Application of cotton gene GhEDC13 in improving plant disease resistance

Abstract

The present invention discloses an application of a cotton gene GhEDC13 in improving plant disease resistance, wherein the gene ID of the cotton gene GhEDC13 is Gh_A01G193100, and the nucleotide sequence is shown in Sequence 1. The present invention obtains a homozygous transgenic Arabidopsis thaliana strain of GhEDC13 gene by transgenic technology, and the tolerance of the transgenic Arabidopsis thaliana under the stress of Verticillium wilt is significantly improved. The gene silenced cotton plant is obtained by VIGS technology, and the disease index of the silenced plant under the stress of Verticillium wilt is reduced, the fungal content is increased, and the tolerance is significantly reduced. The results show that the GhEDC13 gene plays an important role in the process of plant disease resistance. The present invention provides a good gene resource for cotton disease resistance molecular breeding.

Description

Technical Field

[0001] The invention relates to the field of genetic engineering, and in particular to application of cotton gene GhEDC13 in improving plant disease resistance. Background Art

[0002] Cotton is an important economic crop in my country, the main source of natural textile fiber, and an important oil crop. Verticillium wilt is a soil-borne vascular disease caused by Verticillium dahliae Kleb. It is one of the most devastating diseases in the growth process of cotton and is called the "cancer" of cotton. The pathogenic bacteria invade the root tip growth area of ​​cotton, and after entering the vascular tissue, they quickly produce a large number of hyphae and conidia, and secrete toxins, which affect the water and nutrient transport of cotton plants, causing systemic disease, and eventually causing the cotton plants to wilt and die. The pathogenic bacteria have the characteristics of a wide host range, multiple transmission routes, long survival time, and frequent mutations, which can lead to a decline in cotton fiber quality and yield, seriously restricting the safe production of cotton in my country.

[0003] In recent years, the area of ​​Verticillium wilt in my country's main cotton-producing areas has increased year by year, and the prevention and control of Verticillium wilt is still very severe; genetic improvement of the main cotton varieties and breeding of new varieties resistant to Verticillium wilt have always been a hot topic for breeders. However, there is still a lack of effective resistance sources. However, my country is not a cotton-producing area, and breeding resources mainly come from a few cotton germplasm resources such as Daizi cotton and Sizi cotton, with a narrow genetic basis. my country's cotton germplasm resources resistant to Verticillium wilt need to be further developed, and it is urgent to find new germplasm resources resistant to Verticillium wilt and study their disease resistance mechanisms.

[0004] Plants have developed a series of complex stress response mechanisms to enhance tolerance to various abiotic and biotic stresses. Multiple plant hormones also play a vital role in defense responses. Hormones such as salicylic acid, jasmonic acid, ethylene, cytokinin, abscisic acid, and brassinolide work together to cope with the invasion of different pathogens. However, the immune mechanism and regulatory network of plants are extremely complex. It is the result of the interweaving and synergistic action of multiple signal pathways, and it still needs to be continuously analyzed and explored. Studies have found that chitinase is widely present in plant, animal and microbial cells, and participates in a variety of physiological processes. Chitinase activity can significantly improve plant resistance to fungal diseases. The gene ID of the cotton gene GhEDC13 is Gh_A01G193100. The CDS of this gene is 690 bp in length and encodes an endochitinase. Research on the function of the GhEDC13 gene can provide good gene resources for molecular breeding of cotton disease resistance. Summary of the invention

[0005] In view of the problems existing in the prior art, the purpose of the present invention is to provide a new application of the cotton gene GhEDC13 in regulating resistance to Verticillium wilt and to expand the application scope of the gene GhEDC13.

[0006] The technical solution of the present invention is: application of cotton gene GhEDC13 in improving plant disease resistance, and the CDS sequence of the cotton gene GhEDC13 is shown in sequence 1.

[0007] Furthermore, the application is the application of the cotton gene GhEDC13 in improving disease resistance to Verticillium wilt, and the plant is Arabidopsis thaliana or cotton.

[0008] Furthermore, the recombinant vector, expression cassette, transgenic cell line or recombinant bacteria containing the GhEDC13 gene as shown in Sequence 1 are used to improve the Verticillium wilt resistance of the target plants cotton or Arabidopsis.

[0009] Furthermore, the application is to overexpress the cotton gene GhEDC13 in plants, thereby improving the disease resistance of plants.

[0010] The present invention also discloses a method for improving the disease resistance of plants, wherein an exogenous gene is transformed into a plant through a plant expression vector via Agrobacterium-mediated transformation to obtain a transgenic plant with disease resistance; the nucleotide sequence of the exogenous gene is as shown in Sequence 1 or a degenerate sequence encoding the same protein as Sequence 1.

[0011] The advantages and positive effects of the present invention are:

[0012] The homozygous strain of Arabidopsis thaliana overexpressing the GhEDC13 gene obtained by transgenic technology in the present invention has significantly improved tolerance to Verticillium wilt stress, and the gene-silenced cotton plant obtained by VIGS technology is significantly reduced by Verticillium wilt stress treatment. The above results show that GhEDC13 plays an important role in plant disease resistance. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments are briefly introduced below. It should be understood that the following drawings only illustrate the embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other relevant drawings can be obtained based on these drawings without paying creative work.

[0014] Figure 1 The invention provides a homozygous Arabidopsis thaliana line overexpressing the GhEDC13 gene;

[0015] Figure 2is the expression level of the GhEDC13 gene in the T2 generation transgenic positive strain of Arabidopsis thaliana overexpressing the GhEDC13 gene provided in the embodiment of the present invention;

[0016] Figure 3 The statistical results of the disease index of the wild-type and homozygous Arabidopsis thaliana strains overexpressing the GhEDC13 gene under the stress of Verticillium dahliae provided in the embodiments of the present invention;

[0017] Figure 4 TRV provided in the embodiment of the present invention: GhEDC13 silenced cotton plants show albino phenotype;

[0018] Figure 5 These are the TRV:GhEDC13 silenced plants target gene expression levels and disease index survey results provided by the embodiments of the present invention. DETAILED DESCRIPTION

[0019] Unless otherwise specified, the methods used in the following examples are all conventional methods.

[0020] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0021] Example 1 Cloning of cotton GhEDC13 gene

[0022] Total RNA was extracted from leaf tissue of upland cotton Zhongzhimian 2 (from the seed bank of Cotton Research Institute, Chinese Academy of Agricultural Sciences). After digesting gDNA with DNase I, the total RNA was reverse transcribed into first-strand cDNA using reverse transcriptase to obtain cDNA from leaf tissue of Zhongzhimian 2. Using this cDNA as a template, the specific primer OE_GhEDC13_PF: 5'-GTTCCAGACTACGCT GGTACC ATGAGCTTTCTTCGGCTC-3' (underlined is the recognition site of restriction endonuclease Kpn I) and OE_GhEDC13_PR: 5'-CATGATCTTTGTAATC GGATCC AAACCAAAACGCAGACTT-3' (the underline is the recognition site of the restriction endonuclease BamH I) was used as a primer for PCR amplification to obtain a PCR amplification product of about 690 bp, and a fragment 1 of about 690 bp was recovered; the plant expression vector pCAMBIA2300-35S was double-digested with restriction endonucleases Kpn I and BamH I, and a vector backbone 2 of about 9.8 k was recovered. The fragment 1 and the vector backbone 2 were connected by homologous recombination to obtain a recombinant plasmid pCAMBIA2300-35S:GhEDC13; the recombinant plasmid was sequenced, and the sequencing results showed that the recombinant plasmid contained the DNA molecule shown in sequence 1 in the sequence table (hereinafter named GhEDC13 gene).

[0023] Sequence 1:

[0024] ATGAGCTTTCTTCGGCTCTTGTCAGTTTTCCTTTTGTTCTTATCCTATGTAGTCATAGGATCAGCTGAGCAGTGTGGAAGGCAAGCAGGCGGTGCTCTTTGCCCCGGTGGTCTATGTTGTAGCCAAATTGGTTGGTGTGGCAGTACTGCTAACTACTGCACAGTTCCGGGTTGCCAAAGTCAGTGCAGCGGTAGTGGCCCTGCCCCTGGGCCTGGTGGGCTAACCAATCTTATATCAAGAGAGACGTTTGATCGGATGCTTTTGCATAGGGACGATGGGGGTTGTCCTGCCCGTGGCTTCTATACCTATGATGCTTTCATTGCTGCTGCACGTTCTTTTCCTGCCTTCGCTACAACTGGTTACCAAGCTACTCGGAAGAGGGAAATAGCTGCCTTCTTAGCCCAAACTTCCCATGAAACTACTGGTGGGGCAGGGTGGGCTGCACCGGATGGTCATTATGCATGGGGATACTGTTACAATAGGGAATTGAACCCTTCCCCTTACTGCGCTTGGAGTCCGAACTACCCTTGTGCTCCTGGTAAACAATATTTTGGCCGGGGTCCCATGCAACTTACTTGGAACTACAACTACGAGCAATGTGGACGGTCCATAGGGGTGGACTTGTTAAACAACCCAGACCTGCTATCAAGTGATCCCACAATTTCCTTCAAGTCTGCGTTTTGGTTTTGA

[0025] Example 2: Plant transformation and screening of Arabidopsis thaliana overexpressing the GhEDC13 gene

[0026] The recombinant vector pCAMBIA2300-35S: GhEDC13 obtained in Example 1 was transformed into Agrobacterium GV3101 competent cells and infected wild-type Arabidopsis thaliana (Col-0) by the floral dip method. The infiltration medium used for infection contained MS 4.3 g / L, sucrose 50 g / L (5%), MES 0.5 g / L, Silwet-77 200 μL / L (0.02%), and pH 5.7. The Arabidopsis inflorescence was placed in the transformation bacterial solution for 20 to 30 seconds, cultured in the dark for 24 hours after infection, and then transferred to normal conditions for culture. In order to improve the transformation efficiency, the infection was repeated once after 1 week, and the T0 generation seeds were harvested after the seeds matured.

[0027] After surface disinfection of T0 seeds, resistant seedlings were selected on 1 / 2 MS medium containing 50 mg / L kanamycin. After vernalization at 4°C for 3 days, the seedlings were transferred to an artificial climate incubator with conditions set at 22°C, 16h light / 8h dark. After about 10 days of culture in the selection medium, positive plants grew normally, while negative plants had yellow leaves and stopped growing. Positive seedlings were transplanted into nutrient pots, and T1 seeds were harvested after seeds matured. T1 seeds were germinated on kanamycin selection medium, and transgenic single-copy lines were identified by counting the separation ratio of seedling survival and death (about 3:1). T2 seeds were harvested after seeds matured. T2 seeds were germinated again on kanamycin selection medium, and transgenic homozygous lines were identified by counting seedling survival rate. Leaf samples of T2 seedlings were collected and PCR identification was performed using forward primers OE_GhEDC13_PF: 5'-GTTCCAGACTACGCTGGTACCATGAGCTTTCTTCGGCTC-3' and OE_GhEDC13_PR: 5'-CATGATCTTTGTAATCGGATCCAAACCAAAACGCAGACTT-3'. qRT-PCR analysis was performed using forward primers qGhEDC13_ PF: 5'-CTTATCCTATGTAGTCATAGG-3' and qGhEDC13_PR: 5'-GCAGCAGCAATGAAAGCATCA-3'. The expression level of the gene GhEDC13 was detected for strain screening, and three homozygous strains with high expression of GhEDC13 (OE-3, OE-5 and OE-9) were obtained. After the T2 seedlings grew to maturity, the T3 seeds were harvested for disease resistance phenotype identification, such as Figure 1-2 shown.

[0028] Example 3 Tolerance of Arabidopsis thaliana overexpressing GhEDC13 to Verticillium dahliae stress

[0029] After surface disinfection, wild-type and T3 generation Arabidopsis seeds overexpressing GhEDC13 were sown on 1 / 2 MS medium, vernalized at 4°C for 3 days, and moved to a growth chamber at 22°C with a photoperiod of 16h light / 8h dark. After 8 days, the seedlings were transplanted into nutrient pots, in which the ratio of vermiculite to nutrient soil was 2:1. Each culture pot was inoculated with 10 mL of Vd991 spore suspension (spore concentration was 1×107 cfu / mL). About 25 days after inoculation, the leaves of Arabidopsis began to turn yellow and wither, showing the characteristics of disease, and the disease index was calculated, such as Figure 3 shown.

[0030] Example 4 VIGS to verify the role of GhEDC13 in cotton resistance to Verticillium dahliae stress

[0031] RNA was extracted from the upland cotton strain Zhimian 2 and reverse transcribed into cDNA as a template. PCR amplification was performed using specific primers to construct a VIGS gene silencing vector. GAATTC CTTATCCTATGTAGTCATAGG (underlined is the recognition site of restriction endonuclease EcoR I) and reverse primer VIGS_PR: CGTGAGCTCGGTACC

[0032] GGATCC GCAGCAGCAATGAAAGCATCA (underlined is the recognition site of restriction endonuclease BamHI) GhEDC13 Gene VIGS fragment, using homologous recombinase to connect the VIGS fragment to the TRV vector double-digested with EcoR I and BamH I. The constructed TRV: GhEDC13 gene silencing vector was transformed into Agrobacterium GV3101, with CLCrVA: 00 Agrobacterium as negative control and TRV: PDS Agrobacterium as positive control. Before VIGS injection, the OD of the Agrobacterium solution should be 600 Adjust the value to 1.5.

[0033] Upland cotton Zhongzhimian No. 2 was used as the VIGS injection material. The seeds of Zhongzhimian No. 2 were planted in bottomless paper pots and placed in a greenhouse to grow at 28 ℃, 16h light / 8h dark conditions. When the two cotyledons of the seedlings were flat, VIGS injection was performed, the back of the cotyledons were gently scratched with a syringe needle, and the bacterial solution was injected into the entire cotyledon. After the injection, the plants were cultured in the dark for 24 hours, and then transferred to normal conditions for culture. After the plants grew three true leaves, they were subjected to Verticillium wilt stress treatment.

[0034] Example 5 Phenotypic Identification of Gene Silenced Cotton in Resistance to Verticillium Wilt Infection

[0035] TRV:00 (empty plants) and TRV: GhEDC13 (gene silenced plants) were inoculated with Verticillium wilt. Under control conditions, water treatment was applied. The growth of TRV:00 cotton plants and TRV: GhEDC13 silenced cotton plants was the same. After 25 days of inoculation, the disease index was investigated and statistically analyzed. The results showed that the disease resistance of cotton plants decreased after the GhEDC13 gene was silenced. Figure 4-5 shown.

[0036] The present invention compares the tolerance of wild-type Arabidopsis thaliana (WT) and transgenic Arabidopsis thaliana overexpressing GhEDC13 to Verticillium dahliae stress, and compares the plants treated with Verticillium dahliae stress. The results show that under Verticillium dahliae stress, the wild-type Arabidopsis thaliana exhibits obvious leaf chlorosis and stunted growth and development, while the Arabidopsis thaliana strain overexpressing GhEDC13 shows a better growth trend. The present invention also compares the tolerance of TRV:00 and gene-silenced plants (TRV: GhEDC13) to Verticillium dahliae stress, and the results show that the gene-silenced morphology and plant physiological and biochemical indicators are worse under Verticillium dahliae stress, indicating that the gene plays an enhancing role in plant resistance to Verticillium dahliae stress.

[0037] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. Application of cotton gene GhEDC13 in improving plant resistance to Verticillium wilt, wherein the CDS sequence of cotton gene GhEDC13 is shown in sequence 1, the plant is Arabidopsis thaliana or cotton, and the Verticillium wilt is caused by Verticillium dahliae ( Verticillium dahliae Kleb. ), and the application is to overexpress the cotton gene GhEDC13 in cotton or Arabidopsis, thereby improving the disease resistance of cotton or Arabidopsis to Verticillium wilt.

2. The use according to claim 1, characterized in that The use of a recombinant vector, an expression cassette, a transgenic cell line or a recombinant bacterium containing the GhEDC13 gene as shown in Sequence 1 in improving the Verticillium wilt resistance of target plants such as cotton or Arabidopsis.

Images