A recombinant genetically engineered bacterium producing phytosphingosine and its preparation method and use

Abstract

The present invention provides a recombinant genetically engineered bacterium for producing phytosphingosine, and its preparation method and use, belonging to the field of genetic recombination fermentation technology. The recombinant genetically engineered bacterium of the present invention is obtained by overexpressing the serine palmitoyltransferase LCB1 gene, LCB2 gene, tsc3 gene, 3-dehydrodihydrosphingosine reductase tsc10 gene, sphingosine hydroxylase sur2 gene, serine integrin tms1 gene, phosphoglycerate dehydrogenase ser3 gene in the genome of Saccharomyces cerevisiae, and knocking out the sphingosine kinase phospho-LCB4 gene, ceramide synthase LAG1 gene and LAC1 gene, LDB16 gene, sphingolipid homeostasis protein orm1 gene and orm2 gene, L-serine deaminase CHA1 gene, L-serine hydroxymethyltransferase SHM1 gene and SHM2 gene, and fatty acid elongase elo2 gene. The method for producing phytosphingosine using the recombinant genetically engineered bacterium is cost-effective, simple and efficient, with high phytosphingosine yield, and suitable for practical promotion and application.

Description

Technical Field

[0001] The present invention belongs to the technical field of gene recombination fermentation, and in particular relates to a recombinant genetic engineering bacterium producing phytosphingosine, a preparation method and application thereof. Background Art

[0002] Sphingolipids are lipids composed of two major groups: fatty acids and sphingosine. Depending on the attached side chains, they are primarily classified into ceramides, sphingomyelins, and glycosphingolipids. Ceramides within these groups form a network structure in the stratum corneum, maintaining skin moisture. Ceramides with phytosphingosine as their base chain are the most susceptible to loss. However, phytosphingosine is a key precursor to ceramides in moisturizing skincare products. Therefore, the cosmetics industry favors the addition of phytosphingosine-derived ceramides to develop a variety of popular commercial products.

[0003] Currently, phytosphingosine has been approved by the China National Medical Products Administration and is widely used in high-end skincare products. However, phytosphingosine is primarily found in seeds of plants like wheat. Its content is extremely low, making its extraction extremely difficult. It is known as "soft gold of plants." Extracting phytosphingosine from plant seeds is difficult, resulting in low yields and insufficient supply to meet current market demand.

[0004] Another method for producing phytosphingosine is to synthesize it through microbial synthesis. This method offers lower costs, shorter production cycles, and, most importantly, greater access to raw materials. In 1956, while isolating a haploid strain of the non-model strain Pichia ciferrii (Wickham's yeast), it was unexpectedly discovered that it could produce tetraacetyl phytosphingosine (TAPS), an acetylated product of phytosphingosine. However, tetraacetyl phytosphingosine requires alkaline deacetylation to obtain phytosphingosine.

[0005] Currently, phytosphingosine can be directly synthesized by fermentation through bacterial strain modification. For example, the U.S. patent application with publication number US20180179562 describes the synthesis of phytosphingosine in Saccharomyces cerevisiae, with a shake flask yield of 70 mg / L. The Chinese patent application with publication number CN116103176A describes genetic modification of Saccharomyces cerevisiae strains, ultimately achieving a phytosphingosine yield of 2.817 g / L in a 5L fermenter. Therefore, the simple method of obtaining phytosphingosine through direct microbial fermentation will become the preferred method for large-scale production of phytosphingosine in the future.

[0006] However, prior art methods for directly producing phytosphingosine using modified strains of Saccharomyces cerevisiae suffer from relatively low yields, making them unsuitable for industrial production and requiring further strain modification. Therefore, research is needed to develop strains that are more effective in producing phytosphingosine. Summary of the Invention

[0007] The purpose of the present invention is to provide a recombinant genetic engineering bacterium producing phytosphingosine and a preparation method and use thereof.

[0008] The invention provides a recombinant genetically engineered bacterium for producing phytosphingosine. The bacterium is obtained by overexpressing a serine palmitoyltransferase LCB1 gene, a LCB2 gene, a tsc3 gene, a 3-dehydrodihydrosphingosine reductase tsc10 gene, a sphingosine hydroxylase sur2 gene, a serine integrin tms1 gene, and a phosphoglycerate dehydrogenase ser3 gene in the genome of Saccharomyces cerevisiae, and knocking out a sphingosine kinase phosphate LCB4 gene, a ceramide synthase LAG1 gene and a LAC1 gene, a LDB16 gene, a sphingolipid homeostasis protein orm1 gene and an orm2 gene, an L-serine deaminase CHA1 gene, an L-serine hydroxymethyltransferase SHM1 gene and a SHM2 gene, and a fatty acid elongase elo2 gene.

[0009] Furthermore, the aforementioned recombinant genetically engineered bacteria inserts the expression cassettes of the serine palmitoyltransferase LCB1 gene and the LCB2 gene at the sites where the LCB4 gene and orm2 gene are knocked out in the genome of Saccharomyces cerevisiae, inserts the expression cassette of the tsc3 gene and the 3-dehydrodihydrosphingosine reductase tsc10 gene at the site where the LAG1 gene is knocked out, inserts the expression cassette of the sphingosine hydroxylase sur2 gene at the site where the LAC1 gene is knocked out, and inserts the expression cassette of the phosphoglycerate dehydrogenase ser3 gene and the serine integrin tms1 gene at the site where the elo2 gene is knocked out.

[0010] Furthermore, the expression cassette of the serine palmitoyltransferase LCB1 gene includes a Gal10 promoter, a serine palmitoyltransferase LCB1 gene, and a CYC1 terminator; the expression cassette of the serine palmitoyltransferase LCB2 gene includes a Gal1 promoter, a serine palmitoyltransferase LCB2 gene, and a TEF1 terminator; the expression cassette of the tsc3 gene includes a Gal10 promoter, a tsc3 gene, and a CYC1 terminator; the expression cassette of the 3-dehydrodihydrosphingosine reductase tsc10 gene includes a Gal10 promoter, a tsc3 gene, and a CYC1 terminator; 1 promoter, 3-dehydrodihydrosphingosine reductase tsc10 gene and TEF1 terminator, the expression cassette of sphingosine hydroxylase sur2 gene includes Gal1 promoter, sphingosine hydroxylase sur2 gene and TEF1 terminator, the expression cassette of phosphoglycerate dehydrogenase ser3 gene includes Gal1 promoter, phosphoglycerate dehydrogenase ser3 gene and TEF1 terminator, the expression cassette of serine integrin tms1 gene includes Gal10 promoter, serine integrin tms1 gene and CYC1 terminator;

[0011] The nucleotide sequence of the Gal1 promoter is shown in SEQ ID NO: 1, the nucleotide sequence of the Gal10 promoter is shown in SEQ ID NO: 2, the nucleotide sequence of the CYC1 terminator is shown in SEQ ID NO: 3, and the nucleotide sequence of the TEF1 terminator is shown in SEQ ID NO: 4.

[0012] Furthermore, the serine palmitoyltransferase LCB1 gene, LCB2 gene, tsc3 gene, 3-dehydrosphingosine reductase tsc10 gene, sphingosine hydroxylase sur2 gene, serine integrin tms1 gene, and phosphoglycerate dehydrogenase ser3 gene are all from Saccharomyces cerevisiae S288c.

[0013] Furthermore, the recombinant genetically engineered bacteria does not contain the following genes: sphingosine kinase phosphate LCB4 gene, ceramide synthase LAG1 gene and LAC1 gene, LDB16 gene, sphingolipid homeostasis protein orm1 gene and orm2 gene, L-serine deaminase CHA1 gene, L-serine hydroxymethyltransferase SHM1 gene and SHM2 gene, fatty acid elongase elo2 gene.

[0014] Furthermore, the sphingosine kinase phosphate LCB4 gene (NCBI-GeneID: 854342), sphingolipid homeostasis protein orm2 gene (NCBI-GeneID: 851064), serine palmitoyltransferase LCB1 gene (NCBI-GeneID: 855342) and LCB2 gene (NCBI-GeneID: 851634), ceramide synthase LAG1 gene (NCBI-GeneID: 856386) and LAC1 gene (NCBI-GeneID: 853861), tsc3 gene (NCBI- The expression cassettes for the 3-dehydrodihydrosphingosine reductase tsc10 gene (NCBI-GeneID: 852568), sphingosine hydroxylase sur2 gene (NCBI-GeneID: 851891), fatty acid elongase elo2 gene (NCBI-GeneID: 850400), phosphoglycerate dehydrogenase ser3 gene (NCBI-GeneID: 856814), and serine integrator tms1 gene (NCBI-GeneID: 851682) were all from Saccharomyces cerevisiae S288c.

[0015] Furthermore, the recombinant genetically engineered bacteria does not contain the following genes: sphingosine kinase phosphate LCB4 gene, ceramide synthase LAG1 gene and LAC1 gene, LDB16 gene, sphingolipid homeostasis protein orm1 gene (NCBI-GeneID: 852926) and orm2 gene, L-serine deaminase CHA1 gene (NCBI-GeneID: 850295), L-serine hydroxymethyltransferase SHM1 gene (NCBI-GeneID: 852565) and SHM2 gene (NCBI-GeneID: 850747), fatty acid elongase elo2 gene;

[0016] Furthermore, the sphingosine kinase phosphate LCB4 gene, ceramide synthase LAG1 gene and LAC1 gene, LDB16 gene, sphingolipid homeostasis protein orm1 gene and orm2 gene, L-serine deaminase CHA1 gene, L-serine hydroxymethyltransferase SHM1 gene and SHM2 gene, and fatty acid elongase elo2 gene are all from Saccharomyces cerevisiae S288c.

[0017] Furthermore, the cerevisiae yeast is cerevisiae S288c.

[0018] Furthermore, the cerevisiae Saccharomyces cerevisiae S288c is obtained from soil screening.

[0019] Furthermore, the transformation of the recombinant genetically engineered bacteria is accomplished using the CRISPR Cas9 yeast genome editing method.

[0020] The present invention also provides the use of the aforementioned recombinant genetically engineered bacteria in producing phytosphingosine.

[0021] The present invention also provides a method for producing phytosphingosine, which comprises the following steps:

[0022] The aforementioned recombinant genetically engineered strain was inoculated into a YPD seed medium, cultured overnight at 25-30° C. and 100-200 rpm, transferred to a YPD fermentation medium, and fermented at 25-30° C. and 100-200 rpm for 4-10 days. After the fermentation, the cells were collected by centrifugation, ground, and extracted with methanol to obtain phytosphingosine.

[0023] The seed culture medium and fermentation liquid are formulated as follows: 15-20 g / L of peptone, 5-10 g / L of yeast powder, 10-30 g / L of glucose, and the balance being water.

[0024] Furthermore, the formula of the seeds and fermentation medium is: 20g / L peptone, 10g / L yeast powder, 20g / L glucose, and the balance is water.

[0025] Gal1 nucleotide sequence (SEQ ID NO: 1):

[0026] TGTGCCTCGCGCCGCACTGCTCCGAACAATAAAGATTCTACAATACTAGCTTTTATGGGTTATGAAGAGGAAAAATTGGCAGTAACCTGGCCCCACAAACCTTCAAATGAACGAATCAAATTAACAACCATAGGATGATAATGCGATTAGTTTTTTAGCCTTATTTCTGGGGTAATTA ATCACGAAGCGATGATTTTTGATCTATTAACAGATATATAAATGCAAAAACTGCATAACCACTTTAACTAATACTTTCAACATTTTCGGTTTGTATTACTTCTTATTCAAATGTAATAAAAGTATCAACAAAAAATTGTTAATATACCTCTATACTTTAACGTCAAGGAGAAAAAAC

[0027] Gal10 nucleotide sequence (SEQ ID NO: 2):

[0028] TTTTCAAAAATTCTTACTTTTTTTTTGGATGGACGCAAAGAAGTTTAATAATCATATTACATGGCATTACCACCATATACATATCCATATACATATCCATATCTAATCTTACTTATATGTTGTGGAAATGTAAAGAGCCCCATTATCTTAGCCTAAAAAAACCTTCTCTTTGGAACTTTCAGTAATACGCTTAACTGCTCATTGCTATATTGAAGTACGGATTAGAAGCCGCCGAGCGGGTGACAGCCCTCCGAAGGAAGACTCTCCTCCGTGCGTCCTCGTCTTCACCGGTCGCGTTCCTGAAACGCAGA

[0029] CYC1 terminator nucleotide sequence (SEQ ID NO:3):

[0030] ATCCGCTCTAACCGAAAAGGAAGGAGTTAGACAACCTGAAGTCTAGGTCCCTATTTATTTTTTTATAGTTATGTTAGTATTAAGAACGTTATTTATATTTCAAATTTTTCTTTTTTTTCTGTACAGACGCGTGTACGCATGTAACATTATACTGAAAACCTTGCTTGAGAAGGTTTTGGGACGCTCGAAG

[0031] TEF1 terminator nucleotide sequence (SEQ ID NO:4):

[0032] CTGAATTGGAGCGACCTCATGCTATACCTGAGAAAGCAACCTGACCTACAGGAAAGAGTTACTCAAGAATAAGAATTTTCGTTTTAAAACCTAAGAGTCACTTTAAAATTTGTATACACTTATTTTTTTTATAACTTATTTAATAATAAAAATCATAAATCATAAGAAATTCGCTTATTTAGAAGTGTCAACAACGTATCTACCAACGATTTGACCCTTTTCCATCTTTTCGTAAATTTCTGGCAAGGTAGACAAGCCGACAACCTTGATTGGAGACTTGACCAAACCTCTGGCGAAGAATT<0​The present invention realizes the synthesis of sphingolipid derivatives such as phytosphingosine in the model organism Saccharomyces cerevisiae, including overexpression of key synthesis pathways, knockdown of the precursor serine degradation pathway and increase of its flux, and knockout of key genes in the phytosphingosine degradation pathway, thereby obtaining an engineered strain with high intracellular phytosphingosine production.

[0034] Compared with the prior art, the present invention has the following beneficial effects:

[0035] The present invention provides a recombinant genetically engineered bacterium that produces phytosphingosine. The method for producing phytosphingosine using the recombinant genetically engineered bacterium is cost-effective, simple in process and highly efficient, with a high yield of phytosphingosine (the yield after 4 days of fermentation is as high as 0.85 g / L), and is suitable for practical promotion and application.

[0036] Obviously, based on the above contents of the present invention, according to common technical knowledge and customary means in this field, without departing from the above basic technical ideas of the present invention, other various forms of modifications, replacements or changes can be made.

[0037] The following further describes the above content of the present invention in detail through specific embodiments in the form of examples. However, this should not be construed as limiting the scope of the above subject matter of the present invention to the following examples. All technologies implemented based on the above content of the present invention fall within the scope of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 Metabolic diagram of phytosphingosine biosynthesis.

[0039] Figure 2 The results of phytosphingosine content of each recombinant Saccharomyces cerevisiae engineered strain after 4 days of fermentation. DETAILED DESCRIPTION

[0040] Unless otherwise specified, the raw materials and equipment used in the specific embodiments of the present invention are all known products and are obtained by purchasing commercial products.

[0041] The Saccharomyces cerevisiae used in the present invention is Saccharomyces cerevisiae S288c.

[0042] Example 1: Construction of recombinant genetically engineered bacteria producing phytosphingosine

[0043] The steps for constructing recombinant genetically engineered bacteria in this embodiment are as follows:

[0044] (1) The Crispr Cas9 knockout system was used to edit the sphingosine kinase phosphate LCB4 gene, ceramide synthase LAG1 gene and LAC1 gene in the Saccharomyces cerevisiae genome. The corresponding p426 linear fragment with 20 bp sgRNA was amplified by PCR using primers p426-LCB4-F / P426-R, p426-LAG1-F / P426-R, and p426-LAC1-F / P426-R, all with p426 vector as template (purchased from Addgene, catalog number #68060); the three PCR products were detected by 1.0% agarose gel electrophoresis and purified with a clean-up kit; the three recovered DNAs were transformed into E. coli DH5a, and obtain the transformation product; the transformation product was spread on LB solid medium (containing a final concentration of 100 mg / L ampicillin), and the culture was shaken at 37°C and 220 rpm for 12-16 hours, and then the plasmid was extracted for sequencing verification. The verification primer was P426yz-1, and then the recombinant plasmids p426-sgRNA-LCB4, p426-sgRNA-LAG1, and p426-sgRNA-LAC1 were obtained after verification. The 20 bp sgRNA nucleotide sequence in p426-sgRNA-LCB4 is the italicized bold portion of the primer p426-LCB4-F; the 20 bp in p426-sgRNA-LAG1 The sgRNA nucleotide sequence is shown in bold italics in primer p426-LAG1-F; the 20-bp sgRNA nucleotide sequence in p426-sgRNA-LAC1 is shown in bold italics in primer p426-LAC1-F. The corresponding primers are listed in Table 1.

[0045] (2) To construct the Donor fragment, the Saccharomyces cerevisiae genome was used as a template. PCR was performed using primers LCB4-upF / LCB4-upR, LCB4-downF / LCB4-downR, LAG1-upF / LAG1-upR, LAG1-downF / LAG1-downR, LAC1-upF / LAC1-upR, and LAC1-downF / LAC1-downR, respectively, to amplify the upper and lower 500 bp homology arms of the corresponding LCB4 gene, LAG1 gene, and LAC1 gene. The six PCR products were detected by 1.0% agarose gel electrophoresis and purified using a clean-up kit. The corresponding primers are listed in Table 1.

[0046] (3) Construction of a Saccharomyces cerevisiae strain containing the P414-cas9 vector; a small amount of bacterial liquid was dipped into an inoculation stick from the Saccharomyces cerevisiae S288c stored in a glycerol tube, streaked onto a YPD solid plate, and placed in a 30°C incubator for 48 h; a single colony was picked and inoculated into 5 mL of YPD liquid culture medium, and placed in a 30°C, 200 rpm incubator overnight until the OD 600 The pH value was 0.8-1; the culture medium was taken out and a commercial yeast preparation competent state kit (purchased from Zymo Research, product number T2001) was used to prepare a Saccharomyces cerevisiae competent state; then P414-cas9 (purchased from Addgene, product number #43802) was transformed into the Saccharomyces cerevisiae competent state, and the culture was placed at 30°C and cultured on a shaker at 200 rpm for 3 hours. The culture medium was then applied to SC-trp solid culture medium and cultured in a 30°C incubator for 48 hours to obtain a Saccharomyces cerevisiae strain containing the P414-cas9 vector.

[0047] (4) The Saccharomyces cerevisiae strain containing the P414-cas9 vector was cultured in SC-trp medium at 30°C overnight until the OD 600When the p-value reaches 0.8-1.0, the bacterial liquid is centrifuged to obtain bacterial cells, and then a commercial yeast competent cell preparation kit is used to prepare competent cells. The prepared p426-sgRNA and the corresponding donor (upper and lower homology arms + expression cassette of the inserted gene) are added to the competent cells, and then solution 3 in the kit is added. The cells are cultured at 30°C and 200rpm for 1 hour, and then spread onto SC-trp-ura double-deficient culture plates (the SC-trp-ura powder is purchased from Panjinuo, product number YGM003A-31) and cultured at 30°C for 48 hours. Several single colonies are picked from the plate as templates, and PCR is performed with the corresponding verification primers (the corresponding primers in Table 1 are LCB4YZ-1 / LCB4-downR, LAC1YZ-1 / LAC1-downR, and LAG1YZ-1 / LAG1-downR), and the gene deletion is confirmed by observing whether there is a correct DNA band in a 1.0% agarose gel. The strain in which the genes encoding sphingosine kinase phosphate LCB4, ceramide synthase LAG1 and LAC1 were successfully knocked out was inoculated into 5 mL of YPD liquid culture medium and cultured in a 30°C incubator overnight. The culture medium was then spread or streaked onto an SC-trp plate containing 5FOA (the SC-trp powder was purchased from Panjinuo, product number YGM003A-2). The single colonies that grew were again verified on SC-ura (the SC-ura powder was purchased from Panjinuo, product number YGM003A-3) to verify whether the p426-sgRNA vector was removed. If no plasmid grows on SC-ura, the plasmid has been eliminated. Finally, the p414-cas9 plasmid is eliminated by self-passage, and the p426-sgRNA plasmid is inoculated into YPD medium for overnight culture. Then, it is streaked onto YPD plates and cultured for 24-48 hours. The corresponding single colonies are verified on the plate. As long as the single colony does not grow on the SC-trp-ura double-deficient medium, it is the target strain that has successfully knocked out both plasmids.

[0048] (5) According to the above gene knockout steps, the LCB4 gene, LAG1 gene and LAC1 gene were knocked out in the genome in sequence. The strains constructed in this way were recorded as Saccharomyces cerevisiae Sc△LCB4 (abbreviated as Sc01), Sc△LCB4△LAG1 (abbreviated as Sc02) and Sc△LCB4△LAG1△LAC1 (abbreviated as Sc03).

[0049] Example 2: Preparation and determination of phytosphingosine

[0050] (1) Preparation method

[0051] The three recombinant Saccharomyces cerevisiae engineered strains constructed in Example 1 and the control strain (i.e., the starting strain S.cerevisiae S288c) were inoculated into YPD seed culture medium for culture, and cultured on a shaker at 30°C and 200rpm for 12 to 16 hours to obtain seed liquid; the mixture was transferred to 50mL YPD fermentation medium at 2% (v / v) for fermentation, and cultured on a shaker at 30°C and 200rpm for 4 days. After the fermentation was completed, the fermentation liquid was centrifuged, the supernatant was removed, 10mL of methanol was added, and the mixture was ground and crushed to obtain phytosphingosine. The fermentation process of phytosphingosine synthesis and metabolism process is shown in FIG. Figure 1 .

[0052] The formula of YPD fermentation medium is: 20 g / L tryptone, 10 g / L yeast powder, 20 g / L glucose, and the balance is water.

[0053] (2) Determination of phytosphingosine

[0054] Standard sample preparation: Prepare 10 g / L phytosphingosine standard and dilute it to concentrations of 0.5, 1, 2, 4, and 6 g / L, respectively. Pass 1 mL of the diluted standard sample through the membrane for testing.

[0055] Sample preparation: Take 1 mL of fermentation broth and centrifuge at 12000 rpm for 5 minutes, remove the supernatant, add 1 mL of methanol, and then add an appropriate amount of white zirconium beads. Use a crushing instrument to crush the beads. After crushing, centrifuge at 12000 rpm for 5 minutes, and take the methanol supernatant for testing.

[0056] LC-MS detection method: LC part: Agilent 1260DAD detector; Agilent SB-C 18 (2.1mm*50mm, 1.8μm) chromatographic column; mobile phase A: 30% 0.1% TFA aqueous solution and mobile phase B: 70% acetonitrile for isocratic elution; MS part: ESI ion source, SIM scanning mode, positive ion mode.

[0057] Detect the content of phytosphingosine in the fermentation broth obtained by recombinant fermentation of each recombinant Saccharomyces cerevisiae engineered strain. Figure 2 .Depend on Figure 2 After 4 days of shake flask fermentation, the three recombinant strains all produced higher yields than the control strain, S. cerevisiae S288c (no phytosphingosine was detected in the control strain), with strain Sc03 producing the highest yield, 0.051 g / L. These results suggest that blocking the degradation pathways of intermediates and phytosphingosine promotes phytosphingosine accumulation; however, the final phytosphingosine yield remains very low, likely due to a weak metabolic flux in the primary pathway.

[0058] Example 3: Construction of recombinant genetically engineered bacteria producing phytosphingosine

[0059] The steps for constructing recombinant genetically engineered bacteria in this embodiment are as follows:

[0060] (1) The Crispr Cas9 knockout system was used to integrate the LCB1 gene, LCB2 gene, tsc3 gene, tsc10 gene and sur2 gene into the genome of the initial strain of Saccharomyces cerevisiae S288c. The insertion sites selected were the three gene (LCB4, LAG1, LAC1) knockout sites in Example 1, and the corresponding p426-sgRNA used was the same as that shown in Example 1.

[0061] (2) To construct the Dnonr fragment, the Saccharomyces cerevisiae genome was used as a template and PCR amplified using primers LCB1-F / LCB1-R, LCB2-F / LCB2-R, tsc3-F / tsc3-R, tsc10-F / tsc10-R, and sur2-F / sur2-R to obtain fragments LCB1, LCB2, tsc3, tsc10, and sur2, respectively. These five PCR products were then detected by 1.0% agarose gel electrophoresis and purified using a clean-up kit.

[0062] Finally, the purified LCB1 and tsc3 fragments were cloned in one step with the BBS17 plasmid linearized with primers Gal10-F / Gal10-R (see Chinese patent application publication number CN116716196A for the circular BBS17 plasmid map), and then transformed into E. coli DH5a to obtain transformation products. The transformation products were spread on LB solid medium (containing a final concentration of 100 mg / L ampicillin) and cultured in shake flasks at 37°C and 220 rpm for 12-16 hours. After that, the plasmids were extracted and sequenced for verification. If the verification was correct, the recombinant plasmids BBS17-tCYC1-LCB1-pGal10 (abbreviated as BBs17-LCB1) and BBS17-tCYC1-tsc3-pGal10 (abbreviated as BBs17-tsc3) were obtained.

[0063] The three plasmids constructed above (BBs17-LCB1, BBs17-tsc3 and circular BBs17) were used as templates and primers Gal1-F / Gal1-R were used to PCR amplify the linearized vectors BBs17-LCB1, BBs17-tsc3 and BBs17. Then, the linearized vectors BBs17-LCB1, BBs17-tsc3 and BBs17 were cloned with the corresponding fragments LCB2, tsc10 and sur2 respectively and then transformed into E. coli. DH5a, and obtain the transformation product; the transformation product was spread on LB solid medium (containing a final concentration of 100 mg / L ampicillin), and cultured in a shake flask at 37°C and 220 rpm for 12-16 hours, after which the plasmid was extracted and sequenced for verification. If the verification was correct, the recombinant plasmids BBS17-tCYC1-LCB1-pGal10-pGal1-LCB2-tTEF1 (abbreviated as BBs17-LCB12), BBS17-tCYC1-tsc3-pGal10-pGal1-tsc10-tTEF1 (abbreviated as BBs17-tsc3-10), and BBS17-pGal l1-sur2-tTEF1 (abbreviated as BBs17-sur2); finally, the recombinant plasmids BBs17-LCB12, BBs17-tsc3-10 and BBs17-sur2 were PCR amplified using primers TF / TR to obtain fragments tCYC1-LCB1-pGal10-pGal1-LCB2-tTEF1, tCYC1-tsc3-pGal10-pGal1-tsc10-tTEF1 and pGal1-sur2-tTEF1. The three PCR products were detected by 1.0% agarose gel electrophoresis and purified using a clean-up kit.

[0064] Using the Saccharomyces cerevisiae genome as a template, primers LCB4-upF / LCB4-upR1, LCB4-downF1 / LCB4-downR, LAG1-upF / LAG1-upR1, LAG1-downF1 / LAG1-downR, LAC1-upF / LAC1-upR1, and LAC1-downF1 / LAC1-downR were used to amplify the upper and lower 500-bp homology arms of LCB4, LAG1, and LAC1, respectively. The six PCR products were checked by 1.0% agarose gel electrophoresis and purified using a clean-up kit. The corresponding primers are listed in Tables 1 and 2.

[0065] (3) The prepared p426-sgRNA and the corresponding Donor (upper and lower homology arms + expression cassette of the inserted gene) were added to the competent yeast strain containing the P414-cas9 vector (prepared in the same manner as in Example 1), and then solution 3 in the kit was added and cultured at 30°C 200rpm for 1 hour, and then spread on the SC-trp-ura double-deficient culture dish and cultured at 30°C for 48 hours. Several single colonies were picked on the plate as templates, and PCR was performed with the corresponding verification primers (the corresponding primers LCB4YZ-1 / LCB4-downR, LAC1YZ-1 / LAC1-downR and LAG1YZ-1 / LAG1-downR in Table 1), and the gene deletion was confirmed by observing whether there was a correct DNA band in the 1.0% agarose gel. The strain that had been successfully replaced was removed from the two plasmids p426-sgRNA and p414-cas9 according to the method of Example 1, and finally the target strain with successful knockout of the two plasmids was obtained.

[0066] (4) According to the above gene insertion steps, the expression cassettes of the serine palmitoyltransferase LCB1 gene and the LCB2 gene were inserted into the LCB4 gene locus on the genome of the original strain of Saccharomyces cerevisiae, the expression cassettes of the tsc3 gene and the 3-dehydrodihydrosphingosine reductase tsc10 gene were inserted into the LAG1 gene locus, and the expression cassette of the sphingosine hydroxylase sur2 gene was inserted into the LAC1 gene locus. The recombinant strains finally obtained were Sc△LCB4::tCYC1-LCB1-pGal10-pGal1-LCB2-tTEF1△LAG1::tCYC1-tsc3-pGal10-pGal1-tsc10-tTEF1△LAC1::pGal1-sur2-tTEF1 (abbreviated as Sc04).

[0067] (5) The Crispr Cas9 knockout system was used to edit the orm1 and orm2 genes encoding the sphingolipid homeostasis proteins and the LDB16 gene in the Saccharomyces cerevisiae genome. PCR was performed using primers p426-orm1-F / P426-R, p426-orm2-F / P426-R, and p426-LDB16-F / P426-R, all with the p426 vector as a template, to amplify the corresponding p426 linear fragment with 20 bps gRNA; the three PCR products were detected by 1.0% agarose gel electrophoresis and purified with a clean-up kit; the three recovered DNAs were transformed into E. coli DH5a to obtain a transformation product; the transformation product was spread on LB solid medium (containing a final concentration of 100 mg / L ampicillin), and the culture was shaken at 37°C and 220 rpm for 12-16 h. After that, the plasmids were extracted and sequenced for verification. If the verification was correct, the recombinant plasmids p426-sgRNA-orm1, p426-sgRNA-orm2, and p426-sgRNA-LDB16 were obtained, wherein the 20 bp sgRNA nucleotide sequence in p426-sgRNA-orm1 is shown in the italicized bold portion of primer p426-orm1-F; the 20 bp sgRNA nucleotide sequence in p426-sgRNA-orm2 is shown in the italicized bold portion of primer p426-orm2-F; and the 20 bp sgRNA nucleotide sequence in p426-sgRNA-LDB16 is shown in the italicized bold portion of primer p426-LDB16-F. The corresponding primers are listed in Tables 1 and 2.

[0068] (6) To construct the Donor fragment, the Saccharomyces cerevisiae genome was used as a template. PCR was performed using the primers orm1-upF / orm1-upR, orm1-downF / orm1-downR, orm2-upF / orm2-upR, orm2-downF / orm2-downR, LDB16-upF / LDB16-upR, and LDB16-downF / LDB16-downR, respectively, to amplify the upper and lower 500 bp homology arms of the orm1 gene, orm2 gene, and LDB16 gene. The six PCR products were detected by 1.0% agarose gel electrophoresis and purified using a clean-up kit. The corresponding primers are listed in Table 2.

[0069] (7) The same knockout and screening method as in Example 1 was used to knock out the orm1 gene, orm2 gene, and LDB16 gene in the genome of strain Sc04 in sequence according to the above-mentioned gene knockout steps. The strains constructed in this way were designated as Saccharomyces cerevisiae Sc04△orm1 (abbreviated as Sc05), Sc04△orm1△orm2 (abbreviated as Sc06), and Sc04△orm1△orm2△LDB16 (abbreviated as Sc07).

[0070] Example 4. Preparation and determination of phytosphingosine

[0071] (1) Preparation method

[0072] The four recombinant Saccharomyces cerevisiae engineered strains (Sc04, Sc05, Sc06, and Sc07) constructed in Example 3, as well as a control strain (Sc03), were inoculated into YPD seed medium (medium composition was the same as in Example 2) and cultured in a shaking incubator at 30°C and 200 rpm for 12-16 hours to obtain a seed solution. The solution was then transferred to YPD fermentation medium at a 2% (v / v) concentration and cultured in a shaking incubator at 30°C and 200 rpm for 4 days. After fermentation, the fermentation broth was centrifuged, the supernatant removed, and 10 mL of methanol was added before grinding to obtain phytosphingosine.

[0073] (2) Determination of phytosphingosine

[0074] The detection and determination methods are the same as those in Example 2, except that the brewing engineering strains are the four brewing yeast engineering strains constructed in this example and the control strain Sc03; the content of phytosphingosine in the fermentation broth obtained by recombinant fermentation of each recombinant brewing yeast engineering strain is detected as follows: Figure 2 .Depend on Figure 2 It can be seen that after 4 days of shake flask fermentation, the maximum yield of the constructed Sc07 was found to be 0.24 g / L. The above results show that enhancing the expression of key enzymes related to the main pathway is beneficial to the accumulation of the target product; Figure 2 It can be seen that the Sc07 yield was further improved from 0.051g / L to 0.24g / L.

[0075] Example 5: Construction of recombinant genetically engineered bacteria producing phytosphingosine

[0076] The steps for constructing recombinant genetically engineered bacteria in this embodiment are as follows:

[0077] (1) The Crispr Cas9 knockout system was used for genomic gene integration, and multiple copies of LCB1 and LCB2 were inserted. The insertion sites were the two gene (orm2 and LDB16) knockout sites in Example 3, and the corresponding P426-sgRNA used was the same as that shown in Example 3.

[0078] (2) To construct the Dnonr fragment, plasmid BBs17-LCB12 was used as a template and primers TF / TR were used to amplify the fragment tCYC1-LCB1-pGal10-pGal1-LCB2-tTEF1. The PCR product was then detected by 1.0% agarose gel electrophoresis and purified with a clean-up kit for later use.

[0079] Simultaneously, using the Saccharomyces cerevisiae genome as a template, primers orm2-upF / orm2-upR1, orm2-downF1 / orm2-downR, LDB16-upF / LDB16-upR1, and LDB16-downF1 / LDB16-downR were used to amplify the upper and lower 500-bp homology arms of orm2 and LDB16, respectively. The four PCR products were checked by 1.0% agarose gel electrophoresis and purified using a clean-up kit. The corresponding primers are listed in Table 2.

[0080] (3) The prepared p426-sgRNA and the corresponding Donor (upper and lower homology arms + expression cassette of the inserted gene) were added to the competent Saccharomyces cerevisiae strain containing the P414-cas9 vector (prepared in the same manner as in Example 1), and then solution 3 in the kit was added and cultured at 30°C 200rpm for 1 hour. Then, the culture dish was spread on the SC-trp-ura double-deficient culture dish and cultured at 30°C for 48 hours. Several single colonies were picked on the plate as templates, and PCR was performed with the corresponding verification primers (the corresponding primers Orm2yz-1 / orm2-downR and LDB16YZ-1 / LDB16-downR in Table 2), and the gene deletion was confirmed by observing whether there was a correct DNA band in the 1.0% agarose gel. The strain that had been successfully replaced was removed from the two plasmids p426-sgRNA and p414-cas9 according to the method of Example 1, and finally the target strain with successful knockout of the two plasmids was obtained.

[0081] (4) According to the above gene insertion steps, the expression cassettes of the serine palmitoyltransferase LCB1 gene and the LCB2 gene were inserted into the orm2 gene and LDB16 gene loci on the Saccharomyces cerevisiae Sc07 genome, respectively. The recombinant strains finally obtained were Sc07△orm2::tCYC1-LCB1-pGal10-pGal1-LCB2-tTEF1 (abbreviated as Sc08) and Sc07△orm2::tCYC1-LCB1-pGal10-pGal1-LCB2-tTEF1

[0082] △LDB16::tCYC1-LCB1-pGal10-pGal1-LCB2-tTEF1 (abbreviated as Sc09).

[0083] Example 6. Preparation and determination of phytosphingosine

[0084] (1) Preparation method

[0085] The two recombinant Saccharomyces cerevisiae engineered strains constructed in Example 5 and a control strain (Sc07) were inoculated into YPD seed medium (medium composition was the same as in Example 2) and cultured in a shaking incubator at 30°C and 200 rpm for 12-16 hours to obtain a seed solution. The solution was then transferred to YPD fermentation medium at a 2% (v / v) concentration and cultured in a shaking incubator at 30°C and 200 rpm for 4 days. After fermentation, the fermentation broth was centrifuged, the supernatant removed, and 10 mL of methanol was added before grinding to obtain phytosphingosine.

[0086] (2) Determination of phytosphingosine

[0087] The detection and determination methods are the same as those in Example 2, except that the brewing engineering strains are two brewing yeast engineering strains constructed in this example and the control strain Sc07; the content of phytosphingosine in the fermentation broth obtained by recombinant fermentation is detected as follows: Figure 2 .Depend on Figure 2 It can be seen that after 4 days of shake flask fermentation, it was found that the constructed Sc08 had a higher yield than Sc09, and its yield could reach 0.38g / L; the above results show that moderate expression of LCB1 and LCB2 is beneficial to the metabolic balance in the bacteria, thereby promoting product accumulation.

[0088] Example 7: Construction of recombinant genetically engineered bacteria producing phytosphingosine

[0089] The steps for constructing recombinant genetically engineered bacteria in this embodiment are as follows:

[0090] (1) The Crispr Cas9 knockout system was used to knock out the L-serine deaminase CHA1 gene, L-serine hydroxymethyltransferase SHM1 gene and SHM2 gene, and fatty acid elongase elo2 gene in the Sc08 genome; using the p426 plasmid as a template, the corresponding p426 linear fragments with 20 bp sgRNA were amplified by PCR using primers p426-CHA1-F / P426-R, p426-SHM1-F / P426-R, p426-SHM2-F / P426-R, and p426-elo2-F / P426-R, respectively; the four PCR products were detected by 1.0% agarose gel electrophoresis and purified with a clean-up kit; the four recovered DNAs were transformed into E. coli DH5a, and obtain the transformation product; the transformation product was spread on LB solid medium (containing a final concentration of 100 mg / L ampicillin), and cultured in a shake flask at 37°C and 220 rpm for 12-16 h. After that, the plasmid was extracted and sequenced for verification. If the verification was correct, the recombinant plasmids p426-sgRNA-CHA1, p426-sgRNA-SHM1, p426-sgRNA-SHM2, and p426-sgRNA-elo2 were obtained. The 20-bp sgRNA nucleotide sequence in p426-sgRNA-CHA1 is shown in bold italics in primer p426-CHA1-F; the 20-bp sgRNA nucleotide sequence in p426-sgRNA-SHM1 is shown in bold italics in primer p426-SHM1-F; the 20-bp sgRNA nucleotide sequence in p426-sgRNA-SHM2 is shown in bold italics in primer p426-SHM2-F; and the 20-bp sgRNA nucleotide sequence in p426-sgRNA-elo2 is shown in bold italics in primer p426-elo2-F. The corresponding primers are listed in Tables 1 and 3.

[0091] (2) To construct the Donor fragment, the Saccharomyces cerevisiae genome was used as a template. PCR was performed using the primers CHA1-upF / CHA1-upR, CHA1-downF / CHA1-downR, SHM1-upF / SHM1-upR, SHM1-downF / SHM1-downR, SHM2-upF / SHM2-upR, SHM2-downF / SHM2-downR, elo2-upF / elo2-upR, and elo2-downF / elo2-downR, respectively, to amplify the upper and lower 500 bp homology arms of the corresponding CHA1 gene, SHM1 gene, SHM2 gene, and elo2 gene. The eight PCR products were detected by 1.0% agarose gel electrophoresis and purified using a clean-up kit. The corresponding primers are listed in Table 3.

[0092] (3) The prepared p426-sgRNA and the corresponding Donor (upper and lower homology arms) were added to the competent yeast strain containing the P414-cas9 vector (prepared in the same manner as in Example 1), and then solution 3 in the kit was added and cultured at 30°C 200rpm for 1 hour. Then, the solution was spread on the SC-trp-ura double-deficient culture dish and cultured at 30°C for 48 hours. Several single colonies were picked from the plate as templates, and PCR was performed with the corresponding verification primers (the corresponding primers CHA1YZ-1 / CHA1-downR, SHM1YZ-1 / SHM1-downR, SHM2YZ-1 / SHM2-downR and elo2yz-1 / elo2-downR in Table 3), and the gene deletion was confirmed by observing whether there was a correct DNA band in the 1.0% agarose gel. The strain that has been successfully replaced was used to remove the two plasmids p426-sgRNA and p414-cas9 according to the method of Example 1, and finally the target strain with successful knockout of the two plasmids was obtained.

[0093] (4) According to the above steps, the L-serine deaminase CHA1 gene, L-serine hydroxymethyltransferase SHM1 gene and SHM2 gene and fatty acid elongase elo2 gene were knocked out in the Saccharomyces cerevisiae Sc08 genome respectively. The recombinant strains finally obtained were Sc08△CHA1 (abbreviated as Sc10), Sc08△CHA1△SHM1 (abbreviated as Sc11), Sc08△CHA1△SHM1△SHM2 (abbreviated as Sc12) and Sc08△CHA1△SHM1△SHM2△elo2 (abbreviated as Sc13).

[0094] Example 8. Preparation and determination of phytosphingosine

[0095] (1) Preparation method

[0096] The four recombinant Saccharomyces cerevisiae engineered strains constructed in Example 7 and a control strain (Sc08) were inoculated into YPD seed medium (medium composition was the same as in Example 2) and cultured in a shaking incubator at 30°C and 200 rpm for 12-16 hours to obtain a seed solution. The solution was then transferred to YPD fermentation medium at a 2% (v / v) concentration and cultured in a shaking incubator at 30°C and 200 rpm for 4 days. After fermentation, the fermentation broth was centrifuged, the supernatant removed, and 10 mL of methanol was added before grinding to obtain phytosphingosine.

[0097] (2) Determination of phytosphingosine

[0098] The detection and determination methods are the same as those in Example 2, except that the brewing engineering strains are the four brewing yeast engineering strains constructed in this example and the control strain Sc08; the content of phytosphingosine in the fermentation broth obtained by recombinant fermentation is detected as follows: Figure 2 .Depend on Figure 2 It can be seen that by knocking out CHA1, SHM1 and SHM2 in the serine metabolic pathway, the strain Sc12 obtained had a significantly increased phytosphingosine production to 0.67 g / L after 4 days of shake flask fermentation. The yield of the strain Sc13 obtained by further knocking out elo2 was further improved, increasing by 92% compared with the control strain Sc08, reaching 0.73 g / L. The above results indicate that when the metabolic flux of the main pathway is sufficient, the supply of its precursor substances is the key to the production of phytosphingosine.

[0099] Example 9: Construction of recombinant genetically engineered bacteria producing phytosphingosine

[0100] The steps for constructing recombinant genetically engineered bacteria in this embodiment are as follows:

[0101] (1) The Crispr Cas9 knockout system was used for genomic gene integration. The serine integration protein tms1 gene and the phosphoglycerate dehydrogenase ser3 gene were integrated into the Sc13 genome. The insertion site was the elo2 gene knockout site in Example 7, and the corresponding P426-sgRNA used was the same as that shown in Example 7.

[0102] (2) To construct the Dnonr fragment, the Saccharomyces cerevisiae genome was used as a template and PCR amplified the fragments ser3 and tms1 using primers ser3-F / ser3-R and tms1-F / tms1-R, respectively. These two PCR products were then detected by 1.0% agarose gel electrophoresis and purified using a clean-up kit.

[0103] Finally, the purified tms1 fragment was linearized with the BBS17 plasmid using primers Gal10-F / Gal10-R (the map of the circular BBS17 plasmid can be found in Chinese patent application publication number CN116716196A), and then transformed into E. coli DH5a to obtain a transformation product. The transformation product was spread on LB solid medium (containing a final concentration of 100 mg / L ampicillin), cultured in a shake flask at 37°C and 220 rpm for 12-16 hours, and then the plasmid was extracted for sequencing verification. If the verification was correct, the recombinant plasmid BBS17-tCYC1-tms1-pGal10 (abbreviated as BBs17-tms1) was obtained.

[0104] Using BBs17-tms1 as a template, primers Gal1-F / Gal1-R were used to amplify the linearized vector BBs17-tms1, which was then cloned with the fragment ser3 in one step and then transformed into E. coli. DH5a, and obtain the transformation product; the transformation product was spread on LB solid medium (containing a final concentration of 100 mg / L ampicillin), and the plasmid was extracted and sequenced for verification after shaking at 37°C and 220 rpm for 12-16 h. If the verification was correct, the recombinant plasmid BBS17-tCYC1-tms1-pGal10-pGal1-ser3-tTEF1 (abbreviated as BBs17-tsc3-ser3) was obtained; using the above-constructed plasmid BBs17-tsc3-ser3 as a template, primers TF / TR were used to amplify the fragment tCYC1-tms1-pGal10-pGal1-ser3-tTEF1 by PCR, and the PCR product was detected by 1.0% agarose gel electrophoresis and purified with a clean-up kit.

[0105] Simultaneously, using the Saccharomyces cerevisiae genome as a template, primers elo2-upF / elo2-upR1 and elo2-downF1 / elo2-downR were used to amplify the upper and lower 500-bp homology arms of the elo2 gene, respectively. The two PCR products were checked by 1.0% agarose gel electrophoresis and purified using a clean-up kit. The corresponding primers are listed in Tables 2, 3, and 4.

[0106] (3) The prepared p426-sgRNA and the corresponding Donor (upper and lower homologous arms + expression cassette of the inserted gene) were added to the competent Saccharomyces cerevisiae strain containing the P414-cas9 vector (prepared in the same manner as in Example 1), and then solution 3 in the kit was added, cultured at 30°C 200rpm for 1 hour, and then spread on the SC-trp-ura double-deficient culture dish and cultured at 30°C for 48 hours. Several single colonies were picked on the plate as templates, and PCR was performed with the corresponding verification primers (the corresponding primers elo2yz-1 / elo2-downR in Table 3), and the gene deletion was confirmed by observing whether there was a correct DNA band in the 1.0% agarose gel. The strain that had been successfully replaced was removed from the two plasmids p426-sgRNA and p414-cas9 according to the method of Example 1, and finally the target strain with successful knockout of the two plasmids was obtained.

[0107] (5) According to the above gene insertion steps, the expression cassettes of the serine integration protein tms1 gene and the phosphoglycerate dehydrogenase ser3 gene were inserted into the elo2 gene site on the Sc13 genome of Saccharomyces cerevisiae in sequence, and the recombinant strain finally obtained was Sc13△elo2::tCYC1-tms1-pGal10-pGal1-ser3-tTEF1 (abbreviated as Sc14).

[0108] Example 10: Preparation and determination of phytosphingosine

[0109] (1) Preparation method

[0110] The recombinant Saccharomyces cerevisiae engineered strain Sc14 constructed in Example 9 was inoculated into YPD seed medium (medium components were the same as in Example 2) and cultured at 30°C, 200 rpm, and shaken for 12-16 hours to obtain a seed solution. The solution was then transferred to YPD fermentation medium at a 2% (v / v) concentration and cultured at 30°C, 200 rpm, and shaken for 4 days. After fermentation, the fermentation broth was centrifuged, the supernatant removed, and 10 mL of methanol was added before grinding to obtain phytosphingosine.

[0111] (2) Determination of phytosphingosine

[0112] The detection and determination methods are the same as those in Example 2, except that the brewing engineering strain is constructed using the brewing engineering strain (Sc14) of this example; the content of phytosphingosine in the fermentation broth obtained by recombinant fermentation is detected as follows: Figure 2 .Depend on Figure 2 It can be seen that after 4 days of shake flask fermentation, the yield of phytosphingosine reached 0.85 g / L; the above results indicate that increasing the supply of precursor substances is beneficial to the flow of carbon metabolism to the production of target products.

[0113] Table 1. Primers used in the experiment

[0114]

[0115]

[0116] Table 2. Primers used in the experiment

[0117]

[0118]

[0119] Table 3. Related primers used in the experiment

[0120]

[0121]

[0122] Table 4. Related primers used in the experiment

[0123] Primer name Primer sequence (5′-3′) SEQ ID NO: ser3-F CGTCAAGGAGAAAAAACCCCATGACAAGCATTGACATTAA 93 ser3-R AGCTAGCCGCGGTACCAAGC 94 tms1-F GTAAGAATTTTTGAAAATTCATGGGTGCCGTAATTTCTTT 95 tms1-R CATCCTTGTAATCCATCGATTTAATAGTAATTCTCGTAAT 96 elo2-upR1 ATGAGGTCGCTCCAATTCAGGGCTTCTAGACGAAGATAAT 97 elo2-downF1 ATTATCTTCGTCTAGAAGCCCTGAATTGGAGCGACCTCAT 98

[0124] In summary, the present invention provides a recombinant genetically engineered bacterium that produces phytosphingosine. The method for producing phytosphingosine using the recombinant genetically engineered bacterium is cost-effective, simple and efficient, and has a high yield of phytosphingosine (the yield after 4 days of fermentation is as high as 0.85 g / L), which is suitable for practical promotion and application.

Claims

1. A recombinant genetically engineered bacterium producing phytosphingosine, characterized in that: The recombinant genetically engineered bacteria overexpresses serine palmitoyltransferase in the genome of Saccharomyces cerevisiae LCB1 Gene, LCB2 Gene, tsc3 gene, 3-dehydrosphingosine reductase tsc10 gene, sphingosine hydroxylase sur2 gene, serine integrin tms1 gene, phosphoglycerate dehydrogenase ser3 gene and knock out sphingosine kinase phosphatase from the genome LCB4 gene, ceramide synthase LAG1 Genes and LAC1 Gene, LDB16 Gene, sphingolipid homeostasis protein orm1 Genes and orm2 gene, L-serine deaminase CHA1 gene, L-serine hydroxymethyltransferase SHM1 Genes and SHM2 Gene, fatty acid elongase elo2 Genetic The recombinant genetically engineered bacteria is a gene that is knocked out in the genome of Saccharomyces cerevisiae. LCB4 Serine palmitoyltransferase , SERPT LCB1 Gene expression cassette and LCB2 The gene expression cassette is knocked out orm2 Serine palmitoyltransferase , SERPT LCB1 Gene expression cassette and LCB2 The gene expression cassette is knocked out LAG1 Insertion at the gene site tsc3 3-dehydrosphingosine reductase tsc10 The gene expression cassette is knocked out LAC1 Sphingosine Hydroxylase sur2 The gene expression cassette is knocked out elo2 phosphoglycerate dehydrogenase , PGDH ser3 Gene expression cassette and serine integrin tms1 expression cassette of the gene; The starting strain of the recombinant strain is Saccharomyces cerevisiae S288c; Serine palmitoyltransferase LCB1 Gene, LCB2 Gene, tsc3 gene, 3-dehydrosphingosine reductase tsc10 gene, sphingosine hydroxylase sur2 gene, serine integrin tms1 gene, phosphoglycerate dehydrogenase ser3 All genes are from Saccharomyces cerevisiae S288c.

2. The recombinant genetically engineered bacterium according to claim 1, characterized in that: Serine palmitoyltransferase LCB1 The gene expression cassette includes Gal10 promoter, serine palmitoyltransferase LCB1 gene and CYC1 terminator, serine palmitoyltransferase LCB2 The gene expression cassette includes Gal1 promoter, serine palmitoyltransferase LCB2 gene and TEF1 terminator, tsc3 The gene expression cassette includes the Gal10 promoter, tsc3 gene and CYC1 terminator, 3-dehydrosphingosine reductase tsc10 The gene expression cassette includes Gal1 promoter, 3-dehydrosphingosine reductase tsc10 gene and TEF1 terminator, sphingosine hydroxylase sur2 The gene expression cassette includes Gal1 promoter, sphingosine hydroxylase sur2 gene and TEF1 terminator, phosphoglycerate dehydrogenase ser3 The gene expression cassette includes Gal1 promoter, phosphoglycerate dehydrogenase ser3 gene and TEF1 terminator, serine integrin tms1 Gene expression cassette Gal10 promoter, serine integrin tms1 gene and CYC1 terminator; The nucleotide sequence of the Gal1 promoter is shown in SEQ ID NO: 1, the nucleotide sequence of the Gal10 promoter is shown in SEQ ID NO: 2, the nucleotide sequence of the CYC1 terminator is shown in SEQ ID NO: 3, and the nucleotide sequence of the TEF1 terminator is shown in SEQ ID NO:

4.

3. The recombinant genetically engineered bacterium according to claim 1, characterized in that: The recombinant genetically engineered bacteria does not contain the following genes: sphingosine kinase phosphate LCB4 gene, ceramide synthase LAG1 Genes and LAC1 Gene, LDB16 gene, sphingolipid homeostasis protein orm1 Genes and orm2 gene, L-serine deaminase CHA1 gene, L-serine hydroxymethyltransferase SHM1 Genes and SHM2 Gene, fatty acid elongase elo2 Gene.

4. The recombinant genetically engineered bacterium according to any one of claims 1 to 3, characterized in that: The transformation of the recombinant genetically engineered bacteria was completed using the CRISPR Cas9 yeast genome editing method.

5. Use of the recombinant genetically engineered bacterium according to any one of claims 1 to 4 in the production of phytosphingosine.

6. A method for producing phytosphingosine, characterized in that: It includes the following steps: The recombinant genetically engineered strain according to any one of claims 1 to 4 is inoculated into a YPD seed medium, cultured overnight at 25-30°C and 100-200 rpm, transferred to a YPD fermentation medium, and fermented at 25-30°C and 100-200 rpm for 4-10 days. After the fermentation is completed, the cells are collected by centrifugation, ground and crushed, and then extracted with methanol to obtain phytosphingosine; The formula of the YPD seed culture medium and the YPD fermentation culture medium is: 15-20 g / L of peptone, 5-10 g / L of yeast powder, 10-30 g / L of glucose, and the balance is water.

7. The method according to claim 6, characterized in that: The formula of the YPD seed culture medium and the YPD fermentation culture medium is: 20 g / L peptone, 10 g / L yeast powder, 20 g / L glucose, and the balance is water.

Images