obvious precipitation.

[0176] (3) Transfer the cell lysate to a 1.5 ml EP tube and continue lysing on ice for 10 minutes.

[0177] (4) Add 0.2 ml of RNA extraction reagent (provided by TranZolUp Plus RNA kit) and shake vigorously at room temperature for 5 minutes.

[0178] (5) Centrifuge at 12,000 g for 15 minutes at 4°C.

[0179] (6) Transfer the upper colorless aqueous phase to a new 1.5 ml EP tube, add an equal volume of isopropanol, pipette and mix thoroughly, and place in a 4 °C refrigerator for 30 minutes.

[0180] (7) Centrifuge at 12,000 g for 10 minutes at 4°C.

[0181] (8) Discard the supernatant and add 1 ml of anhydrous ethanol to the white precipitate at the bottom, and mix by pipetting repeatedly.

[0182] (9) Centrifuge at 12,000 g for 1 minute at 4°C.

[0183] (10) Discard the supernatant again, add 1 ml of anhydrous ethanol, and mix by pipetting repeatedly.

[0184] (11) Centrifuge at 12,000 g for 5 minutes at 4°C.

[0185] (12) Discard the supernatant and let it dry at room temperature.

[0186] (13) Add an appropriate amount of DEPC water and pipette repeatedly to mix evenly.

[0187] (14) Measure the total RNA concentration and purity. Take 1 μl of the aliquot to measure the OD value and store the remaining RNA at -80°C.

[0188] 2.3 RNA reverse transcription experiment

[0189] (1) Reverse transcription reaction system

[0190]

[0191] (2) MicroRNA plus polyA tail reaction system

[0192]

[0193] (3) Reverse transcription reaction conditions

[0194]

[0195] 2.4 Real-time quantitative PCR (RT-qPCR)

[0196] (1) The above-mentioned reversed product was diluted 10 times with DEPC water and used in this experiment.

[0197] (2) Reaction system

[0198]

[0199] (3) Reaction conditions (40 cycles in total)

[0200]

[0201]

[0202] (4) The product was stored at -80°C.

[0203] (5) GAPDH was used as the internal reference, while U6 was used as the internal reference for microRNA. ΔCt = Ct (target gene) - Ct (reference gene), ΔΔCt = ΔCt - mean ΔCt of the control group.

[0204]

[0205] Note: The downstream primers of micro RNAs are provided by Universal Primer and U6 internal reference kit.

[0206] 2.5 Cell experiments

[0207] 2.5.1 Cell lines

[0208] This study used primary human retinal microvascular endothelial cells. To ensure good cell growth, the cells used in the experiment were all at passage 4-8.

[0209] 2.5.2 Cell recovery

[0210] Remove hRMECs from liquid nitrogen and quickly place them in a preheated 37°C water bath. Shake rapidly to completely thaw the cryovial within 1 minute. Immediately add 2 ml of pre-prepared complete culture medium, gently pipette, and centrifuge (500 rpm, 4 minutes). Discard the supernatant. Add 1 ml of pre-prepared complete culture medium and pipette thoroughly before inoculating into a T25 culture flask. Gently shake the flask using the cross-section maneuver to evenly distribute the cells. Place the flask in an incubator for culture.

[0211] 2.5.3 Cell culture, medium replacement, and passaging

[0212] (1) Cell culture: hRMECs were inoculated in complete culture medium and cultured at 37°C with a CO2 concentration of 5%. Cells in the logarithmic growth phase were used for subsequent experiments.

[0213] (2) Cell culture medium replacement: To provide cells with good growth conditions, the culture medium needs to be replaced regularly. After aspirating most of the old culture medium, wash the cells twice with sterile 1*PBS phosphate buffer. After adding fresh complete culture medium, gently mix and place in the incubator for continued culture.

[0214] (3) Cell passaging: When the cell density reaches 70-80%, cell passaging can be performed. Discard the old culture medium and add sterile 1*PBS phosphate buffer to wash twice. Add 1ml of 0.05% EDTA-trypsin to the culture flask and mix well so that the adherent cells are evenly covered with liquid. Place in the incubator to digest for 1-2 minutes (dynamic observation under the microscope). When most of the cells are detached from the wall, immediately add 2ml of complete culture medium to neutralize. Repeatedly blow to form a cell suspension, transfer to another new 15ml centrifuge tube and centrifuge (1000rpm, 5min). Discard the supernatant and add an appropriate amount of fresh complete culture medium. After gently blowing evenly, inoculate into a new culture flask and place in the incubator for culture.

[0215] 2.5.4 Cell plating

[0216] After digesting the cells in the logarithmic growth phase, count the cells under a microscope and seed them into a 6-well plate, 96-well plate, culture dish, etc. required for the experiment at a certain density. Gently shake the cells to evenly distribute them and then place them in an incubator for culture.

[0217] 2.5.5 Cell Cryopreservation

[0218] Digest the cells to be frozen and centrifuge them (1000 rpm, 5 minutes). Add 1 ml of pre-prepared freezing solution (0.9 ml FBS + 0.1 ml DMSO) and pipette thoroughly to mix well before transferring to a cryovial. Label the cryovial with the cell name, passage number, freezing time, and the experimenter's name. Place the cryovial in a programmed cooling box at -80°C overnight, then transfer to liquid nitrogen for long-term freezing.

[0219] 2.5.6 Cell transfection

[0220] In this study, siRNA design and transfection were performed targeting hsa_circ_0053004.

[0221] (1) Experimental groups

[0222] Transfection blank group (Ctrl group): hRMECs were cultured in a normal complete medium containing 5.5 mmol / L glucose and transfected with empty Scr siRNA as a blank control.

[0223] High glucose + transfection blank group (HG group): hRMECs were cultured in high glucose medium (20 mmol / L glucose was added to the normal medium) and transfected with empty Scr siRNA.

[0224] High glucose + transfection intervention group (HG+circ_0053004siRNA group): hRMECs were cultured in high glucose medium and then transfected with circ_0053004siRNA for intervention.

[0225] (2) Transfection steps

[0226] Cells in the logarithmic phase of growth were digested and seeded into 6-well plates according to the experimental groups, and incubated in an incubator. When the cell density reached 40-50%, transfection experiments could be performed. Remove the 6-well plate and starve it for 2 hours. Change the medium half an hour before transfection. Prepare the transfection reagent: Add 5μl siRNA to 100μl Transfection Buffer (1X), pipette gently to mix evenly, and let it stand at room temperature for 5 minutes. Add 4μl Gen Mute Reagent to the above mixture, pipette gently to mix evenly, and let it stand at room temperature for 15 minutes. Remove the 6-well plate and gently add the above mixture dropwise. Replace with fresh culture medium after 5 hours.

[0227] 2.5.7 Cell viability assay

[0228] (1) Experimental groups

[0229] Normal control group (NG group): hRMECs were cultured in normal complete culture medium containing glucose at a concentration of 5.5 mmol / L.

[0230] High glucose medium group (HG group): hRMECs were cultured in high glucose medium, in which 20 mmol / L glucose was additionally added to the normal medium.

[0231] Mannitol medium group (OS group): hRMECs were cultured in high-glucose medium, in which 20 mmol / L mannitol was additionally added to the normal medium.

[0232] (3) Steps

[0233] Digest each group of cells and seed them into a 96-well plate at a density of 5,000 cells / well (200 μl). Cell viability was assessed when the cell density reached 70–80%. Aspirate the original culture medium and add 100 μl of fresh culture medium plus 10 μl of CCK-8 solution to each well. Incubate the 96-well plate in an incubator for 1–2 hours. Measure the OD value at a wavelength of 450 nm using a microplate reader.

[0234] 2.5.8 Transwell assay

[0235] (1) Experimental groups

[0236] Transfection blank group (Ctrl group): hRMECs were cultured in a normal complete medium containing 5.5 mmol / L glucose and transfected with empty Scr siRNA as a blank control.

[0237] High glucose + transfection blank group (HG group): hRMECs were cultured in high glucose medium (20 mmol / L glucose was added to the normal medium) and transfected with empty ScrsiRNA.

[0238] High glucose + transfection intervention group (HG+circ_0053004siRNA group): hRMECs were cultured in high glucose medium and then transfected with circ_0053004siRNA for intervention.

[0239] (2) Steps

[0240] Before the experiment, pre-cool the pipette tips, 24-well plates, and Transwell chambers required for the experiment, and dissolve the Matrigel matrix gel in a -4°C refrigerator cold bath. Dilute the Matrigel matrix gel with pre-cooled sterile 1*PBS phosphate buffer. Use tweezers to pick up the Transwell chamber required for the experiment and place it in the 24-well plate. Add 100μl of Matrigel matrix gel to each well and incubate in the incubator for 2 hours until the Matrigel matrix gel solidifies. Remove the 24-well plate, aspirate the excess unsolidified liquid in the upper chamber, add 100μl of pre-cooled culture medium, and continue to incubate in the incubator for 30 minutes. Digest each group of cells and inoculate them on the Matrigel matrix gel in the upper chamber at a cell density of 104 / well (200μl of culture medium without FBS), and add 750μl of culture medium containing 10% FBS to the lower chamber. Place in the incubator for 24 hours. Carefully remove the Transwell chamber and wash twice with sterile 1x PBS phosphate buffer. Fix with paramethylol for 20 minutes, then wash twice with sterile 1x PBS phosphate buffer. Stain the Transwell chamber with crystal violet and wash three times with sterile 1x PBS phosphate buffer. Gently wipe the interior of the upper chamber with a cotton swab and observe and photograph under a microscope.

[0241] 2.5.9 Angiogenesis Assay

[0242] (1) Experimental groups

[0243] Transfection blank group (Ctrl group): hRMECs were cultured in a normal complete medium containing 5.5 mmol / L glucose and transfected with empty ScrsiRNA as a blank control.

[0244] High glucose + transfection blank group (HG group): hRMECs were cultured in high glucose medium (20 mmol / L glucose was added to the normal medium) and transfected with empty ScrsiRNA.

[0245] High glucose + transfection intervention group (HG+circ_0053004siRNA group): hRMECs were cultured in high glucose medium and then transfected with circ_0053004siRNA for intervention.

[0246] (3) Steps

[0247] Before the experiment, pre-cool the pipette tips and 96-well plates required for the experiment and dissolve the Matrigel in a -4°C refrigerator. Dilute the Matrigel in equal proportions with pre-cooled sterile 1x PBS phosphate buffer. Remove the pre-cooled 96-well plate and vertically add 50 μl of Matrigel to each well. Incubate in an incubator for 2 hours until the Matrigel solidifies. Digest each group of cells and seed them onto the Matrigel at a cell density of 3 x 104 / well (100 μl of culture medium). Place in an incubator and observe and photograph the cells for 4-8 hours.

[0248] 2.6 Statistical analysis

[0249] All experimental data in this study were statistically analyzed using SPSS software, version 22.0, and GraphPad Prism software, version 9.5.1. Measurement data in figures are presented as mean ± standard error (SEM), and measurement data in tables are presented as mean ± standard deviation (SD). Count data are presented as ratios. All measurement data were tested for normality, and normally distributed measurement data were further tested for homogeneity of variance (Levene's test). For data that conformed to a normal distribution and had homogeneous variance, two-group comparisons were performed using the Student's two-sided test, and multiple-group comparisons were performed using one-way analysis of variance. For data that did not conform to a normal distribution and had heterogeneous variance, two-group comparisons were performed using the Mann-Whitney U test, and multiple-group comparisons were performed using the Kreskal-Wallis test combined with the Bonferroni's test. A P value < 0.05 was considered statistically significant.

[0250] Example 1 Screening for potential biomarkers in patients with retinopathy

[0251] In order to find potential biomarkers for diagnosing diabetic retinopathy, the present invention extracted circRNAs from the peripheral blood of 4 healthy controls (HC), 4 diabetic patients (DM) and 4 diabetic retinopathy (DR) patients (see Table 1 for the results).

[0252] The Agilent Human CircRNAArray (V2.0) was used to perform microarray analysis of the expression profiles of circRNAs in peripheral blood. Based on the results of the above chip analysis, circRNAs with significant differential expression between the groups were screened as potential biomarkers (see Table 2 for the results).

[0253] A total of 2,452 differentially expressed circRNAs were screened between diabetic retinopathy patients and healthy controls, of which 106 were upregulated and 1,346 were downregulated. A total of 946 genes were differentially expressed between diabetic retinopathy patients and healthy controls, of which 549 were upregulated and 397 were downregulated.

[0254] Furthermore, in the study of differentially expressed circRNAs between patients with diabetic retinopathy and diabetic patients, the test results showed that after RNA was extracted from isolated peripheral blood, high-throughput sequencing was used to detect circular RNA in exosomes, and a total of 289 circRNAs were detected to be differentially expressed.

[0255] Attachment Figure 1A The results showed that the abundance of 104 circRNAs was significantly lower than that of the diabetic patient group, and the abundance of 185 circRNAs was significantly higher than that of the diabetic patient group. Figure 1B The results showed that 289 circRNAs were significantly differentially clustered between patients with diabetic retinopathy and patients with diabetes. Table 1 shows the top 10 upregulated and downregulated circRNAs with the greatest differences. circ_0053004 was the most significantly upregulated circRNA. Therefore, the present invention selected circ_0053004 as a candidate biomarker for distinguishing patients with DR and diabetes.

[0256] Table 1. The 20 circRNAs with the greatest expression differences in peripheral blood mononuclear cells between patients with diabetic retinopathy (n=4) and patients with diabetes (n=4) (P<0.05)

[0257]

[0258]

[0259] The above table shows the 10 most upregulated and 10 most downregulated circRNA IDs in tissue sections of patients with diabetic retinopathy and diabetes.

[0260] Table 2. Demographic and clinical characteristics of the subjects in the confirmation cohort (samples were derived from peripheral blood mononuclear cells)

[0261]

[0262]

[0263] The table above shows RNA validation screened in peripheral blood mononuclear cells. Unless otherwise specified, data are expressed as mean ± SD. DM: diabetes mellitus; NPD: nonproliferative diabetic retinopathy; PDR: proliferative diabetic retinopathy; BMI: body mass index; HbA1c: glycated hemoglobin A1c; TC: total cholesterol; TG: triglycerides; HDL-C: high-density lipoprotein; LDL-C: low-density lipoprotein. * represents the comparison between the diabetic group or the nonproliferative diabetic retinopathy group and the proliferative diabetic retinopathy group. *P < 0.05.

[0264] Example 2 Bioinformatics Analysis of Differentially Expressed CircRNAs

[0265] In order to better understand the biological functions of differentially expressed CircRNAs between diabetic retinopathy patients and diabetic patients, the present invention performed GO and KEGG analysis on these differentially expressed CircRNAs.

[0266] The top 15 pathways enriched in diabetic retinopathy patients were mainly related to biological processes, molecular functions, and cellular components. In terms of molecular function, guanine nucleotide exchange factor activity and Ras guanine nucleotide exchange factor activity were the most enriched (see Appendix). Figure 2 ).

[0267] These enriched signaling pathways were related to plasma membrane, extracellular matrix components, proteinaceous extracellular matrix and extracellular matrix (Appendix Figure 2 The biological functions with the highest enrichment levels included multicellular biological processes, single-cell biological processes, and the movement of cellular or subcellular components, all of which were related to cell growth and proliferation. In addition, KEGG pathway analysis showed that the 15 pathways with the highest enrichment levels in patients with diabetic retinopathy compared with those in patients with diabetes (see Appendix). Figure 3 Specifically, these differentially expressed circRNAs were mainly concentrated in ECM-receptor interactions and molecular adhesion, which are closely related to the mechanism of microvascular dysfunction in the development of DR.

[0268] Example 3 Validation of biomarkers

[0269] The expression level of circ_0053004 was further detected in samples from clinical patients by qRT-PCR to verify its effectiveness as a DR biomarker. The present invention extracted and separated the patient's peripheral blood mononuclear cells and aqueous humor samples. The clinical characteristics of the patients are as follows (Table 3 and Table 4). Figure 4As shown in Figure A, compared with diabetic patients, the relative expression level of circ_0053004 in peripheral blood mononuclear cells of diabetic retinopathy patients was significantly higher than that of diabetic patients (p<0.001). In order to better illustrate the effectiveness of circ_0053004 as a biomarker in the diagnosis of diabetic retinopathy, the present invention further verified the expression level of circ_0053004 in aqueous humor. The results showed that the expression level of circ_0053004 in aqueous humor of diabetic retinopathy patients was significantly upregulated (p<0.001) (Appendix Figure 4 B). At the same time, the present invention found that circ_0053004 was not only associated with DR, but also with the stage of DR. The expression level of circ_0053004 in PDR was significantly higher than that in non-proliferative diabetic retinopathy and diabetic patients (p < 0.001) (Appendix Figure 4 C). In different stages of non-proliferative diabetic retinopathy, the expression level of circ_0053004 in patients with severe NP diabetic retinopathy was higher than that in patients with mild NP diabetic retinopathy (p<0.05) (Appendix Figure 4 D).

[0270] Table 3. Demographic and clinical characteristics of the subjects in the confirmation cohort—RNA screening was further validated in aqueous humor (samples were derived from aqueous humor cells)

[0271]

[0272] The table above shows the RNA screened for validation in aqueous humor cells. Unless otherwise specified, data are expressed as mean ± SD. DM: diabetes mellitus; NPD: nonproliferative diabetic retinopathy; PDR: proliferative diabetic retinopathy; BMI: body mass index; HbA1c: glycated hemoglobin A1c; TC: total cholesterol; TG: triglycerides; HDL-C: high-density lipoprotein; LDL-C: low-density lipoprotein. * represents a comparison between healthy patients or diabetic patients and patients with diabetic retinopathy. *P < 0.05.

[0273] Table 4. Diagnostic value of the biomarker hsa_circ_0053004 in peripheral blood mononuclear cells of patients with different stages of diabetic retinopathy - Analysis of the diagnostic efficacy of biomarkers in peripheral blood mononuclear cells

[0274]

[0275]

[0276] Example 4 Diagnostic Value of circ_0053004 in Peripheral Blood Mononuclear Cells of Patients with Diabetic Retinopathy

[0277] Receiver operating characteristic (ROC) curve analysis was used to evaluate the diagnostic value of circ_0053004 in peripheral blood mononuclear cells of patients with diabetic retinopathy. The results showed that the AUC between DR and diabetic patients was 0.9023 (95% CI, 0.8243-0.9804) (Appendix Figure 5 The present invention further considered whether circ_0053004 could be used as an early diagnostic biomarker to distinguish DR. ROC analysis showed that the AUC of circ_0053004 between patients with non-proliferative diabetic retinopathy and those with diabetes was 0.8876 (95% CI, 0.7991-0.9760), and the AUC of circ_0053004 for diagnosing early DR was 0.8693 (95% CI, 0.7671-0.9716). Due to its high AUC, sensitivity, and specificity, circ_0053004 was selected as a diagnostic biomarker for early DR and DR.

[0278] Receiver operating characteristic (ROC) analysis was used to evaluate the clinical diagnostic efficacy of hsa_circ_0053004 in peripheral blood mononuclear cells of DR patients. The area under the ROC curve (AUC) can reflect the accuracy of the diagnostic model. The results of ROC analysis are as follows (Figure 6): the AUC between the DR group and the DM group was 0.8123 (95% CI, 0.7159-0.9086); the AUC between the PDR group and the DM group was 0.9261 (95% CI, 0.7962-1.0000); the AUC between the NPDR group and the DM group was 0.7913 (95% CI, 0.6842-0.8984); the AUC between the mild NPDR group and the DM group was 0.7143 (95% CI, 0.5306-0.8980); the AUC between the moderate NPDR group and the DM group was 0.7600 (95% CI, 0.6298-0.8902); and the AUC between the severe NPDR group and the DM group was 0.9409 (95% CI, 0.8438-1.000) (Table 4). These results showed that hsa_circ_0053004 showed good AUC, specificity, and sensitivity in the diagnosis of DR at different stages.

[0279] Therefore, hsa_circ_0053004 demonstrated excellent potential for diagnosing different stages of DR. In particular, the AUCs exceeded 0.9 between the PDR and DM groups, and between severe NPDR and DM groups, further confirming the excellent discriminatory power of hsa_circ_0053004 for the severe stages of DR. The receiver operating characteristic (ROC) curves are shown in Figure 6.

[0280] Example 5 Downregulation of circ_0053004 can alleviate microvascular dysfunction in hRMECs treated with HG

[0281] When hRMECs were exposed to a range of glucose concentrations for 24 h, the cell viability was highest at 20 mM glucose (Supplementary Figure 2). Figure 7 A). In hRMECs treated with high glucose, the expression of circ_0053004 was significantly increased (Appendix Figure 7 B). After transfection of circ_0053004 siRNA, the expression of circ_0053004 in hRMECs was significantly reduced (Appendix Figure 7 C). Under high glucose stimulation, relative cell migration and tube formation abilities increased significantly. However, circ_0053004 siRNA reversed relative cell migration and tube formation abilities (Appendix Figure 7 D-7E). Therefore, downregulation of circ_0053004 can alleviate the microvascular dysfunction of hRMECs induced by high glucose.

Claims

1. Use of a reagent for detecting biomarker expression levels in the preparation of a product for early diagnosis of type 2 diabetic retinopathy, characterized in that: The biomarker is hsa_circ_0053004, and the nucleotide sequence of hsa_circ_0053004 is shown in SEQ ID No.

1.

2. The use according to claim 1, characterized in that The early diagnosis product includes an early diagnosis reagent or an early diagnosis kit.

3. The use according to claim 2, characterized in that The early diagnosis product also includes an amplification primer pair for amplifying the biomarker, an internal reference gene GAPDH primer, and an amplification system.

4. The use according to claim 3, characterized in that The amplification primer pair includes an upstream primer and a downstream primer. The nucleotide sequence of the upstream primer is shown in SEQ ID No. 2, and the nucleotide sequence of the downstream primer is shown in SEQ ID No.

3.

5. The use according to claim 3, characterized in that The nucleotide sequence of the upstream primer of the internal reference gene GAPDH is shown in SEQ ID NO.4, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.

5.

6. The use according to claim 3, characterized in that The amplification system is a real-time fluorescence quantitative PCR amplification system, which includes Ex Taq enzyme, dNTP Mixture, Mg 2+ , TliR NaseH and TB Green.

7. The use according to claim 1, characterized in that The diabetic retinopathy is proliferative diabetic retinopathy.