Nissle 1917 engineered bacteria based on the T7 expression system, its preparation method and application

Abstract

The present invention provides an Escherichia coli Nissle 1917 engineered bacterium based on the T7 expression system, a preparation method thereof, and an application thereof. The Escherichia coli Nissle 1917 engineered bacterium is suitable for inducing the expression of exogenous proteins with IPTG or lactose, has a high expression efficiency, does not contain endotoxin, simplifies the purification of the target product in the industrial production process, improves the use safety of the target product, and is suitable for application in industrial production.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering. More specifically, the present invention relates to an Escherichia coli Nissle 1917 engineered bacterium based on the T7 expression system, a preparation method thereof, and an application thereof. Background Art

[0002] Escherichia coli (E. coli), as a classic host for prokaryotic expression in genetic engineering, is widely used in the field to express foreign genes. E. coli is a Gram-negative bacterium with a short rod shape and is the most widely used prokaryotic expression host in current laboratories and industrial production, mainly including K-12 and B strains. The Escherichia coli protein expression system has the following main advantages: 1. Its genetic background is clear. After whole-genome sequencing, a total of 4,405 open reading frames were found; 2. The molecular biology operation element system supporting Escherichia coli is mature and perfect; 3. It is easy to culture and control, the transformation operation is simple and efficient, the protein expression level is high, the cost is low, and the cycle is short, etc.

[0003] However, as a prokaryotic expression host, E. coli will produce a type of bacterial endotoxin with a lipopolysaccharide (LPS) structure during the cultivation process, which will cause host toxic reactions. Bacterial endotoxins have a small molecular weight and strong stability to heat and chemical reagents. Currently, methods such as ion exchange, adsorption, ultrafiltration, and surfactants are mainly used to remove endotoxins in samples. However, the above methods still have problems such as low efficiency, poor specificity, toxicity of the reagents used in the process that is not easy to remove, and high purification costs, which seriously restrict the wide application of E. coli as a host bacterium in industrial production.

[0004] Therefore, finding a safer Escherichia coli as a host bacterium will greatly simplify the purification of the target product in the industrial production process and improve the use safety of the target product. Summary of the Invention

[0005] The purpose of the present invention is to provide an Escherichia coli Nissle 1917 engineered bacterium based on the T7 expression system, which can be induced by IPTG or lactose to express foreign proteins, has a high expression efficiency, does not contain endotoxins, simplifies the purification of the target product in the industrial production process, improves the use safety of the target product, and is suitable for application in industrial production.

[0006] In the first aspect of the present invention, a method for modifying Escherichia coli Nissle 1917 is provided, including: (a) introducing an exogenous T7 RNA polymerase (T7RNAP) expression cassette; (b) removing cryptic plasmids.

[0007] In a second aspect of the present invention, there is provided an Escherichia coli Nissle 1917 engineered bacterium, which is engineered from Escherichia coli Nissle 1917 and is a strain having the following characteristics: (a) comprising an exogenous T7 RNA polymerase expression cassette; (b) its cryptic plasmid has been removed.

[0008] In one or more preferred embodiments, in (a), the T7 RNA polymerase expression cassette comprises, operably linked (5'-3'): an expression driving element, a modified ribosome binding site, and a T7 RNA polymerase encoding gene (preferably, also comprising a terminator).

[0009] In one or more preferred embodiments, the modified ribosome binding site comprises a ribosome binding site of the sequence 5'-aaagaggagaaa-3' and a spacer sequence; the spacer sequence is 5'-ggccactactagag-3' located upstream (5' end) of the ribosome binding site, and 5'-tactag-3' located downstream (3' end) of the ribosome binding site.

[0010] In one or more preferred embodiments, the expression driving element comprises: a lactose promoter and a lactose operon; more preferably, the lactose promoter is lacUV5; preferably, the lactose promoter has the sequence 5'-tttacactttatgcttccggctcgtataatg-3', and the lactose operon has the sequence 5'-ttgtgagcggataacaa-3'.

[0011] In one or more preferred embodiments, the T7 RNA polymerase expression cassette has the nucleotide sequence shown at positions 1-87 in SEQ ID NO:23.

[0012] In one or more preferred embodiments, the engineered bacterium further comprises: (c) downregulating the endA gene.

[0013] In one or more preferred embodiments, the engineered bacterium further comprises: (d) downregulating the ompT gene.

[0014] In one or more preferred embodiments, in (a), the T7 RNA polymerase expression cassette is introduced into the genome of Escherichia coli Nissle 1917.

[0015] In one or more preferred embodiments, the T7 RNA polymerase expression cassette is integrated into the attB site of the genome; preferably, it is integrated by means of gene editing or homologous recombination.

[0016] In one or more embodiments, in (b)-(d), the down-regulation or removal of the relevant gene or plasmid is carried out by methods including (but not limited to) gene knockout / silencing, gene interference.

[0017] In one or more preferred embodiments, gene knockout / silencing is carried out by gene editing or homologous recombination methods, so as to carry out the down-regulation or removal.

[0018] In one or more preferred embodiments, in (b), the cryptic plasmids include: pMUT1, pMUT2.

[0019] In one or more embodiments, the cryptic plasmids pMUT1 and pMUT2 are knocked out by the CRISPR / Cas9 method; preferably, it includes: using specific sgRNAs targeting pMUT1 and pMUT2; more preferably, the sequence of the sgRNA targeting pMUT1 is shown as SEQ ID NO:1, and the sequence of the sgRNA targeting pMUT2 is shown as SEQ ID NO:2.

[0020] In one or more embodiments, endA and ompT are knocked out by the CRISPR / Cas9 method; preferably, it includes: using specific sgRNAs targeting the endA and ompT genes; more preferably, the sequence of the sgRNA targeting endA is shown as SEQ ID NO:31, and the sequence of the sgRNA targeting ompT is shown as SEQ ID NO:32.

[0021] In one or more embodiments, the cryptic plasmids pMUT1 and pMUT2 are knocked out by homologous recombination methods; preferably, it includes: by the Gibson homologous recombination method, using specific primer sequences, recombining the AmpR and sacB expression cassettes into the cryptic plasmid vectors pMTU1 or pMTU2, transforming the strain, screening and obtaining the recombinant strain; more preferably, the specific primer sequences are shown in Table 1.

[0022] In one or more embodiments, endA and ompT are knocked out by homologous recombination methods.

[0023] In one or more preferred embodiments, it includes: preparing homologous arm sequences for knocking out endA or ompT, transforming the homologous arm sequences and vector fragments into the strain, performing PCR amplification using specific primer sequences, screening and obtaining the recombinant strain; more preferably, the specific primer sequences are shown in Table 5.

[0024] In the third aspect of the present invention, a recombinant expression system for exogenous proteins is provided, which comprises: (1) the Nissle 1917 engineered bacterium described in any one of the foregoing; and, (2) an expression construct (expression vector), which comprises: a T7 promoter, and an insertion site for an exogenous protein coding gene (preferably, a terminator is further included).

[0025] In one or more embodiments, the exogenous proteins include, but are not limited to: functional proteins, structural proteins.

[0026] In one or more embodiments, the exogenous proteins include, but are not limited to: regulatory proteins, enzymes (such as TEV enzyme), reporter proteins (such as fluorescent proteins).

[0027] In one or more embodiments, the expression construct is a pET expression vector.

[0028] In the fourth aspect of the present invention, the application of the Nissle 1917 engineered bacterium described in any one of the foregoing or the recombinant expression system for the exogenous protein is provided for expressing exogenous (heterologous) proteins.

[0029] In the fifth aspect of the present invention, a kit for expressing exogenous proteins is provided, which comprises: the Nissle 1917 engineered bacterium described in any one of the foregoing; or, the recombinant expression system described above.

[0030] In one or more preferred embodiments, an inducer is further included in the kit, and the inducer includes: lactose or IPTG.

[0031] In the fifth aspect of the present invention, a method for expressing exogenous proteins using the recombinant expression system for the exogenous protein is provided, which comprises: (i) introducing an exogenous protein coding gene into the insertion site for the exogenous protein coding gene of the expression construct therein to obtain a recombinant expression construct; (ii) introducing the recombinant expression construct in (i) into the engineered bacterium to obtain a recombinant engineered bacterium, and culturing the recombinant engineered bacterium to express exogenous proteins.

[0032] In one or more preferred embodiments, in (ii), after culturing the recombinant engineered bacterium, it is induced with lactose or IPTG to express exogenous proteins.

[0033] In the sixth aspect of the present invention, a modified ribosome binding site or a T7 RNA polymerase expression cassette containing this site is provided, and the modified ribosome binding site comprises a ribosome binding site with the sequence of 5'-aaagaggagaaa-3' and a spacer sequence; the spacer sequence is 5'-ggccactactagag-3' located upstream (5' end) of the ribosome binding site, and 5'-tactag-3' located downstream (3' end) of the ribosome binding site.

[0034] In one or more preferred embodiments, the T7 RNA polymerase expression cassette comprises, operably linked (5'-3'): an expression driving element, a modified ribosome binding site, and a T7 RNA polymerase encoding gene (preferably, also including a terminator); the expression driving element comprises: a lactose promoter and a lactose operon; preferably, the lactose promoter is lacUV5; preferably, the lactose promoter has a sequence of 5'-tttacactttatgcttccggctcgtataatg-3', and the lactose operon has a sequence of 5'-ttgtgagcggataacaa-3'; more preferably, the T7 RNA polymerase expression cassette has the nucleotide sequence shown at positions 1-87 in SEQ ID NO:23.

[0035] In one or more preferred embodiments, the spacer sequence upregulates the expression of T7 RNA polymerase.

[0036] Other aspects of the present invention will be apparent to those skilled in the art from the present disclosure. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 PCR and genomic DNA identification electrophoresis patterns of EcNc strains; (a) and (b) are the clone PCR identification bands for knocking out pMTU1 and pMTU2 plasmids respectively; (c) is the identification band for extracting genomic DNA of the original strain and EcNc strains, Lane1 and Lane2 correspond to EcNc strains, and Lane3 and Lane4 correspond to the original strain.

[0038] Figure 2 : Schematic diagram of EcNc-T7 expression cassette optimization.

[0039] Figure 3 : The expression levels of T7 RNA polymerase in strains obtained by different optimization methods are shown by fluorescence intensity. Different letters between different groups indicate significant differences, P<0.05.

[0040] Figure 4 : Microscopic photographs of EcNc-T7 expression cassette before and after optimization of bacterial cells under excitation by white light source (a, c) and light source with a wavelength of 584 nm (b, d) (the cryptic plasmid of the bacteria is knocked out by homologous recombination).

[0041] Figure 5: PCR amplification and sequencing identification map of EcNcΔattB(lacUV5-T7) strain; (a) shows the PCR amplification result of the positive clone with the T7RNAP expression cassette knocked into the Escherichia coli EcNc strain; (b) shows the assembly schematic diagram of the sequencing result of the T7RNAP expression cassette at the knock-in site.

[0042] Figure 6 : Results of PCR product sequencing identification after knocking out the endA (a) and ompT (b) genes of the EcNcΔattB(lacUV5-T7) strain.

[0043] Figure 7 : Expression of red fluorescent protein in the strain under different induction conditions: (a) without induction; (b) induced by IPTG; (c) induced by lactose; Group 1: Escherichia coli BL21(DE3) strain; Group 2: Escherichia coli EcNc strain; Group 3: Escherichia coli EcNc-T7 strain; Group 4: Escherichia coli EcNc(lacUV5-T7)ΔendAΔompT strain.

[0044] Figure 8 : Identification map of TEV protein expression of the EcNcΔattB(lacUV5-T7)ΔendAΔompT strain under different induction conditions (a-d). Detailed implementation mode

[0045] To solve the problems in the prior art that bacterial endotoxins are produced during the fermentation production process using conventional E. coli (BL21) as the host, and the selection of prokaryotic engineered strains with high safety and suitable for industrial large-scale production in the art is single. After in-depth research, the present inventors provided an Escherichia coli engineered bacterium based on Nissle1917, which can be induced to express by IPTG or lactose, has high expression efficiency, does not contain endotoxins, simplifies the purification of the target product in the industrial production process, improves the use safety of the target product, and is suitable for application in industrial production.

[0046] As used herein, "probiotic" refers to a microbial cell preparation (such as live microbial cells), which, when administered in an effective amount, provides a beneficial effect on the health or well-being of an individual. By definition, all probiotics have the proven non-pathogenic characteristics.

[0047] As used herein, "(genetically) engineered bacterium" refers to a strain that is genetically modified by genetic engineering methods to have capabilities and characteristics that the original strain does not have, so as to have a certain functional use. The present invention constructs a Nissle1917 engineered bacterium, which is genetically modified by genetic engineering methods to enable it to express foreign proteins.

[0048] As used herein, "Nissle 1917 (EcN)", "Escherichia coli Nissle 1917", or "EcN" are used interchangeably. Escherichia coli Nissle 1917 is a probiotic strain with a serotype of O6:K6:H1, which has high antagonistic activity against various pathogenic bacteria such as Salmonella, Yersinia enterocolitica, Shigella flexneri, etc.; in addition to its antibacterial activity, EcN also exhibits various excellent properties, does not contain pathogenic factors such as enterotoxin, hemolysin, and cytotoxin, and poses no safety risk to the host. Currently, EcN probiotic preparations have been used to treat diarrhea, inflammatory bowel disease, and constipation; and due to its safety performance for the host, it is also increasingly widely used in vaccines, tumor treatment, and drug research and development. Different from ordinary Escherichia coli, in addition to its own 5.4 Mb genome, EcN also contains two cryptic plasmids, pMUT1 (3.2 kb) and pMUT2 (5.6 kb), in its cytoplasm. The pMUT1 plasmid carries a ColE1 replication system, while the pMUT2 plasmid carries a ColE2-like replication system, and both can be stably inherited in the cell body. However, in the art, the application of the Nissle 1917 strain is limited to being used as a probiotic, and no engineered host bacteria that can highly express heterologous genes have been successfully developed, and there are no molecular biology elements available for exogenous protein expression in its cells either.

[0049] As used herein, "foreign" refers to the relationship between two or more nucleic acid or protein sequences from different sources, or refers to the relationship between a protein / gene and a host cell. For example, although the host cell itself may also contain the corresponding gene or produce the corresponding protein, when a synthetic / recombinant established gene / protein is introduced into the host cell by genetic engineering methods, it is "foreign" to the host cell. The "foreign" includes "heterologous". A "heterologous" nucleic acid or protein is usually not present in the host cell itself.

[0050] Using Escherichia coli Nissle 1917 as the starting strain, the genetic modification described in the present invention includes: (a) introducing a foreign T7 RNA polymerase (T7RNAP) expression cassette; (b) removing the cryptic plasmid. In a more preferred manner, it also includes: (c) downregulating the endA gene; and / or (d) downregulating the ompT gene. Through systematic modification, the engineered Nissle 1917 bacteria of the present invention can highly express foreign proteins.

[0051] The endA gene expresses a non-specific endonuclease I, which can unwind all DNA double strands and plays an important role in DNA replication and recombination. The endA gene can be referenced by NCBI accession number (949092). In the present invention, it was unexpectedly found that the downregulation of the endA gene promoted the expression of foreign proteins.

[0052] The ompT gene expresses a specific outer membrane protein-degrading enzyme, which specifically degrades the ferrichrome receptor protein bound to the cell membrane. The ompT gene can be referenced by NCBI accession number (945185). In the present invention, it was unexpectedly found that the downregulation of the ompT gene promoted the expression of foreign proteins.

[0053] The downregulation of a gene includes "deletion / loss" or "inactivation" or "inhibition", meaning that the enzyme or protein encoded by the gene or coding region is not produced, or is produced in an inactive form in the host cell, or is produced in the host cell at a level lower than that found in the wild-type form of the host cell under the same or similar growth conditions. This can be achieved by one or more of the following methods, including homologous recombination, RNA interference-based techniques, ZFN and TALEN, CRISPR / Cas systems, etc.

[0054] In the present invention, various methods can be used to remove the cryptic plasmid, downregulate the endA gene and / or downregulate the ompT gene.

[0055] As a preferred method of the present invention, the CRISPR / Cas (such as Cas9) system can be used for targeted gene editing to knockout the cryptic plasmid, knockout the endA gene and / or knockout the ompT gene in the targeted region. Common knockout methods include: co-transferring the sgRNA or nucleic acid capable of forming the sgRNA, Cas mRNA or nucleic acid capable of forming the Cas mRNA into the targeted region or targeted cells. After determining the target site, known methods can be used to introduce the sgRNA and Cas into the cell.

[0056] In some specific embodiments, the CRISPR / Cas9 technology is used to remove the cryptic plasmids pMUT1 and pMUT2. This includes: using a specific sgRNA targeting the pMUT1 and pMUT2 genes; preferably, the sequence of the sgRNA targeting pMUT1 is as shown in SEQ ID NO:1, and the sequence of the sgRNA targeting pMUT2 is as shown in SEQ ID NO:2.

[0057] In some specific embodiments, the endA gene or the ompT gene is down-regulated by CRISPR / Cas9 technology. Preferably, the sequence of the sgRNA targeting the endA gene is as shown in SEQ ID NO:31, and the sequence of the sgRNA targeting the ompT gene is as shown in SEQ ID NO:32.

[0058] As an alternative approach, homologous recombination can be used to specifically target the cryptic plasmid, knockout the endA gene and / or knockout the ompT gene, resulting in defective expression or lack of expression. The Cre and loxp methods can also be applied to selectively knockout relevant genes in the cell genome, reduce expression or inactivate them.

[0059] As an alternative approach, RNAi can be applied to the down-regulation or removal (such as interfering RNA molecules such as siRNA, shRNA, miRNA, etc.). Those skilled in the art can understand that, based on the information of the cryptic plasmid, endA gene and / or ompT gene provided in the present invention, such interfering RNA molecules can be prepared. The interfering RNA can be delivered into cells by using an appropriate transfection reagent, or can also be delivered into cells by using a variety of techniques known in the art.

[0060] "Increase", "introduce" or "knock-in" of a gene or coding region means producing the enzyme or protein encoded by the gene or coding region in a host cell, or producing it in a host cell at a level higher than that found in the wild-type form of the host cell under the same or similar growth conditions. When it is necessary to introduce it into the genome, it can be achieved by one or more of the following methods, for example: Cre-loxp recombination system, CRISPR / Cas (such as Cas9) gene editing technology.

[0061] Those skilled in the art know that when selecting the site for introducing the expression cassette (T7 RNAP) fragment containing T7 RNA polymerase into Nissle 1917, at least one of the following characteristics is advantageous: (1) One or more bacterial genes affected by the engineering of the site are not essential for the growth of Nissle 1917 and do not change the biochemical and physiological activities of the host bacterium; (2) The site can be easily edited; (3) T7 RNAP in the site can be transcribed. Common sites include, for example: bacteriophage attachment (attB) sites. In some specific embodiments, the expression cassette (T7RNAP) fragment containing T7 RNA polymerase is introduced into Nissle 1917 by using CRISPR / Cas9 technology.

[0062] As used herein, "T7 RNA polymerase" or "T7 RNAP" is an RNA polymerase with a molecular weight of approximately 99 kDa. It specifically catalyzes the formation of RNA in the 5'→3' direction. T7 RNA polymerase has a high promoter specificity and only transcribes the DNA or DNA replicas located downstream of the T7 promoter in the T7 vector (expression vector).

[0063] In the present invention, through optimized design, an expression cassette of T7 RNA polymerase was introduced into the genome of Escherichia coli Nissle 1917, and the expression of this polymerase was enhanced by the optimized design of the expression elements. The expression cassette includes (5'-3') operably linked: an expression driving element, a modified ribosome binding site (RBS), and a T7 RNA polymerase encoding gene. The modified ribosome binding site includes a ribosome binding site of 5'-aaagaggagaaa-3' and a spacer sequence; the spacer sequence is 5'-ggccactactagag-3' located upstream (5' end) of the ribosome binding site and 5'-tactag-3' located downstream (3' end) of the ribosome binding site. The expression driving element includes: a lactose promoter and a lactose operon. In a preferred manner, the arrangement of these elements is as Figure 2 shown. The present invention may also include homologous sequences having at least 80% (such as at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%) sequence identity therewith.

[0064] The present invention provides a recombinant expression system for foreign proteins, which includes the engineered Escherichia coli Nissle 1917 obtained by modification, and an expression construct (expression vector) carrying a T7 promoter. Among them, there is a "T7 expression system".

[0065] The "T7 expression system" includes two key parts: T7 RNA polymerase and T7 promoter. T7 RNA polymerase acts on the T7 promoter, endowing the T7 system with the ability to synthesize foreign proteins. Represented by the pET vector system, the T7 promoter is completely specifically controlled by T7 RNA polymerase. When both T7 RNA polymerase and T7 promoter are present in the cell, the transcription of the T7 promoter can reach a very high level in a short time, and its transcription efficiency is much higher than the gene transcription level of the host cell itself. The T7 expression system is simple to construct, highly efficient, has a high transcription efficiency, and the expression regulation of the target gene is rigorous.

[0066] In some embodiments of the present invention, the T7 expression system is used to express exogenous (heterologous) proteins. As used herein, the term "exogenous (heterologous) protein" refers to a protein that is not native to the host cell, as it is transplanted into the host cell from a different organism by genetic engineering methods and is not present in the unengineered host cell. The exogenous protein can be diverse, including various functional proteins, structural proteins, etc. In the present invention, the coding gene of the exogenous protein is introduced into the expression construct carrying the T7 promoter.

[0067] The recombinant expression system of the exogenous protein operates as follows: When Escherichia coli survives in an environment without lactose, the lac operon is in a repressed state; when lactose is present, lactose induces the lac operon, inducing the expression of the downstream gene, i.e., the coding gene of T7 RNA polymerase. T7 RNA polymerase recognizes the T7 promoter and initiates the transcription / expression of its downstream genes. In a preferred embodiment of the present invention, the expression of T7 RNA polymerase is enhanced by modifying the ribosome binding site, generating more T7 RNA polymerase, thereby effectively promoting the expression efficiency of the exogenous protein in the recombinant expression system of the exogenous protein.

[0068] The expression construct (expression vector) carrying the T7 promoter can be a prokaryotic expression vector well-known in the art, including, for example, the pET expression vector.

[0069] In some embodiments of the present invention, the exogenous protein is not a secreted protein. That is, for the genetic engineering of Escherichia coli hosts, it is not necessary to make it have a "leaky" or destabilized outer membrane so that the exogenous protein is secreted outside the host cell.

[0070] In some exemplary embodiments, the exogenous protein can be a red fluorescent protein, and the exogenous protein gene includes a nucleic acid sequence as shown in SEQ ID NO: 43, and homologous sequences having at least 80% (such as at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%) sequence identity thereto.

[0071] In some other exemplary embodiments, the exogenous protein may be a TEV protein. The exogenous protein gene includes the nucleic acid sequence shown in SEQ ID NO: 44, and homologous sequences having at least 80% (such as at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%) sequence identity therewith. The "TEV" is a cysteine protease of Tobacco Etch Virus (TEV) with a His tag (6X His tag) that can be recombinantly expressed in Escherichia coli. It can specifically recognize the heptapeptide sequence Glu-Asn-Leu-Tyr-Phe-Gln-Gly / Ser and perform enzymatic cleavage between the Gln and Gly / Ser amino acid residues, and is commonly used to remove Glutathione S-transferase (GST), His or other tags of fusion proteins.

[0072] It can be understood that exemplary exogenous proteins are listed in the specific embodiments of the present invention, and the exogenous protein expression system of the present invention can be applied to the expression of more exogenous proteins, especially functional proteins with biomedical activity. That is, according to the Nissle 1917 engineered bacteria and its experimental data method provided by the present invention, those skilled in the art can, as needed, apply the Nissle 1917 engineered bacteria described in the present invention to the expression of one or more exogenous proteins required, as long as they can be expressed through the T7 expression system.

[0073] The present invention also provides a method for expressing an exogenous protein using the genetically engineered bacteria of Nissle1917 (EcN) described in the present invention. The method includes: (1) connecting the gene of the exogenous protein to an expression vector containing a T7 promoter to obtain a recombinant plasmid; (2) transforming the Nissle 1917 engineered bacteria with the recombinant plasmid described in (1); (3) inducing the expression of the exogenous protein. In some specific embodiments, the induction includes induction using lactose or IPTG.

[0074] Advantages or positive effects of the present invention compared with the prior art:

[0075] (1) In the present invention, an optimized ribosome binding site (including a spacer sequence) is added upstream of the promoter of T7 RNA polymerase, which improves the expression efficiency of T7 RNA polymerase and lays a foundation for the high-efficiency expression of exogenous proteins;

[0076] (2) By knocking out the endA and ompT genes in the Nissle 1917 engineered bacteria, the present invention significantly improves the expression level of exogenous proteins;

[0077] (3) The present invention constructs an exogenous protein expression system based on Escherichia coli Nissle 1917, which can be induced by IPTG or lactose and has a very high expression efficiency.

[0078] (4) As a probiotic, Escherichia coli Nissle 1917 has the advantages of antibacterial activity, and does not contain pathogenic factors such as enterotoxin, hemolysin and cytotoxin, and has no safety risk.

[0079] The following further elaborates the present invention in conjunction with specific embodiments. It should be understood that these embodiments are only used to illustrate the present invention and not to limit the scope of the present invention. The experimental methods without specific conditions noted in the following embodiments are usually carried out under conventional conditions such as those described in Molecular Cloning: A Laboratory Manual, Third Edition, edited by J. Sambrook et al., published by Science Press, or according to the conditions recommended by the manufacturer.

[0080] Example 1: Knock out the cryptic plasmids pMTU1 and pMTU2 of probiotic Escherichia coli Nissle1917 by CRISPR / Cas9 gene editing technology to obtain EcNc

[0081] In the original strain Escherichia coli Nissle1917 (E.coli Nissle1917), the present invention uses CRISPR / Cas9 gene editing technology to design sgRNAs for the cryptic plasmids pMTU1 and pMTU2 respectively to knock them out, and constructs an Escherichia coli strain with cryptic plasmids removed, named EcNc.

[0082] Among them:

[0083] sgRNA-pMTU1: agttaccggataaggcgcagcgg (SEQ ID NO:1);

[0084] sgRNA-pMTU2: gtttggcgcagaacctcggacgg (SEQ ID NO:2).

[0085] The method for transforming the CRISPR / Cas9 knockout system into the target strain E.coli Nissle1917 is as follows:

[0086] (i) Prepare electrocompetent cells of E.coli Nissle1917 strain;

[0087] (ii) Use a homologous recombination kit (Pro Ligation-Free Cloning Kit, abm company, product number E086) to ligate the Cas9 fragment with the NcoI / XhoI double-digested fragment of the pKD46 plasmid to construct the pKD-Cas9 plasmid;

[0088] (iii) Transform the pKD-Cas9 plasmid into E. coli Nissle 1917 cells. Spread the bacterial solution on a Kan-resistant plate and incubate at 30 °C.

[0089] (iv) The next day, pick monoclonal colonies for PCR verification. Prepare electrocompetent cells from the positive clones and name them EcN-Cas9.

[0090] (v) Transfer pUC-sgRNA-pMTU1 and pUC-sgRNA-pMTU2 into EcN-Cas9 cells. Spread the bacterial solution on a Kan+Spec-resistant plate and incubate at 30 °C.

[0091] (vi) The next day, pick monoclonal colonies for expanded culture. Amplify the target gene using PCR primers (SEQ ID NO: 3 - 6) and identify by agarose gel electrophoresis.

[0092] pMTU1-F: ccctttttctgatttcctggtc (SEQ ID NO: 3);

[0093] pMTU1-R: ttctgggtctttgtcttttgctc (SEQ ID NO: 4);

[0094] pMTU2-F: gcaacccaacattgtcattattt (SEQ ID NO: 5);

[0095] pMTU2-R: cttagcacccgctttaccttta (SEQ ID NO: 6);

[0096] (vii) Pick the clones without bands and re-streak for screening.

[0097] (viii) The next day, pick monoclonal colonies for expanded culture. Amplify the target gene using primers and identify by agarose gel electrophoresis.

[0098] (ix) Pick the clones without bands and inoculate them into fresh medium. Extract genomic DNA.

[0099] (x) Identify by genomic DNA agarose gel electrophoresis to confirm that pMTU1 is completely removed.

[0100] (xi) Select the strains with pMTU1 removed and perform the knockout of the pMTU2 plasmid based on the same steps as above.

[0101] (xii) The strains with both pMTU1 and pMTU2 removed, as identified by double verification of PCR and genomic DNA agarose gel electrophoresis, are gene-edited strains and named EcNc.

[0102] The PCR and genomic DNA identification electrophoresis patterns of the EcNc strain are as follows Figure 1 shown. (a) and (b) are the PCR identification results of the clones with the pMTU1 and pMTU2 plasmids knocked out respectively, showing that no visible bands were amplified by the two pairs of primers; (c) is the genomic DNA identification of the original strain and the EcN strain, and the results show that the EcNc strain has no visible pMTU1 and pMTU2 bands. This indicates that the cryptic plasmids pMTU1 and pMTU2 of Escherichia coli Nissle1917 have been successfully and completely removed.

[0103] Example 2: Obtaining EcNc by knocking out the cryptic plasmids pMTU1 and pMTU2 of probiotic Escherichia coli Nissle1917 by homologous recombination

[0104] In this example, the cryptic plasmids pMTU1 and pMTU2 of Nissle1917 were knocked out by homologous recombination. The steps are as follows (the primer sequences are shown in Table 1):

[0105] (1) Extract the cryptic plasmids pMTU1 and pMTU2 of Escherichia coli Nissle 1917 (EcN) by the alkaline lysis method, separate pMTU1 and pMTU2 by agarose gel electrophoresis and recover them by cutting the gel respectively.

[0106] (2) Digest the plasmids pMTU1 and pMTU2 with SphI endonuclease at 37°C, perform agarose gel electrophoresis and recover them by cutting the gel.

[0107] (3) Using pUC57-Amp as a template, amplify the AmpR expression cassette (SEQ ID NO:15) with the Amp-pMTU2-F / Amp-pMTU1 / 2-R or Amp-pMTU1-F / Amp-pMTU1 / 2-R primer pair; using pRE112 as a template, amplify the expression cassette of the sucrose-sensitive gene (SacB) (SEQ ID NO:16) with the SacB-pMTU1 / 2-F / SacB-pMTU1-R or SacB-pMTU1 / 2-F / SacB-pMTU2-R primer pair; perform agarose gel electrophoresis on the PCR products and recover them by cutting the gel.

[0108] (4) By the Gibson homologous recombination method, recombine the AmpR and sacB expression cassettes into the cryptic plasmid vectors pMTU1 and pMTU2, name them pMTU1-Amp and pMTU2-Amp, transform them into DH5α competent cells respectively and coat them on Amp-resistant LB plates and culture overnight at 37°C.

[0109] (5) The next day, pick single colonies and inoculate them into Amp-resistant LB liquid medium, and use the Amp-SacB-JJF / Amp-SacB-JJR primer pair to identify positive clones by PCR.

[0110] (6) Extract the plasmids of positive clones and verify the correct rate of the recombinant sequence by sequencing.

[0111] (7) Extract the plasmids of correct clones, electrotransform them into the competent cells of EcN strain, and after recovery incubation, also coat them on the LB plate with Amp resistance and culture overnight at 37°C.

[0112] (8) Pick single colonies and inoculate them into the LB liquid medium with Amp resistance. Use the primer pairs Amp-SacB-JJF / Amp-SacB-JJR to identify positive clones by PCR and extract plasmids for sequencing verification. The strains carrying the recombinant plasmids are named EcN-pMTU1-Amp or EcN-pMTU2-Amp.

[0113] (9) Continuously passage EcN-pMTU1-Amp or EcN-pMTU2-Amp on the LB plate with Amp resistance for 3 times. Re-pick single colonies for PCR screening to remove the strains that carry the recombinant plasmids while removing the original cryptic plasmid pMTU1 or pMTU1, and extract plasmids for electrophoresis verification.

[0114] (10) Inoculate the positive clones into the antibiotic-free LB liquid medium containing 10% sucrose for expansion culture, and continuously passage them on the antibiotic-free LB plate with 10% sucrose for 3 times.

[0115] (11) Use the primer pairs pMTU1-JJF / pMTU1-JJR or pMTU2-JJF / pMTU2-JJR to screen the clones with the removal of pMTU1-Amp or pMTU2-Amp plasmids by PCR. The positive clones are cultured on both antibiotic-free and Amp-resistant LB plates at the same time. Select the clones sensitive to Amp resistance for expansion culture, and extract plasmids for electrophoresis to identify the plasmid removal situation.

[0116] (12) Repeat steps 7-11 to remove another cryptic plasmid of EcN, extract plasmids for electrophoresis to identify the plasmid removal situation, and finally obtain Escherichia coli that removes 2 cryptic plasmids and is sensitive to antibiotics, named EcNc.

[0117] Table 1 Primers used in the process of removing cryptic plasmids

[0118]

[0119] The cells obtained in this example and Example 1 were analyzed and compared. The results showed that by knocking out the cryptic plasmids through CRISPR and by knocking out the cryptic plasmids through homologous recombination, neither method left a trace in the cells. Therefore, the bacteria obtained by the two methods were consistent.

[0120] Example 3. Optimization of the T7-RNAP expression cassette

[0121] On the genome of the conventional Escherichia coli BL21(DE3), the T7-RNAP expression cassette contains the lac UV5 promoter, the lac operon (LacO), the lacZ gene, and the T7 RNA polymerase gene. However, Nissle 1917 does not contain the T7RNAP expression cassette and cannot express foreign genes. In order to enable Nissle 1917 to express T7 RNA polymerase, the T7RNAP expression cassette needs to be inserted into the genome of Nissle1917 bacteria. Further, to improve the expression of T7 RNA polymerase, the expression cassette was simplified and expression-optimized: 1) The optimized expression regulation system is still the lactose operon system, and its promoter and operon sequences are the same as those of Escherichia coli, but the lacZ gene is deleted; 2) A section of RBS sequence and a new spacer sequence are added upstream of the start codon of the T7 RNA polymerase gene to improve the transcription and translation of the T7RNA polymerase gene; 3) The optimized expression cassette is inserted into the PET vector and transformed into EcNc to evaluate the expression efficiency of the optimized system.

[0122] In step 2), the inventors designed and compared the effects of sequence-optimized expressions formed by different combinations of RBS and spacer sequences. These combinations are shown in Table 2, and the different optimized sequence structures and compositions are as Figure 2 shown, and the primer sequences are shown in Table 3.

[0123] Table 2

[0124] Serial number Strain number Sequence combination 1 BL21(DE3) lacUV5 + lacO + spacer1 + RBS1 + LacZ + T7RNAP 2 EcNc - T7 - 1 lacUV5 + lacO + spacer2 + RBS2 + T7RNAP 3 EcNc - T7 - 2 lacUV5 + lacO + spacer1 + RBS1 + T7RNAP 4 EcNc - T7 - 3 lacUV5 + lacO + spacer2 + RBS1 + T7RNAP 5 EcNc - T7 - 4 lacUV5 + lacO + spacer1 + RBS2 + T7RNAP

[0125] RBS1: AGGAAA; RBS2: AAAGAGGAGAAA;

[0126] spacer1: TTTCACAC (upstream of RBS) + CAGCT (downstream of RBS);

[0127] spacer2: GGCCACTACTAGAG (upstream of RBS) + TACTAG (downstream of RBS).

[0128] The specific steps are as follows:

[0129] (1) Design primer pairs T7-RNA-F / T7-RNA-R according to the genome sequence of strain BL21(DE3) on NCBI, amplify the T7-RNA polymerase gene and verify it by sequencing;

[0130] (2) Gene-synthesize the regulatory elements upstream of the T7-RNA polymerase gene, such as the lac UV5 promoter, the lac operon, and RBS. The complete fragment can be amplified by Promoter-F / Promoter-R and named PlacUV5-lacO-RBS;

[0131] (3) Use Promoter-F / T7-RNAP-R to assemble the regulatory element and the T7-RNA polymerase gene in step (1) into a linear fragment (named T7-RNAP) through PCR reaction and verify by sequencing;

[0132] (4) When steps (1) to (3) are carried out, construct the fluorescent vector synchronously. Use NcoI / XhoI to digest the pET-28a vector and insert the mRFP fluorescent protein coding gene into the pET-28a vector, named pET-mRFP;

[0133] (5) After the sequencing of pET-mRFP is correct, use SphI to digest pET-mRFP alone and recover the linearized fragment. Amplify the T7-RNAP expression cassette with the primer pair T7-RNAP-FN / T7-RNAP-RN and insert it into the pET-mRFP vector by homologous recombination method, named pET-mRFP-T7RNAP;

[0134] (6) Transform pET-mRFP-T7RNAP into the Nissle 1917 strain (EcNc) without the cryptic plasmid and spread it on the resistant plate, and culture it overnight at 37°C;

[0135] (7) Pick the monoclonal in step (6), inoculate it into fresh LB medium, and culture it overnight at 37°C and 220 rpm. This bacterial solution is the seed solution;

[0136] (8) Inoculate the seed solution obtained in step (7) into fresh LB medium at a ratio of 1:100 again, and culture it at a constant temperature of 37°C and 220 rpm until the OD600 of the bacterial solution reaches about 0.6;

[0137] (9) Add IPTG (final concentration 0.5 mM) to the bacterial solution and induce culture at a constant temperature of 37°C and 220 rpm for 3 h;

[0138] (10) Collect the bacterial solution sample and observe the expression of pET-mRFP-T7RNAP in the EcNc strain using a fluorescence microscope.

[0139] Table 3. Sequences used in the optimization process of the T7-RNAP expression cassette

[0140]

[0141] As Figure 2As shown, after optimization of the present invention, the promoter sequence is "tttacactttatgcttccggctcgtataatg", the operator sequence is "ttgtgagcggataacaa", the RBS sequence is "AAAGAGGAGAAA", and the spacer sequences are "GGCCACTACTAGAG" (the spacer sequence upstream of RBS) and "TACTAG" (the spacer sequence downstream of RBS). The expression cassette composed of them is abbreviated as "lacUV5-T7".

[0142] In SEQ ID NO:23, "ATGAACACGATTAACATCGCTAAGAAC" is the upstream partial sequence of the gene encoding T7 RNA polymerase (Gene ID: 1261050), and ATG is the start codon.

[0143] As Figure 3 and Figure 4 shown, the optimized T7 RNAP of the present invention can be highly expressed in EcNc, while the expression efficiency of the T7-RNAP expression cassette of the original BL21(DE3) is low in EcNc. For different RBSs and spacer sequences, there are significant differences in their combined effects.

[0144] Example 4. Construction of probiotic Escherichia coli EcNcΔattB(lacUV5-T7) strain

[0145] The EcNcΔattB(lacUV5-T7) strain prepared by the present invention, abbreviated as EcNc-T7 strain, has the same insertion site of the expression cassette "lacUV5-T7" as that of Escherichia coli BL21(DE3), both being the attB site on the genome.

[0146] 4.1 Construction of EcNcΔattB(lacUV5-T7) strain using CRISPR / Cas9 gene editing technology

[0147] The inventor of the present invention designed sgRNA for the attB site of the EcN genome (the nucleotide sequence of the sgRNA targeting the attB site is shown in SEQ ID NO:24).

[0148] sgRNA-attB: CTAACTTGAGCGAAACGGGAAGG (SEQ ID NO:24).

[0149] Using the same method as in Example 1, EcNc-Cas9 was constructed. Then, the pUC-sgRNA-attB plasmid and the donor fragment (the donor fragment contains the T7 RNAP fragment and homologous arms of about 300 bp in length upstream and downstream of the attB site) were co-transformed into EcNc-Cas9 cells, and the T7RNAP fragment was integrated into the attB site of the EcNc strain using the CRISPR / Cas9 system (steps vi-ix in Example 1 were skipped during the operation).

[0150] Using the obtained positive clones as templates, PCR amplification was performed on the sequences upstream and downstream of the CRISPR / Cas9 knock-in site, and the correct bands were recovered using agarose gel and verified by sequencing. The PCR primers used are shown in SEQ ID NO:25-26, and the results are as Figure 5 shown. From the assembly results of the sequencing results, the sequence of the knock-in fragment is consistent with the T7RNAP fragment, indicating that the T7RNAP expression cassette was successfully knocked into EcNc, and it was named EcNcΔattB(lacUV5-T7), that is, EcNc-T7.

[0151] EcNc-F: cgtggtatgcgttacaccttgagt(SEQ ID NO:25);

[0152] EcNc-R: ctggtggcactgggtagttgttaat(SEQ ID NO:26).

[0153] 4.2 Construction of EcNcΔattB(lacUV5-T7) strain using homologous recombination technology

[0154] Homologous recombination can also insert T7RNA into EcNc. The specific steps are as follows (primer sequences are shown in Table 4):

[0155] (1) Using primers T7-RNAP-F1 / T7-RNAP-R1, the T7-RNAP expression cassette was amplified using pET-mRFP-T7RNAP as a template. The PCR product was subjected to agarose gel electrophoresis and the gel was cut and recovered.

[0156] (2) The plasmid pKD3 was digested with SphI, and the T7-RNAP was recombined onto the plasmid pKD3 through Gibson homologous recombination, and finally named pKD3-T7RNAP was constructed.

[0157] (3) Positive identification of pKD3-T7RNAP was performed by PCR and verified by gene sequencing.

[0158] (4) Using the T7-RNAP-F2 / -R2 primer pair, amplify the target fragment + FRT + CmR expression element + FRT sequence with pKD3-T7RNAP as the template, and add approximately 50 bp upstream and downstream of the knockout site at both ends of the fragment. Finally, name the fragment the T7-CmR fragment.

[0159] (5) The recombination process is the same as the homologous recombination knockout process of the cryptic plasmids pMTU1 and pMTU2 in Example 2.

[0160] (6) Using the EcN-F / EcN-R primer pair, amplify the recombined fragment by PCR. The sequencing verification results show that the T7RNAP expression cassette is successfully knocked in.

[0161] Table 4. Primer sequences used in the construction of the EcNcΔattB(lacUV5-T7) strain by homologous recombination technology

[0162]

[0163] Example 5. Establishment of EcNcΔattB(lacUV5-T7)ΔendAΔompT using the CRISPR / Cas9 system

[0164] In this example, based on the CRISPR / Cas9 gene editing technology, knockout the endA and ompT genes in the probiotic Escherichia coli EcNcΔattB(lacUV5-T7) strain to prepare EcNcΔattB(lacUV5-T7)ΔendAΔompT.

[0165] Design sgRNAs for the genes endA (the sgRNA nucleotide sequence of endA is shown in SEQ ID NO: 31) and ompT (the sgRNA nucleotide sequence of ompT is shown in SEQ ID NO: 32) respectively, and transform the CRISPR / Cas9 knockout system into the target strain EcNcΔattB(lacUV5-T7), that is, EcNc-T7, to knockout the target genes using the same method as in Example 1.

[0166] sgRNA-endA: TTTTTCTCAAGCGAAAGCCGCGG (SEQ ID NO: 31);

[0167] sgRNA-ompT: TACTCCTGACAACATAAATGCGG (SEQ ID NO: 32);

[0168] Using the positive clone as a template, PCR primers (such as those shown in SEQ ID NO: 33 - 36) were used to amplify the upstream and downstream sequences of the CRISPR / Cas9 gene knockout sites endA and ompT genes. The correct bands were recovered using agarose gel electrophoresis and verified by sequencing.

[0169] The results are as Figure 6 (a) and Figure 6 (b) shown. The sequences of the knockout fragments are consistent with the fragments of the endA and ompT genes, indicating that the endA and ompT genes in the EcNcΔattB(lacUV5 - T7) strain were successfully knocked out. It was named EcNcΔattB(lacUV5 - T7)ΔendAΔompT.

[0170] ompT - F: cattcgggaaggagccgatatcat (SEQ ID NO: 33);

[0171] ompT - R: ctaatatgcatctaaaggcatggcact (SEQ ID NO: 34);

[0172] endA - F: tacgccgtcataatcgcgtagt (SEQ ID NO: 35);

[0173] endA - R: tgaaatcgaccttcatggcgcat (SEQ ID NO: 36).

[0174] Example 6. Establishment of EcNcΔattB(lacUV5 - T7)ΔendAΔompT by homologous recombination

[0175] In this example, the endA and ompT genes in the probiotic Escherichia coli EcNcΔattB(lacUV5 - T7) strain were knocked out based on homologous recombination technology to obtain EcNcΔattB(lacUV5 - T7)ΔendAΔompT, named TCBJ117.

[0176] 6.1 Knockout of the ompT gene

[0177] (1) Using the universal primers P1 / P2, the FRT + CmR expression element + FRT sequence (CmR fragment) was amplified using PKD3 as a template. The PCR product was subjected to agarose gel electrophoresis and the gel was cut and recovered.

[0178] (2) Using the ompT - P1 / ompT - P2 primers, approximately 50 bp homologous arms on both sides of the ompT gene knockout position were added to both ends of the CmR fragment by PCR (ompT - CmR fragment). The PCR product was subjected to agarose gel electrophoresis and the gel was cut and recovered.

[0179] (3) Prepare the competent cells of EcNc strain, and transform the pKD46 plasmid into the target strain, named EcNc-pKD46.

[0180] (4) Activate the EcNc-pKD46 strain, inoculate the monoclonal into the LB medium with Amp resistance and culture overnight as the seed solution; transfer the seed solution again the next day, add 0.2% arabinose and culture at 30 °C for expansion until the OD600 reaches 0.4 - 0.5, then collect the bacteria to prepare the competent cells.

[0181] (5) Transform the ompT-CmR fragment into the EcNc-pKD46 competent cells in step (4), transfer it to the LB liquid medium containing Amp and Cm antibiotics, and culture overnight at 30 °C.

[0182] (6) Take an appropriate volume and coat it on the LB plate with Cm resistance, and culture overnight at 37 °C.

[0183] (7) Use the EcNc-ompT-F / EcNc-ompT-R primers to amplify the fragments about 1000bp upstream and downstream of the knockout site by PCR, and determine the gene knockout strain by gene sequencing.

[0184] (8) Pick the positive clones in step (7) to prepare the competent cells of the strain.

[0185] (9) Transform the pCP20 plasmid into the knockout strain, inoculate it into the LB culture medium with Amp and Cm resistance, and culture overnight at 30 °C.

[0186] (10) Transfer the bacterial liquid to the fresh LB culture medium, culture at 42 °C for 1 h, take an appropriate amount of the bacterial liquid and coat it on the antibiotic-free, Amp, and Cm resistance plates, and screen to obtain the antibiotic-sensitive strain, which is the knockout strain EcNcΔompT without resistance.

[0187] (11) Amplify the recombinant fragment by PCR, sequence to verify the knockout situation, and it is verified that the relevant gene is successfully knocked out by this method.

[0188] 6.2 Knockout of endA gene

[0189] Similar to the knockout steps of the ompT gene.

[0190] Table 5. Primer sequences used in the gene knockout process in Example 6

[0191]

[0192] Example 7. Functional verification of probiotic Escherichia coli EcNcΔattB(lacUV5-T7)ΔendAΔompT strain

[0193] To verify the effect of the transformed strain EcNcΔattB(lacUV5-T7)ΔendAΔompT as a host bacterium on the high-efficiency expression of heterologous proteins by vectors containing the T7 promoter, the red fluorescent protein (mRFP) and the tobacco etch virus TEV protein were used as examples for verification. The genes of the red fluorescent protein (mRFP, gene sequence as shown in SEQ ID NO:43) and the tobacco etch virus TEV protein (gene sequence as shown in SEQ ID NO:44) were respectively cloned into the pET28a vector to obtain the pET-mRFP and pET-TEV prokaryotic expression vectors, and then they were respectively transformed into the EcNcΔattB(lacUV5-T7)ΔendAΔompT strain, and BL21(DE3) transformed with the same plasmid was used as a control and compared with the EcNc-T7 strain. IPTG or lactose was added for induction for 1 - 4 hours, and the expression level of TEV was detected by SDS-PAGE electrophoresis.

[0194] 1. Construction of pET-mRFP or pET-TEV prokaryotic expression vector

[0195] (1) The mRFP and TEV gene fragments were respectively amplified by PCR, and the primers were as follows:

[0196] mRFP-F (SEQ ID NO:45):

[0197] GTTTAACTTTAAGAAGGAGATATACCATGGCTTCCTCCGAAGACGTTATC;

[0198] mRFP-R (SEQ ID NO:46):

[0199] GTGGTGGTGGTGGTGCTCGAGCTATTAAGCACCGGTGGAGTGACGACC;

[0200] TEV-F (SEQ ID NO:47):

[0201] gtttaactttaagaaggagatataccatgggccaccatcatcatcatcatag;

[0202] TEV-R (SEQ ID NO:48):

[0203] ggtggtggtggtggtgctcgagctattagttcatcagctgggtagcttc;

[0204] (2) The pET28a plasmid was double-digested with NcoⅠ and XhoⅠ;

[0205] (3) Perform gel electrophoresis and excise and recover the above-mentioned mRFP, TEV amplification fragments, and pET28a double-digested fragments;

[0206] (4) Use a homologous recombination kit (Pro Ligation-Free Cloning Kit) to ligate the mRFP and TEV fragments with the pET28a double-digested fragment respectively; transform the ligation product into DH5α competent cells, spread the transformation solution on an LB plate containing Kan antibiotic, and culture it overnight at 37°C in an inverted position;

[0207] (5) Pick single colonies for PCR identification and sequencing verification to construct the vectors pET-mRFP or pET-TEV.

[0208] 2. Vector transformation

[0209] Transform the pET-mRFP or pET-TEV plasmid into BL21(DE3), EcNc-T7, and EcNcΔattB(lacUV5-T7)ΔendAΔompT competent cells respectively, spread them on a Kan-resistant plate, and culture them overnight at 37°C in an inverted position. The next day, pick monoclonal colonies and inoculate them into test tubes containing 5 mL of LB liquid medium with Kan antibiotic respectively, and culture them overnight at 37°C and 220 rpm to obtain recombinant expression strains.

[0210] 3. Induced expression

[0211] (1) Inoculate the overnight culture (recombinant expression strain) containing the pET-mRFP plasmid into a test tube containing 4 mL of LB culture medium (containing Kan antibiotic) at a ratio of 1:100, and culture it at 37°C and 220 rpm; when cultured for about 2 - 3 hours until the OD600 value reaches 0.6 - 0.8, add IPTG with a final concentration of 0.5 mM or 1% lactose, and continue to culture at 25°C and 220 rpm for 2 - 3 hours.

[0212] [[ID=??]]

[0213] 4. Product detection

[0214] Qualitative analysis was performed on the induced expression of the pET-mRFP plasmid, and the results are as Figure 7 It seems there is an error in the original text where the line break in ID 23 is incorrect. I've translated it as best as possible with the given text. Also, there is an ID "??" in the original which is not a valid ID in the provided context. You may want to check and correct the original text for a more accurate translation.As shown, EcNcΔattB(lacUV5-T7)ΔendAΔompT can express red fluorescent protein under the induction of ITPG or lactose, just like the BL21(DE3) strain; the EcNc-T7 strain can also express red fluorescent protein, but the expression level is lower than that of EcNcΔattB(lacUV5-T7)ΔendAΔompT; while EcNc cannot be induced to express red fluorescent protein.

[0215] Quantitative analysis was performed on the induced expression of the pET-TEV plasmid. The bacterial cells were collected, and then the cells were lysed to extract proteins for relative quantitative determination by SDS-PAGE electrophoresis.

[0216] The results are as Figure 8 shown. (1) The EcNcΔattB(lacUV5-T7)ΔendAΔompT strain can achieve high-level protein expression of the pET-TEV plasmid under the induction of IPTG or lactose. The constructed system can use safe and cheap lactose instead of IPTG to induce recombinant bacteria, which not only reduces the cost but also makes the downstream products meet the safety standards of drugs and foods. (2) The induced expression level of the pET-TEV plasmid by the EcNcΔattB(lacUV5-T7)ΔendAΔompT strain reaches the expression level of the BL21(DE3) strain. This shows that under the same conditions, the EcNcΔattB(lacUV5-T7)ΔendAΔompT strain can achieve high-level expression of foreign proteins. Even, the EcNcΔattB(lacUV5-T7)ΔendAΔompT strain shows significantly better expression levels than BL21(DE3) during lactose induction. (3) The induced expression level of the pET-TEV plasmid by the EcNcΔattB(lacUV5-T7)ΔendAΔompT strain is significantly higher than that of EcNc-T7 (p<0.05), indicating that the knockout of the endA and ompT genes can significantly improve the expression of heterologous genes.

[0217] Furthermore, the expression function of the EcNcΔattB(lacUV5-T7)ΔendAΔompT strain prepared by the method of Example 5 was verified by the same method. It was detected that the strain prepared by this method can also efficiently express foreign proteins and can be induced by both IPTG and lactose, and there is no significant difference in the expression ability compared with the BL21(DE3) strain.

[0218] In summary, EcNcΔattB(lacUV5-T7)ΔendAΔompT optimized and constructed by the method of the present invention is an excellent strain, which can form a new safe and efficient probiotic Escherichia coli expression system for stable expression of foreign proteins in combination with T7 promoter expression vectors such as pET series vectors.

[0219] The above-described embodiments merely represent several implementation manners of the present invention. Their descriptions are relatively specific and detailed, but they should not be construed as limiting the scope of the patent of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present invention, several modifications and improvements can still be made, and these all fall within the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the appended claims. At the same time, all the documents mentioned in the present invention are cited in this application as references, just as each document is cited separately as a reference.

[0220] Summary of Sequence Information

[0221] SEQ ID NO: 1

[0222] AGTTACCGGATAAGGCGCAGCGG

[0223] SEQ ID NO: 2

[0224] GTTTGGCGCAGAACCTCGGACGG

[0225] SEQ ID NO: 3

[0226] CCCTTTTTCTGATTTCCTGGTC

[0227] SEQ ID NO: 4

[0228] TTCTGGGTCTTTGTCTTTTGCTC

[0229] SEQ ID NO: 5

[0230] GCAACCCAACATTGTCATTATTT

[0231] SEQ ID NO: 6

[0232] CTTAGCACCCGCTTTACCTTTA

[0233] SEQ ID NO: 7

[0234] CGACAGGGTTTGTCAGGCCTTGAcgcggaacccctatttgt

[0235] SEQ ID NO: 8

[0236] ACGACAGGGTTTGTCAGGCCTTGAcgcggaacccctatttgt

[0237] SEQ ID NO: 9

[0238] Atgggttaaaaaggatcagaattcccttaccaatgcttaatcagtgaggc

[0239] SEQ ID NO:10

[0240] gggaattctgatcctttttaacccatcacatat acc tgccgttcact

[0241] SEQ ID NO:11

[0242] CTTTAAAAACCGGATCGCCTAAATGAttatttgttaactgttaattgtccttg

[0243] SEQ ID NO:12

[0244] GACTTGCTGCGCCAAGCCGGTGACTTttatttgttaactgttaattgtccttg

[0245] SEQ ID NO:13

[0246] tgacaccacgatgcctgtagc

[0247] SEQ ID NO:14

[0248] tctccggctaatgcaaagacgat

[0249] AmpR expression cassette sequence SEQ ID NO:15:

[0250] cgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaag

[0251] agtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatg

[0252] ctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatg

[0253] atgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgac

[0254] ttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgc

[0255] ggccaacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaac

[0256] cggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaactac

[0257] ttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattg

[0258] ctgataaatctggagccggtgagcgtgggagtcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgac

[0259] ggggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaa

[0260] sacB expression cassette sequence SEQ ID NO:16:

[0261]

[0262] SEQ ID NO:17

[0263] ATGAACACGATTAACATCGCTAAG

[0264] SEQ ID NO:18

[0265] TTATTACGCGAACGCGAAGTC

[0266] SEQ ID NO:19

[0267] tttacactttatgcttccggctcg

[0268] SEQ ID NO:20

[0269] GTTCTTAGCGATGTTAATCGTGTTCA

[0270] SEQ ID NO:21

[0271] gagcaccgccgccgcaaggaatggttttacactttatgcttccggc

[0272] SEQ ID NO:22

[0273] ccgggggactgttgggcgccatctccttTTATTACGCGAACGCGAAGTC

[0274] SEQ ID NO:23

[0275] tttacactttatgcttccggctcgtataatgtgtggaattgtgagcggataacaaGGCCACTACTAGAGAAAGAGGAGAAATA

[0276] CTAGATGAACACGATTAACATCGCTAAGAAC

[0277] SEQ ID NO:24

[0278] CTAACTTGAGCGAAACGGGAAGG

[0279] SEQ ID NO:25

[0280] cgtggtatgcgttacaccttgagt

[0281] SEQ ID NO:26

[0282] ctggtggcactgggtagttgttaat

[0283] SEQ ID NO:27

[0284] tcgctcaagacgtgtaatgctgcaatctTTATTACGCGAACGCGAAGTC

[0285] SEQ ID NO:28

[0286] cgtggccagtgccaagcttgcatgctttacactttatgcttccggc

[0287] SEQ ID NO:29

[0288] catctggtatcacttaaaggtattaaaaacaactttttgtctttttaGAATTCatatgaatatcctccttag

[0289] SEQ ID NO:30

[0290] tgaaatagaaaaatgaatccgttgaagcctgcttttttatactaaAAGCTTtttacactttatgcttccggc

[0291] SEQ ID NO:31

[0292] TTTTTCTCAAGCGAAAGCCGCGG

[0293] SEQ ID NO:32

[0294] TACTCCTGACAACATAAATGCGG

[0295] SEQ ID NO:33

[0296] cattcgggaaggagccgatatcat

[0297] SEQ ID NO:34

[0298] ctaatatgcatctaaaggcatggcact

[0299] SEQ ID NO:35

[0300] tacgccgtcataatcgcgtagt

[0301] SEQ ID NO:36

[0302] tgaaatcgaccttcatggcgcat

[0303] SEQ ID NO:37

[0304] ATATGAATATCCTCCTTAG

[0305] SEQ ID NO:38

[0306] TGTAGGCTGGAGCTGCTTCG

[0307] SEQ ID NO:39

[0308] ctagataaacacgctcttttgtttttccgctcagagttccaagactaatgtatatgaatatcctccttag

[0309] SEQ ID NO:40

[0310] gacaacccctattgcgatcagctcttttgcttctaccgagactttatcgtttgtaggctggagctgcttcg

[0311] SEQ ID NO:41

[0312] ggtactgagcacagcattttccggcccggcattggccgaaggtatcaatagatatgaatatcctccttag

[0313] SEQ ID NO:42

[0314] acatccgcaataaaacgtaccgggcgcgtcagcgtggacttttaccgtgtaggctggagctgcttcg

[0315] SEQ ID NO:43

[0316] atggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaaSEQ ID NO:44

[0317] atgggccaccatcatcatcatcatagcagcggcgaaagcctgtttaaaggtccgcgcgattacaacccgattagtagcaccatctgccatctgaccaacgaatctgacggtcataccaccagtctgtacggtattggctttggcccgtttatcatcaccaacaaacacctgttccgccgtaacaacggtaccctgctggttcaatctctgcatggcgtcttcaaagtcaaaaacaccaccaccctgcaacagcatctgattgacggtcgcgatatgatcatcatccgcatgccgaaagatttcccgccgtttccgcagaaactgaaattccgcgaaccgcaacgcgaagaacgtatttgtctggtcaccaccaacttccagaccaaatccatgtctagcatggttagcgataccagctgtacctttccgagcagcgacggtatcttctggaaacattggatccagaccaaagacggtcaatgcggtagtccgctggttagtacccgcgacggttttatcgtcggcattcatagcgcgagcaacttcaccaacaccaacaactacttcaccagcgtcccgaaaaacttcatggagctgctgaccaaccaagaagcacagcagtgggtttctggttggcgtctgaacgcagattctgttctgtggggcggtcataaagtcttcatggtcaaaccggaagaaccgtttcagccggttaaagaagctacccagctgatgaactaa

[0318] SEQ ID NO:45

[0319] GTTTAACTTTAAGAAGGAGATATACCATGGCTTCCTCCGAAGACGTTATC

[0320] SEQ ID NO:46

[0321] GTGGTGGTGGTGGTGCTCGAGCTATTAAGCACCGGTGGAGTGACGACC

[0322] SEQ ID NO:47

[0323] gtttaactttaagaaggagatataccatgggccaccatcatcatcatcatag

[0324] SEQ ID NO:48

[0325] ggtggtggtggtggtgctcgagctattagttcatcagctgggtagcttc

Claims

1. A method for modifying Escherichia coli Nissle 1917, characterized in that, The method includes: (a) Introducing an exogenous T7 RNA polymerase expression cassette; the T7 RNA polymerase expression cassette includes, operably linked from 5'-3': an expression driving element, a modified ribosome binding site, and a T7 RNA polymerase coding gene; the modified ribosome binding site consists of a ribosome binding site with the sequence 5'-aaagaggagaaa-3' and a spacer sequence; the spacer sequence is 5'-ggccactactagag-3' located upstream of the ribosome binding site and 5'-tactag-3' located downstream of the ribosome binding site; (b) Removing cryptic plasmids; the cryptic plasmids are pMUT1 and pMUT2; (c) Knockout endA gene and ompT gene.

2. The method according to claim 1, wherein The expression driving element includes: a lactose promoter and a lactose operon; the lactose promoter has the sequence 5'-tttacactttatgcttccggctcgtataatg-3', and the lactose operon has the sequence 5'-ttgtgagcggataacaa-3'.

3. The method according to claim 1, characterized in that, The T7 RNA polymerase expression cassette has the nucleotide sequence shown at positions 1-87 in SEQ ID NO:

23.

4. The method according to claim 1, characterized in that Integrate the T7 RNA polymerase expression cassette into the genome by gene editing or homologous recombination at the attB site.

5. The method according to claim 1, characterized in that, Gene knockout is carried out by gene editing or homologous recombination methods to remove genes or plasmids.

6. An Escherichia coli Nissle 1917 engineered bacterium, characterized in that, It is modified from Escherichia coli Nissle 1917 and is a strain with the following characteristics: (a) Containing an exogenous T7 RNA polymerase expression cassette; the T7 RNA polymerase expression cassette includes, operably linked from 5'-3': an expression driving element, a modified ribosome binding site, and a T7 RNA polymerase coding gene; the modified ribosome binding site consists of a ribosome binding site with the sequence 5'-aaagaggagaaa-3' and a spacer sequence; the spacer sequence is 5'-ggccactactagag-3' located upstream of the ribosome binding site and 5'-tactag-3' located downstream of the ribosome binding site; (b) Its cryptic plasmids are removed; the cryptic plasmids are: pMUT1 and pMUT2; (c) endA genes and ompT genes were knocked out.

7. The engineered bacterium according to claim 6, wherein, The expression driving element includes: a lactose promoter and a lactose operon; the lactose promoter has the sequence 5'-tttacactttatgcttccggctcgtataatg-3', and the lactose operon has the sequence 5'-ttgtgagcggataacaa-3'.

8. The engineered bacterium according to claim 6, characterized in that, The T7 RNA polymerase expression cassette has the nucleotide sequence shown at positions 1-87 in SEQ ID NO:

23.

9. The engineered bacterium according to claim 6, characterized in that, Integrate the T7 RNA polymerase expression cassette into the genome by gene editing or homologous recombination attB site.

10. The engineered bacterium according to claim 6, wherein Gene knockout is carried out by gene editing or homologous recombination methods to remove genes or plasmids.

11. A recombinant expression system for an exogenous protein, characterized in that, It includes: (1) The engineered E. coli Nissle 1917 according to any one of claims 6-10; and (2) An expression construct, the expression construct includes: a T7 promoter, and an exogenous protein coding gene insertion site.

12. Use of the engineered Nissle 1917 bacterium according to any one of claims 6-10 or the recombinant expression system of the exogenous protein according to claim 11 in the expression of an exogenous protein.

13. A kit for expressing exogenous proteins, characterized in that, Comprising: The engineered Nissle 1917 bacterium according to any one of claims 6-10; Or The recombinant expression system according to claim 11.

14. The kit for expressing an exogenous protein according to claim 13, wherein The kit further comprises an inducer, and the inducer is lactose or IPTG.

15. A method for expressing an exogenous protein using the recombinant expression system of the exogenous protein described in claim 11, characterized in that, Comprising: (i) Introduce the exogenous protein coding gene into the insertion site of the exogenous protein coding gene of the expression construct in (2) to obtain a recombinant expression construct; (ii) Introduce the recombinant expression construct in (i) into the engineered bacterium in (1) to obtain a recombinant engineered bacterium, culture the recombinant engineered bacterium, and induce with lactose or IPTG to express the exogenous protein.

Images