A type of Streptomyces boulardii and its application in the prevention and control of ginseng rust disease
Microbial preparations and biocontrol agents made from Streptomyces oryzae MS21 and its fermentation broth have solved the problem of ginseng rust disease control, achieving efficient and environmentally friendly disease control and significantly improving ginseng yield and quality.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-05
- Publication Date
- 2026-04-03
AI Technical Summary
The lack of effective biological agents to combat ginseng rust disease in existing technologies leads to frequent outbreaks of the disease, affecting ginseng yield and quality, and chemical agents are also environmentally unfriendly.
Microbial agents and biocontrol agents were prepared by using *Streptomyces gravidarum* MS21 and its fermentation broth, and applied to the rhizosphere soil of ginseng to inhibit the growth of *Ilyonectria robusta*, the pathogen causing ginseng rust rot. Antimicrobial substances such as actinomycin D, tobramycin, and surfactants were isolated and identified.
It effectively controls ginseng rust disease, with an inhibition rate of 63.41% and a control effect of 50.25% in pot experiments. It is environmentally friendly and avoids the negative effects of chemical pesticides.
Smart Images

Figure CN118956683B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of microbial technology, specifically to a type of Streptomyces oryzae and its application in the prevention and control of ginseng rust disease. Background Technology
[0002] The information disclosed in this background section is intended only to enhance understanding of the overall background of the invention and is not necessarily to be construed as an admission or in any way implying that such information constitutes prior art known to those skilled in the art.
[0003] Ginseng (Panax ginseng CAMeyer) is an herbaceous plant of the Araliaceae family. As a precious Chinese medicinal material, it is recorded in many pharmacopoeias and has a long history of application in the field of traditional Chinese medicine.
[0004] Long-term continuous cropping and improper use of pesticides have led to an increase in ginseng diseases, affecting ginseng yield and quality. Ginseng rust rot is a soil-borne fungal disease with a high incidence and severe severity among ginseng diseases. Ginseng rust rot is highly destructive to ginseng. The pathogen not only exists in the soil and rhizosphere but also exists as an endophyte in the ginseng root system. This fungal disease is also one of the main factors leading to continuous cropping obstacles in ginseng, and the occurrence of continuous cropping obstacles further increases the frequency of disease outbreaks, thus creating a vicious cycle.
[0005] Due to the adverse environmental and sustainable development effects of chemical agents, biological agents, as an environmentally friendly and sustainable control method, are receiving increasing attention. In recent years, with the enrichment of the application of biocontrol strains in disease prevention, research on biocontrol bacteria for ginseng rust has also been increasing. However, biocontrol bacteria with significant control effects against a single symptom of rust rot still need further exploration. Summary of the Invention
[0006] To overcome the above problems, the present invention provides a strain of Streptomyces gravidus and its application in the prevention and control of ginseng rust disease.
[0007] To achieve the above technical objectives, the present invention adopts the following technical solution:
[0008] In a first aspect, the present invention provides Streptomyces murinus MS21, which was deposited on August 2, 2024 at the China General Microbiological Culture Collection Center, with accession number CGMCC No. 31525.
[0009] The 16S rDNA sequence of Streptomyces gravidarum MS21 is shown in SEQ ID NO.1.
[0010] The morphological characteristics of *Streptomyces oryzae* MS21 in this invention are as follows: the colonies are round and white with yellow edges; the surface is dry, velvety, and raised; the hyphae are tightly spiraled in 1-3 turns, forked, and without breakage.
[0011] In a second aspect, the present invention provides a fermentation broth obtained by fermentation of *Streptomyces gravidarum* MS21 as described in the first aspect.
[0012] A third aspect of the present invention provides a method for preparing the above-mentioned fermentation broth, comprising:
[0013] (1) Streptomyces MS21 was inoculated into the culture medium and cultured in a shaker at 30°C for 2 days to obtain seed culture;
[0014] (2) The seed liquid was inoculated into the culture medium and fermented at 28-32℃ and 160-200r / min for 3 days to obtain the fermentation broth of Streptomyces oryzae MS21.
[0015] In one or more embodiments, the culture medium formulation includes: 36.7 g / L dextrin, 20 g / L yeast extract, and 4.3 g / L potassium dihydrogen phosphate.
[0016] A fourth aspect of the present invention provides a microbial preparation comprising the Streptomyces gravidarum MS21 described in the first aspect.
[0017] A fifth aspect of the present invention provides a biocontrol agent comprising *Streptomyces gravidarum* MS21 as described in the first aspect.
[0018] A sixth aspect of the invention provides the use of *Streptomyces griseus* MS21 of the first aspect and / or the fermentation broth of the second aspect and / or the microbial preparation of the third aspect and / or the biocontrol agent of the fourth aspect in any of the following:
[0019] (A1) Prevention and treatment of ginseng rust rot;
[0020] (A2) Prepare products for the prevention and treatment of ginseng rust disease.
[0021] A seventh aspect of the invention provides the use of *Streptomyces gravidarum* MS21 of the first aspect and / or the fermentation broth of the second aspect and / or the microbial preparation of the third aspect and / or the biocontrol agent of the fourth aspect in any of the following:
[0022] (B1) Inhibits plant pathogenic fungi;
[0023] (B2) Prepare products for inhibiting plant pathogenic fungi;
[0024] (B3) Prevention and control of diseases caused by plant pathogenic fungi;
[0025] (B4) Prepare products for the prevention and control of diseases caused by plant pathogenic fungi.
[0026] In one or more embodiments, the plant pathogenic fungus includes *Ilyonectria robusta*, the pathogen causing ginseng rust rot.
[0027] An eighth aspect of the present invention provides a method for preventing and controlling ginseng rust rot, comprising: applying the *Streptomyces griseus* MS21 provided in the first aspect and / or the fermentation broth described in the second aspect and / or the microbial preparation described in the third aspect and / or the biocontrol agent described in the fourth aspect to the rhizosphere soil of ginseng plants.
[0028] A ninth aspect of the invention provides the use of *Streptomyces gravidarum* MS21 of the first aspect in any of the following:
[0029] (C1) Catalyzes the decomposition of hydrogen peroxide;
[0030] (C2) Prepare products for catalytic decomposition of hydrogen peroxide.
[0031] The beneficial effects of this invention are as follows:
[0032] The *Streptomyces oryzae* MS21 strain described in this invention was isolated from rhizosphere soil samples from areas with continuous cropping obstacles and a high incidence of ginseng rust rot. Plate confrontation experiments showed that this strain exhibited a 63.41% inhibition rate against *Ilyonectria robusta*, the pathogen of ginseng rust rot. Furthermore, the inhibition of *Ilyonectria robusta* by *Streptomyces oryzae* MS21 was concentration-dependent. Purification of the fermentation broth of *Streptomyces oryzae* MS21 and analysis using liquid chromatography-mass spectrometry (LC-MS) based on database and ion fragmentation analysis revealed high concentrations of antibiotic-like substances in the metabolites of *Streptomyces oryzae* MS21, including actinomycin D, tobramycin, and surfactants, thus demonstrating the antibacterial effect of *Streptomyces oryzae* MS21. Pot experiments further verified that *Streptomyces oryzae* MS21 achieved a 50.25% control effect on ginseng rust rot in pots, therefore this strain can be used for the control of ginseng rust rot. Attached Figure Description
[0033] The accompanying drawings, which form part of this invention, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an improper limitation of the invention.
[0034] Figure 1 This is a colony morphology diagram of Streptomyces griseus MS21.
[0035] Figure 2 Microscopic image of hyphal morphology of Streptomyces oryzae MS21;
[0036] Figure 3 Gram staining image of Streptomyces oryzae MS21 (rat griseus);
[0037] Figure 4 This image shows the antagonistic effect of *Streptomyces gravidarum* MS21 on *Ilyonectria robusta*, the pathogen causing ginseng rust. Image a shows the results of *Ilyonectria robusta* growing on PDA plates at 20°C for 5 days; image b shows the verification of the antagonistic effect of *Streptomyces gravidarum* MS21 on *Ilyonectria robusta* after 5 days of growth on PDA plates at 20°C.
[0038] Figure 5 Phylogenetic tree construction results of Streptomyces gravidarum MS21;
[0039] Figure 6 Figure 1 shows the inhibition of mycelial growth of *Streptomyces gravidarum* MS21 fermentation supernatant on *Ilyonectria robusta*, the pathogen causing ginseng rust rot. In the figure, a, b, and c represent the ratios of fermentation supernatant to culture medium of strain MS21 as 1:3, 1:5, and 1:15, respectively.
[0040] Figure 7 The figure shows the inhibition of spore germination by fermentation supernatant of Streptomyces oryzae MS21 on ginseng rust pathogen Ilyonectria robusta. In the figure, a, b, and c represent the proportions of fermentation supernatant of strain MS21 as 50%, 30%, and 10%, respectively.
[0041] Figure 8 Figure 1. Antibacterial rate of fermentation broth of Streptomyces oryzae MS21 after extraction with different organic solvents;
[0042] Figure 9 Figure 1. Antibacterial rate of Streptomyces oryzae MS21 fermentation broth after n-butanol extraction at different pH values;
[0043] Figure 10 Results of using Streptomyces oryzae MS21 to prevent ginseng rust rot in potted plants (a: clear water control, b: pathogen treatment, c: Streptomyces oryzae MS21 + pathogen treatment). Detailed Implementation
[0044] It should be noted that the following detailed descriptions are exemplary and intended to provide further illustration of the invention. Unless otherwise specified, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.
[0045] It should be noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the scope of exemplary embodiments according to the invention. As used herein, the singular form is intended to include the plural form as well, unless the context clearly indicates otherwise. Furthermore, it should be understood that when the terms "comprising" and / or "including" are used in this specification, they indicate the presence of features, steps, operations, devices, components, and / or combinations thereof.
[0046] To enable those skilled in the art to better understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below with reference to specific embodiments.
[0047] Example 1
[0048] 1.1 Screening of Streptomyces griseus MS21
[0049] At a standardized ginseng cultivation base in Baishan City, Jilin Province, rhizosphere soil samples were collected from areas with continuous cropping obstacles and frequent ginseng rust disease. These samples were placed in resealable plastic bags and stored in a 4℃ incubator before being brought back to the laboratory for bacterial isolation. The soil was air-dried and passed through a 20-mesh sieve. 10g of the sample was weighed and placed in a 250mL Erlenmeyer flask containing glass beads and 90mL of sterile water. The flask was shaken thoroughly for 10–30 minutes, mixed well, and allowed to stand for 5 minutes. Under aseptic conditions, 1mL of the supernatant was taken, and 9mL of sterile water was added, followed by a 10:1 ratio. -3 10 -4 10 -5 Diluents were prepared using a gradient method. 100 μL of each concentration was added to the diluent and plated onto Gao's No. 1 agar plates using the plate dilution method. Each treatment was repeated three times, and the plates were incubated at 30°C for 24 hours. The purified actinomycetes were stored at -80°C.
[0050] Plate confrontation method: Inoculate an 8 mm diameter rust rot pathogen Ilyonectria robusta fungal cake in the center of a PDA plate, and inoculate a preliminarily screened strain 2 cm away from the edge of the pathogen. Incubate at 20℃ for 5 days and observe whether an inhibition zone appears.
[0051] Inhibition rate (%) = [(AB) / (A-8)] × 100%
[0052] (A: Diameter of *Ilyonectria robusta*, the pathogen causing ginseng rust rot, in the control group; B: Diameter of *Ilyonectria robusta*, the pathogen causing ginseng rust rot, in the treatment containing fermentation supernatant; the number 8 represents the diameter of the *Ilyonectria robusta* mycelial cake, in mm).
[0053] Streptomyces griseus MS21 was obtained through screening. The colonies of Streptomyces griseus MS21 were observed directly and under a microscope. The colony morphology results are as follows: Figure 1 As shown, when *Streptomyces griseus* MS21 was inoculated onto Gao's No. 1 solid medium, the morphological characteristics were as follows: colonies were round, white, with yellow edges; the surface was dry, velvety, and raised; the mycelial morphology was observed as follows. Figure 2 As shown, the hyphae are in a tight spiral shape of 1-3 turns, branched, and without breakage. Preliminary identification suggests that strain MS21 belongs to *Streptomyces*; Gram staining results are as follows. Figure 3 As shown, it is a Gram-positive bacterium.
[0054] The antagonistic effect of *Streptomyces gravidus* MS21 on *Ilyonectria robusta*, the pathogen causing ginseng rust, is as follows: Figure 4 As shown, its inhibition rate against the ginseng rust pathogen Ilyonectria robusta was 63.41%.
[0055] 1.2 Physiological and biochemical experiments and molecular biological identification of Streptomyces griseus MS21
[0056] Physiological and biochemical experiments of Streptomyces MS21 were conducted according to the "Streptomyces Identification Manual". The specific results are shown in Table 1.
[0057] Table 1. Physiological and biochemical experiments of *Streptomyces griseus* MS21 (Rat spp.)
[0058]
[0059] Note: In the table, "+" indicates that the strain can utilize the substance, "-" indicates that the strain cannot utilize the substance, and "++" indicates that the strain has a strong ability to utilize the substance.
[0060] As shown in Table 1, strain MS21 can utilize D-cellobiose, rhamnose, sucrose, glucose, fructose, and ONPG, and has catalase activity, all of which are positive. It cannot utilize maltose, trehalose, mannitol, sorbitol, tryptophan, methyl red, and is negative in VP test and gelatin liquefaction.
[0061] The strain MS21 was molecularly identified using 16S rDNA gene sequencing.
[0062] The 16S rDNA sequence of strain MS21 was determined by Shanghai Sangon Biotech Co., Ltd., and a phylogenetic tree was constructed using MEGA 5.0 software. The results are as follows: Figure 5 As shown in the figure, the results indicate that strain MS21 is most closely related to Streptomyces griseus in phylogeny.
[0063] The 16S rDNA sequence of Streptomyces griseus MS21 is as follows:
[0064] TGGTGGGATCTACCTGATTTGAGGTCGAGCTTTTTGTTGTCTCGCAAC
[0065] ACTCGCTCTCGGCCGCCAAGCGTCCCTGAAAAAAAGTCTAGTTCGCTCGG
[0066] CCAGCTTCGCTCCCTTTCAGGCGAGTCGCAGCTCCGACGCTCTTTACACGT
[0067] CGTCCGCTCCGCTCCCCCAACTCTGCGCACGCGCAAGATGGAAACGACGC
[0068] TCAAACAGGCATGCCCCCCGGAATGCCGAGGGGCGCAATGTGCGTTCAAG
[0069] AACTCGATGATTCACGATGGCTGCAATTCACACTAGGTATCGCATTTCGCTG
[0070] CGCTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTGTTT
[0071] GTTTTTCCTAAAATTCTCTTTGCCAATAATTGCTATATTCCACATTTTAAGGG
[0072] GTTGTGGTTTCCTTCCGCTCAAGCAATGGAATAATAAATCACAGTAATGGA
[0073] CCTTTCGGCGGTAACCCCTTCGGAAAGG.
[0074] Example 2: Inhibitory activity of Streptomyces oryzae MS21 fermentation broth against Ilyonectria robusta, the pathogen causing ginseng rust.
[0075] 2.1 Preparation of fermentation broth of Streptomyces griseus MS21:
[0076] (1) Inoculate Streptomyces MS21 into Gao's No. 1 liquid medium and culture it in a shaker at 30℃ and 180r / min for 2 days to obtain seed liquid;
[0077] (2) Inoculate the seed culture into Gao's No. 1 liquid culture medium at an inoculation rate of 1.5% (volume ratio) and culture it in a shaker at 30°C and 180 r / min.
[0078] 2.2 Preparation of fermentation supernatant of Streptomyces oryzae MS21: Take the fermentation broth of the above strain for 36 hours, centrifuge at 12000 rpm for 20 minutes, filter it with a sterile 0.22 μm filter to remove bacteria, and store it in a refrigerator at 4℃ for later use. After the PDA medium cooled to 40°C, the PDA medium was mixed with the fermentation supernatant of the biocontrol bacteria. 1 mL, 3 mL, and 5 mL of fermentation supernatant were added to 15 mL of PDA medium, respectively, to achieve a supernatant-to-PDA medium ratio of 1:15, 1:5, and 1:3. An equal volume of sterile water mixed with PDA medium served as a control. After the plates solidified, 8 mm pieces of *Ilyonectria robusta* mycelial cake were picked and placed on plates containing the fermentation supernatant. The plates were incubated at 20°C for 5 days. Mycelial growth was observed, and the mycelial diameter of *Ilyonectria robusta* was recorded. The inhibition rate of the fermentation supernatant on the mycelium of *Ilyonectria robusta* was calculated. Each treatment was repeated in triplicate.
[0079] Inhibition rate (%) = [(A-B) / (A-8)] × 100%
[0080] (A: Diameter of *Ilyonectria robusta*, the pathogen causing ginseng rust rot, in the control group; B: Diameter of *Ilyonectria robusta*, the pathogen causing ginseng rust rot, in the treatment containing fermentation supernatant; the number 8 represents the diameter of the *Ilyonectria robusta* mycelial cake, in mm).
[0081] The antibacterial results are shown in Table 2 and Figure 6 As shown.
[0082] Table 2. Effects of different concentrations of fermentation supernatant from strain MS21 on mycelial growth of *Ilyonectria rodbusta*, the pathogen causing ginseng rust.
[0083]
[0084] As shown in Table 2, the fermentation supernatant of strain MS21 inhibited the mycelial growth of Ilyonectria robusta, the pathogen causing ginseng rust, by 16.44%, 29.33%, and 56% at different concentrations (1:15, 1:5, and 1:3), respectively.
[0085] 2.3 Preparation of spore suspension of *Ilyonectria robusta*, the pathogen of ginseng rust rot: Take a plate of *Ilyonectria robusta*, a pathogen of ginseng rust rot, grown for 7 days, rinse the surface of the mycelium several times with sterile water, and filter the rinse liquid through sterilized filter paper to remove the hyphae; this is the spore suspension; store at 4℃ for later use; [The text abruptly ends here, likely due to an incomplete sentence or missing information.] Robusta spore suspension was mixed with biocontrol bacteria fermentation supernatant to achieve final supernatant concentrations of 10%, 30%, and 50%, respectively. An equal volume of sterile water mixed with the spore suspension served as a control. The mixture was incubated at 28°C for 30 min. 100 μL of the spore suspension treated with the biocontrol bacteria fermentation supernatant was then spread onto a PDA plate. The plate was incubated at 20°C for 5 days. Spore germination was observed, the number of germinating spores was recorded, and the inhibition rate of the biocontrol bacteria fermentation supernatant on the germination of Ilyonectria robusta spores was calculated. Each treatment was repeated in triplicate.
[0086] Inhibition rate (%) = (A - B) / A × 100%
[0087] (A: Number of spores germinating from *Ilyonectria robusta*, the pathogen causing ginseng rust, in the control group; B: Number of spores germinating from *Ilyonectria robusta*, the pathogen causing ginseng rust, in the treatment containing fermentation supernatant; unit: spores)
[0088] The results of antibacterial activity are shown in Table 3 and Figure 7 As shown.
[0089] Table 3. Effects of different concentrations of fermentation supernatant from strain MS21 on spore germination of *Ilyonectria rodbusta*, the pathogen causing ginseng rust.
[0090]
[0091] As shown in Table 3, the inhibition rates of the fermentation supernatant of strain MS21 on the germination of spores of Ilyonectria robusta, the pathogen of ginseng rust disease, were 33.33%, 51.56%, and 83.52% at different concentrations (10%, 30%, and 50%), respectively.
[0092] Example 3: Study on the antibacterial substance of Streptomyces griseus MS21
[0093] Preparation of fermentation broth of Streptomyces oryzae MS21:
[0094] (1) Inoculate Streptomyces MS21 into Gao's No. 1 liquid medium and culture it in a shaker at 30℃ and 180r / min for 2 days to obtain seed liquid;
[0095] (2) The seed liquid was inoculated into Gao's No. 1 liquid culture medium at an inoculation rate of 1.5% (volume ratio), and cultured in a shaker at 30℃ and 180r / min for 3 days. After fermentation, the bacterial cells were removed by centrifugation, and the supernatant was collected to obtain the fermentation broth of Streptomyces oryzae MS21.
[0096] The fermentation broth of *Streptomyces griseus* MS21 was initially purified using n-butanol and ethyl acetate extraction. The crude extract was then used in inhibition zone experiments, with blank n-butanol and ethyl acetate serving as controls. Results are as follows: Figure 8 As shown, the antibacterial effect of the crude extract of Streptomyces oryzae MS21 in organic solvents is more significant with n-butanol. This proves that the antibacterial substances of Streptomyces oryzae MS21 are significantly higher than those of ethyl acetate under the extraction conditions of n-butanol. Therefore, n-butanol was chosen to extract the fermentation broth of the biocontrol strain.
[0097] After determining that n-butanol would be the organic solvent used for purification, the pH of the extraction was optimized by extracting fermentation broths at different pH values with n-butanol. For example... Figure 9 As shown, the inhibition zone of Streptomyces gravidarum MS21 was significantly higher at pH 7 than at other pH treatments.
[0098] The crude extract of Streptomyces oryzae MS21 was concentrated and further purified. After experiments on the extraction conditions of the antibacterial substance, the crude extract of Streptomyces oryzae MS21 was purified using n-butanol at pH 7. After concentration and purification, the inhibition zone of the antibacterial substance extract was significantly improved. Therefore, this concentrated substance was selected for analysis by liquid chromatography-mass spectrometry (LC-LC / MC).
[0099] The results are shown in Table 4.
[0100] Table 4. LC-LC / MS analysis of substances in the fermentation supernatant of strain MS21
[0101]
[0102] Through liquid chromatography-mass spectrometry (LC-MS) analysis, based on database and ion fragmentation comparison, high concentrations of antibiotic-like substances were detected in the metabolites of strain MS21, including actinomycin D, tobramycin, and surfactant.
[0103] Example 4
[0104] The carbon source, nitrogen source and inorganic salts of strain MS21 based on bean sprout juice basal medium were optimized using single-factor experimental design and response surface methodology. The optimal culture medium formulation for strain MS21 under laboratory conditions was determined to be: dextrin 36.7 g / L, yeast extract 20 g / L and potassium dihydrogen phosphate 4.3 g / L.
[0105] Example 5
[0106] Experiment on the control of ginseng rust rot by Streptomyces oryzae MS21 in potted plants.
[0107] The treatment groups were (1) Streptomyces griseus MS21 bacterial suspension (adjusted to 1×10⁻⁶) 6 (1) 15 mL of cfu / mL + 15 mL of ginseng rust pathogen Ilyonectria robusta mycelial spore suspension; (2) 15 mL of ginseng rust pathogen Ilyonectria robusta mycelial spore suspension + 15 mL of equally diluted sterile culture medium; (3) CK treatment: pour 30 mL of diluted sterile culture medium.
[0108] Plants were dug up 45 days after inoculation, and the severity of ginseng disease was observed and recorded, and the disease index was calculated.
[0109] The severity of ginseng rust disease is divided into 6 levels, as shown in Table 5.
[0110] Table 5. Disease Severity Levels of Ginseng Rust Disease
[0111]
[0112] The disease index and prevention efficacy are calculated according to the following formulas:
[0113] Disease index = [∑(number of disease-grade plants × representative value) / (total number of plants × highest disease-grade representative value)] × 100%
[0114] Prevention efficacy (%) = (Control disease index - Treatment disease index) / Control disease index × 100%
[0115] The potted plant control efficacy of strain MS21 against ginseng rust rot is shown in the figure. Figure 10 According to Table 6, strain MS21 showed a 50.25% control effect on ginseng rust rot in potted plants, indicating that strain MS21 has a good control effect on ginseng rust rot.
[0116] Table 6. Results of potted plant control efficacy of strain MS21 against ginseng rust disease.
[0117]
[0118] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.
Claims
1. Streptomyces boulardii ( Streptomyces murinus MS21 was deposited on August 2, 2024 at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 31525.
2. A fermentation broth, characterized in that, It was obtained by fermentation of *Streptomyces gravidarum* MS21 as described in claim 1.
3. The method for preparing the fermentation broth according to claim 2, characterized in that, include: (1) Streptomyces MS21 was inoculated into the culture medium and cultured in a shaker at 30 °C for 2 days to obtain seed culture; (2) The seed liquid was inoculated into the culture medium and fermented for 3 days at 28~32°C and 160~200 r / min to obtain the fermentation broth of Streptomyces oryzae MS21.
4. The preparation method according to claim 3, characterized in that, The culture medium formula includes: 36.7 g / L dextrin, 20 g / L yeast extract, and 4.3 g / L potassium dihydrogen phosphate.
5. A microbial preparation, characterized in that, The microbial preparation includes Streptomyces gravidarum MS21 as described in claim 1.
6. A biocontrol agent, characterized in that, The biocontrol agent includes Streptomyces gravidarum MS21 as described in claim 1.
7. The application of the *Streptomyces gravidarum* MS21 according to claim 1 and / or the fermentation broth according to claim 2 and / or the microbial preparation according to claim 5 and / or the biocontrol agent according to claim 6 in any of the following: (A1) Prevention and control of ginseng rust pathogen Ilyonectria robusta Caused by ginseng rust disease; (A2) Preparation for the prevention and control of ginseng rust disease pathogens Ilyonectria robusta Products that cause ginseng rust disease.
8. The application of *Streptomyces gravidarum* MS21 according to claim 1 and / or the fermentation broth according to claim 2 and / or the microbial preparation according to claim 5 and / or the biocontrol agent according to claim 6 in any of the following: (B1) Inhibits plant pathogenic fungi; (B2) Prepare products for inhibiting plant pathogenic fungi; (B3) Prevention and control of diseases caused by plant pathogenic fungi; (B4) Prepare products for the prevention and control of diseases caused by plant pathogenic fungi. in, The plant pathogenic fungus is the pathogen causing ginseng rust rot. Ilyonectria robusta .
9. A method for preventing and controlling ginseng rust disease, characterized in that, include: Apply the *Streptomyces gravidarum* MS21 of claim 1 and / or the fermentation broth of claim 2 and / or the microbial preparation of claim 5 and / or the biocontrol agent of claim 6 to the rhizosphere soil of ginseng plants. The ginseng rust disease mentioned is caused by the ginseng rust pathogen. Ilyonectria robusta Caused by.
10. The use of the Streptomyces oryzae MS21 of claim 1 in any of the following: (C1) Catalytic decomposition of hydrogen peroxide; (C2) Prepare products for catalytic decomposition of hydrogen peroxide.
Citation Information
Patent Citations
Actinomycete TL-007 and application thereof
CN110819561A
Biocontrol flora CL92 for preventing and treating ginseng rust rot and promoting ginseng growth
CN118308268A