Aechmea fasciata AfGF14i gene, cloning method, expression vector and application
By cloning and expressing the AfGF14i gene of the dragonfly pineapple, it was determined that it promotes flowering in Arabidopsis, which solved the obstacles of pineapple ethylene flowering at high temperatures, and provided theoretical support for pineapple plant cultivation.
Patent Information
- Application Number
- CN202411243587.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-05
- Publication Date
- 2025-07-25
- Estimated Expiration
- 2044-09-05
AI Technical Summary
The prior art has failed to effectively use the dragonfly pineapple AfGF14i gene to promote flowering, and there are obstacles to pineapple ethylene flowering under high temperature conditions.
By extracting the total RNA of dragonfly pineapple, synthesize cDNA in reverse transcription, designing specific primers, obtaining full-length CDS of the AfGF14i gene using PCR method, and ligating it with the vector, transforming E. coli, constructing the expression vector CaMV35S-AfGF14i-yfp, transiently expressed on tobacco leaves, observing subcellular localization, overexpressing in Arabidopsis, and studying its effect on flowering.
The AfGF14i gene of dragonfly pineapple was successfully cloned, clarifying its subcellular location as cell membrane, and promoting flowering in Arabidopsis, providing a theoretical basis for studying the flowering mechanism of dragonfly pineapple, and providing a reference for the improvement of ethylene flowering technology in pineapple plant cultivation.
Smart Images

Figure CN118956897B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the fields of molecular biology and biotechnology, and relates to the cloning, construction of expression vector, subcellular localization of the AfGF14i gene of Aechmea fasciata, and its regulation on flowering. Background Art
[0002] Plants of the Bromeliaceae family are perennial monocotyledonous plants widely distributed in tropical and subtropical regions, including a total of 58 genera and more than 3,000 species. They can be divided into edible pineapples and ornamental pineapples in terms of uses. Ornamental pineapples, also known as pineapple flowers, are the third largest tropical flowers after orchids and anthuriums. They are deeply loved because of their diverse varieties, beautiful plant shapes, strange flower shapes, bright flower colors, and long flowering periods.
[0003] Aechmea fasciata is an ornamental pineapple of the genus Aechmea, also known as white-striped dragonfly coral, spotted powder pineapple or pink pineapple, and is a model crop of ornamental pineapples. The flowers of Aechmea fasciata are peach-red, blooming in layers, with a flowering period of up to several months. After the flowers wither, the pink bracts can still be maintained for several months, so it has extremely high ornamental value.
[0004] 14-3-3 proteins are a class of regulatory proteins widely present in eukaryotes and are highly conserved among different organisms. At present, it has been reported that 14-3-3 proteins are involved in regulating the flowering transition of plants in various crops such as Arabidopsis thaliana, rice, mango, potato, cotton, and apple. Existing studies have shown that 14-3-3 proteins, as "adapter molecules", connect the florigen FLOWERING LOCUST (FT) and the transcription factor FLOWERING LOCUSD (FD) to form a ternary complex - the florigen activation complex (FAC), which activates the expression of downstream floral meristem determination genes, thereby inducing flowering.
[0005] Through the analysis of the comparative transcriptome information of Aechmea fasciata, a fragment of the 14-3-3 gene was obtained. BLAST alignment showed that it had high homology with the GF14iota gene of the 14-3-3 protein family in other plants, so it was named AfGF14i. The CDS sequence of the gene was cloned by PCR and an expression vector was constructed. After transient expression on tobacco leaves, fluorescence microscopy detection showed that the subcellular localization of the protein encoded by the AfGF14i gene was the cell membrane. After overexpression in Arabidopsis thaliana, Arabidopsis thaliana flowered significantly earlier, indicating that the AfGF14i gene of Aechmea fasciata has the function of promoting flowering. Summary of the Invention
[0006] The technical problem to be solved by the present invention is to provide an AfGF14i gene of Aechmea fasciata. Specifically, the total RNA of Aechmea fasciata is extracted, reverse transcribed into cDNA, and used as a template. Specific primers are designed, and the full-length CDS of the AfGF14i gene is obtained by PCR method, and connected to a vector, transformed into Escherichia coli Trans-T1 competent cells, and positive clones are picked to obtain the AfGF14i gene of Aechmea fasciata. The full length of the CDS of this gene is 729 bp.
[0007] To achieve the above object, the technical solution of the present invention is: to provide an AfGF14i gene of Aechmea fasciata, and the gene sequence has the nucleotide sequence shown in SEQ ID NO.1 in the sequence listing.
[0008] Another object of the present invention is to provide a cloning method for the AfGF14i gene of Aechmea fasciata, including the following steps:
[0009] (1) Using Aechmea fasciata as the material, total RNA is extracted by the CTAB method;
[0010] (2) Cloning of the AfGF14i gene;
[0011] (2-1) Synthesis of cDNA template using One-Step gDNA Removal and cDNA Synthesis SuperMix (Transgene) kit, and reserved as a PCR template;
[0012] (2-2) Design primers for amplifying the full-length CDS;
[0013] Primers for cloning the full length of the CDS of the AfGF14i gene
[0014] Primer Name Sequence (5′-3′) Tm (℃) AfGF14i-F ATGGAGAGGGAGAACCATGT 57.0 AfGF14i-R TTATTCTACATTACCTCCATCCTCAGG 56.7
[0015] (2-3) After optimizing the PCR conditions according to the Tm value of the primers, PCR amplification is carried out, and the obtained product is ligated to a vector, and transformed into Escherichia coli competent Trans-T1, and sequenced after colony PCR identification.
[0016] The PCR system and conditions are as follows:
[0017] Ingredient Amount (μL) 2×TaqMasterMix 25 Forward Primer (10μM) 2 Reverse Primer (10μM) 2 <![CDATA[ddH2O]]> 20 cDNA 1 Total volume 50
[0018]
[0019] The obtained full-length CDS is 729 bp, encoding a sequence of 243 amino acids. Comparing this amino acid sequence in the international gene bank indicates that it has a conserved functional domain of the 14-3-3 family, and the amino acid homologies with the published GF14iota proteins of pineapple, oil palm, and Coffea arabica are 98%, 98%, and 91% respectively.
[0020] Furthermore, the extraction of total RNA in step (1) is specifically as follows:
[0021] (1-1) The mortar used in the experiment process needs to be sterilized at 180 °C for 5 h in advance, and after cooling to room temperature, it is reserved for use. The pipette and the experimental bench need to be wiped with alcohol, and the centrifuge tubes and pipette tips are free of RNase;
[0022] (1-2) Take 850 μL of CTAB buffer into a 2 mL centrifuge tube and preheat it in a 65 °C water bath;
[0023] (1-3) Weigh about 0.2 g of the material into a mortar with liquid nitrogen and grind it thoroughly. After the material is ground into a powder, it can be transferred into the CTAB buffer preheated in (1-2). Before adding the material, first add 25 μL of β-mercaptoethanol;
[0024] (1-4) Vortex for 30 s to mix thoroughly and incubate in a 65 °C water bath for 6 min;
[0025] (1-5) Add an equal volume of chloroform / isoamyl alcohol (24:1), shake vigorously, open the lid to release gas, vortex for 30 s, and centrifuge at 11000 rpm for 15 min at room temperature;
[0026] (1-6) Pipette the supernatant into a new 2 mL centrifuge tube, add an equal volume of chloroform / isoamyl alcohol (24:1) and extract again, vortex for 30 s, and centrifuge at 11000 rpm for 15 min at room temperature;
[0027] (1-7) Pipette the supernatant into a new 1.5 mL centrifuge tube, add 1 / 3 volume of 8 M LiCl, invert to mix evenly, and precipitate at 4 °C for 10 - 12 h;
[0028] (1-8) Centrifuge at 11000 rpm for 30 min at 4 °C and discard the supernatant;
[0029] (1-9) Add 1 mL of 75% ethanol prepared with DEPC water, gently shake the centrifuge tube, centrifuge at 8000 rpm for 5 min at 4 °C, and discard the supernatant. Repeat twice to wash the precipitate thoroughly;
[0030] (1-10) After air-drying the precipitate in a laminar flow hood, add 30 - 40 μL of RNase-free water to dissolve the precipitate.
[0031] (1-11) The concentration and purity of RNA were determined using a SimpliNano micro-spectrophotometer. 2 μL of the sample was taken and the RNA quality was detected by 1.2% agarose gel electrophoresis. The RNA samples were stored at -80 °C for future use and downstream experiments were carried out as soon as possible to avoid RNA degradation.
[0032] Furthermore, the amplification primers in step (2-2) include the sequences of AfGF14i-F and AfGF14i-R, which are shown as SEQ ID NO.2 and SEQ ID NO.3 in the sequence listing respectively.
[0033] Another object of the present invention is to also provide a high-efficiency expression vector containing the AfGF14i gene of Aechmea fasciata as the target gene.
[0034] Furthermore, the vector of the present invention is obtained by inserting the AfGF14i gene of Aechmea fasciata into the plant expression vector CaMV35S-yfp to construct a high-efficiency expression vector containing the AfGF14i gene of Aechmea fasciata downstream of the CaMV35S promoter.
[0035] The construction of the above-mentioned AfGF14i gene expression vector of Aechmea fasciata is specifically carried out according to the following steps:
[0036] (1) According to the sequenced CDS sequence of the AfGF14i gene, the upstream primer P1 with a 27 bp homologous recombination linker containing a Kpn I restriction site added at the 5' end (specifically shown as SEQ ID NO.4 in the sequence listing: 5'-CTCTCGAGCTTTCGCGAGCTCGGTACCATGGAGAGGGAGAACCAT GT-3') and the downstream primer P2 with a 27 bp homologous recombination linker containing an Xba I restriction site (specifically shown as SEQ ID NO.5 in the sequence listing: 5'-GGGACCGGTCCTCGAGACGTCTCTAGATTCTACATTACCTCCATCCTCAGGC-3') were designed.
[0037] (2) Using the plasmid with the correctly verified AfGF14i gene sequencing as the template, the full-length CDS with vector homologous arms was amplified by PCR.
[0038] (3) The CaMV35S-yfp vector was linearized using Kpn I and Xba I restriction endonucleases.
[0039] (4) A recombinant vector was constructed using the ClonExpressTM II One Step Cloning Kit (Vazyme).
[0040] (5) After verification by colony PCR and sequencing, the overexpression vector CaMV35S-AfGF14i-yfp of the AfGF14i gene was obtained.
[0041] The present invention also provides the subcellular localization of the protein encoded by the AfGF14i gene of Aechmea fasciata.
[0042] Specifically, the subcellular localization of the protein encoded by the AfGF14i gene was analyzed by transient expression on tobacco leaves. After the constructed expression vector CaMV35S-AfGF14i-yfp carrying the CDS sequence of the AfGF14i gene was transferred into Agrobacterium tumefaciens EHA105, the tobacco leaves of Nicotiana benthamiana were injected, and the distribution of fluorescence signals was observed using a laser confocal microscope to determine the subcellular localization of the AfGF14i protein. It was observed that the AfGF14i protein was distributed on the cell membrane.
[0043] The present invention also provides the application of the AfGF14i gene of Aechmea fasciata in plant flowering, specifically the effect on the flowering of Arabidopsis thaliana.
[0044] Specifically, Arabidopsis thaliana was transformed by the Agrobacterium-mediated method. After the constructed expression vector CaMV35S-AfGF14i-yfp carrying the CDS sequence of the AfGF14i gene was transferred into Agrobacterium tumefaciens EHA105, the inflorescences of wild-type Arabidopsis thaliana Columbia (Col-0) were infected, and the T0 generation of transgenic seeds was harvested. After disinfecting the T0 generation seeds, they were sown on MS solid medium containing 30 mg / L hygromycin for resistance screening to obtain T1 generation transgenic positive plants. The seeds of the T1 generation were continuously sown on MS solid medium containing 40 mg / L hygromycin for resistance screening to obtain T2 generation transgenic positive plants, and single-plant seeds were harvested. The seeds of the T2 generation were continuously subjected to resistance screening, and whether the T3 generation phenotypes were segregated and whether they were homozygous plants were identified at the molecular level. It was observed that compared with wild-type Arabidopsis thaliana, the transgenic positive lines of the T3 generation flowered significantly earlier.
[0045] The beneficial effects of the present invention:
[0046] In the present invention, the CDS sequence of the AfGF14i gene was constructed into the plant expression vector CaMV35S-yfp to construct a new plant expression vector named CaMV35S-AfGF14i-yfp. This gene affects the flowering of Arabidopsis thaliana. Therefore, the acquisition of the AfGF14i gene lays a foundation for studying the flowering mechanism of Aechmea fasciata and provides a theoretical reference for improving the ethylene flower induction technology in the cultivation of pineapple plants, having important theoretical and practical significance. Description of the Drawings
[0047] Figure 1It is the result diagram of protein subcellular localization. In the figure, YFP is the control, that is, the fluorescence distribution of YFP protein in tobacco leaves infected by Agrobacterium tumefaciens carrying the empty vector CaMV35S-yfp. AfGF14i-YFP is the fluorescence distribution of AfGF14i-YFP fusion protein in tobacco leaves infected by Agrobacterium tumefaciens carrying the vector CaMV35S-AfGF14i-yfp.
[0048] Figure 2 It is agarose gel electrophoresis. In the figure, 35S::AfGF14i#1, 35S::AfGF14i#2, and 35S::AfGF14i#3 are the electrophoresis results of PCR detection using transgenic Arabidopsis cDNA as a template and specific primers AfGF14i-F / R. WT is the electrophoresis result of PCR detection using wild-type Arabidopsis cDNA as a template and specific primers AfGF14i-F / R.
[0049] Figure 3 It is the flowering phenotype of Arabidopsis thaliana. In the figure, 35S::AfGF14i is transgenic Arabidopsis thaliana overexpressing AfGF14i, and WT is wild-type Arabidopsis thaliana. Detailed implementation manners
[0050] The features and advantages of the present invention can be further understood through the following detailed description. The provided examples are only illustrative of the methods of the present invention and do not limit the remaining content disclosed by the present invention in any way. The experimental methods in the following examples are all conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples can be obtained from commercial sources unless otherwise specified.
[0051] Example 1: Cloning method of Tillandsia dyeriana genes
[0052] 1. Extraction of total RNA: Improved CTAB method.
[0053] (1) The mortar used in the experiment needs to be sterilized at 180 °C for 5 h in advance, and after cooling to room temperature, it can be used. The pipette and the experimental table need to be wiped with alcohol. The centrifuge tubes and pipette tips are all free of RNase.
[0054] (2) Take 850 μL of CTAB buffer into a 2 mL centrifuge tube and preheat it in a 65 °C water bath.
[0055] (3) Weigh about 0.2 g of the material and grind it thoroughly in a mortar containing liquid nitrogen. After the material is ground into a powder, it can be transferred into the preheated CTAB buffer in (2). Before adding the material, first add 25 μL of β-mercaptoethanol.
[0056] (4) Vortex for 30 s to mix thoroughly and incubate in a 65 °C water bath for 6 min.
[0057] (5) Add an equal volume of chloroform / isoamyl alcohol (24:1), shake vigorously, open the lid to release gas, vortex for 30 s, and centrifuge at 11,000 rpm for 15 min at room temperature;
[0058] (6) Pipette the supernatant into a new 2-mL centrifuge tube, add an equal volume of chloroform / isoamyl alcohol (24:1) and extract again, vortex for 30 s, and centrifuge at 11,000 rpm for 15 min at room temperature;
[0059] (7) Pipette the supernatant into a new 1.5-mL centrifuge tube, add 1 / 3 volume of 8 M LiCl, invert to mix well, and precipitate at 4 °C for 10 - 12 h;
[0060] (8) Centrifuge at 11,000 rpm for 30 min at 4 °C, discard the supernatant;
[0061] (9) Add 1 mL of 75% ethanol prepared with DEPC water, gently shake the centrifuge tube, centrifuge at 8,000 rpm for 5 min at 4 °C, and discard the supernatant. Repeat twice to wash the precipitate thoroughly;
[0062] (10) After air-drying the precipitate in a laminar flow hood, add 30 - 40 μL of RNase-free water to dissolve the precipitate;
[0063] (11) Measure the concentration and purity of RNA using a SimpliNano micro-spectrophotometer, take 2 μL of the sample and detect the RNA quality by 1.2% agarose gel electrophoresis. Store the RNA sample at -80 °C for later use and perform downstream experiments as soon as possible to avoid RNA degradation.
[0064] 2. Cloning and sequence analysis of the AfGF14i gene
[0065] (1) Use the One-Step gDNA Removal and cDNA Synthesis SuperMix Kit from Transgene to reverse transcribe RNA into cDNA as a template for PCR.
[0066] (2) Design primers for full-length cDNA amplification:
[0067] AfGF14i-F: ATGGAGAGGGAGAACCATGT
[0068] AfGF14i-R: TTATTCTACATTACCTCCATCCTCAGG
[0069] (3) After optimizing the PCR conditions according to the Tm values of the primers, perform PCR amplification according to the method described in Item 1 of the invention content, and ligate the obtained product to The vector was identified by PCR and then subjected to sequence determination. The nucleotide sequence is as follows:
[0070] ATGGAGAGGGAGAACCATGTTTACTTGGCGAAGCTCGCGGAGCAAGCCGAGCGATACGAC 60
[0071] GAAATGGTTGAAAGCATGAAGAATGTAGCCAAGCTTGATGTGGAGCTGACGGTAGAGGAG 120
[0072] AGGAACCTCCTTTCGGTGGGTTACAAAAATGTCATTGGGGCCCGCCGAGCGTCGTGGCGT 180
[0073] ATCATGTCCTCTATTGAGCAGAAAGAAGAATCGAAAGGGAATGAACAAAATGTTAAACTA 240
[0074] ATCAAGGGTTACTGCCAGAAAGTCGAAGAGGAGCTTACCAAGATTTGCAATGATATCTTG 300
[0075] TCCATCATTGATCAGCATCTGATCCCTTCTTCCGGCTCTGGAGAATCTACAGTTTTTTAT 360
[0076] TATAAGATGAAGGGTGACTACTATCGCTACCTTGCGGAGTTTAAGACTGAACAAGAAAGG 420
[0077] AAAGAGGCTGCTGATCAATCTTTGAAGGCCTATCAGGCTGCCTCAAACACAGCCAACACC 480
[0078] GATCTGCCCCCGACCCATCCTATCCGACTTGGTCTCGCCCTCAACTTCTCTGTCTTCTAT 540
[0079] TATGAAATCATGAATTCCCCCGAGAGGGCTTGTCATCTAGCAAAGCAAGCCTTTGATGAG 600
[0080] GCAATTGCGGAGCTGGATACCTTAAGCGAGGAGTCGTACAAGGATAGCACTTTGATCATG 660
[0081] CAGTTGCTGAGAGACAATCTTACTCTCTGGACTTCTGATTTGCCTGAGGATGGAGGTAAT 720
[0082] GTAGAATAA 729
[0083] (4) Homologous retrieval: Use the BLAST online tool to compare the isolated sequence with the sequences in Genebank.
[0084] Example 2: Construction of the plant expression vector CaMV35S-yfp of the AfGF14i gene of Aechmea fasciata
[0085] 1. According to the CDS sequence of the isolated AfGF14i gene of Aechmea fasciata, design primers:
[0086] P1: 5’-CTCTCGAGCTTTCGCGAGCTCGGTACCATGGAGAGAGAA
[0087] CCATGT-3’
[0088] P2: 5’-GGGACCGGTCCTCGAGACGTCTCTAGATTCTACATTACCT
[0089] CCATCCTCAGGC-3’
[0090] Use the cDNA reverse transcribed from total RNA as a template for PCR reaction.
[0091] 2. Linearize the CaMV35S-yfp vector using Kpn I and Xba I restriction endonucleases. After purifying and recovering the above PCR products, ligate them with the linear vector. The operation steps are carried out according to the instructions of the ClonExpressTM II One Step Cloning Kit of Vazyme Company. The reaction system is as follows:
[0092] Component Volume <![CDATA[ddH2O]]> Up to 20μL 5×CEII Buffer 4μL Linearized Cloning Vector 50 - 200μg Insert Fragment Amplification Product 20 - 200μg <![CDATA[Exnase TM II]]> 2μL
[0093] After the system is prepared, gently pipette and mix it with a pipette gun to avoid generating bubbles. Place it on a PCR instrument and react at 37°C for 30 min. After the reaction is completed, immediately place the reaction tube on ice for cooling for 5 min.
[0094] 3. Transform the ligation product into E. coli Trans-T1 competent cells and culture overnight on an LB solid plate containing kanamycin (50 μg / mL). Pick monoclonal colonies for PCR identification, and further sequence verification for the positive single colonies identified by PCR. Name the constructed recombinant vector as CaMV35S-AfGF14i-yfp.
[0095] Example 3: Subcellular localization analysis of the protein encoded by the AfGF14i gene
[0096] 1. Agrobacterium transformation of the recombinant vector
[0097] (1) After thawing the EHA105 competent cells stored in an -80 °C refrigerator on ice, add 1 μg of the recombinant vector carrying the AfGF14i gene, and gently mix by flicking the bottom of the tube with your finger.
[0098] (2) Incubate on ice for 5 min, in liquid nitrogen for 5 min, in a 37 °C water bath for 5 min, and on ice for 5 min in sequence.
[0099] (3) After melting, add 800 μL of LB liquid medium and culture at 28 °C for 3 - 5 h.
[0100] (4) Centrifuge at 5000 rpm for 5 min, remove an appropriate amount of the supernatant, then gently pipette and mix the remaining supernatant and the pellet, and evenly spread them on an LB plate containing 50 μg / mL rifampicin and 50 μg / mL kanamycin. Incubate upside down at 28 °C for 2 - 3 d.
[0101] 2. transient expression
[0102] (1) Preparation of the Agrobacterium induction buffer: Take 1 mL of 1 M MES-KOH, 1 mL of 1 M MgCl2, and 100 μL of 150 mM acetosyringone, and make up to 100 mL with sterile water. The induction buffer needs to be prepared freshly before use.
[0103] (2) Culture the Agrobacterium carrying the CaMV35S-AfGF14i-yfp vector overnight at 28 °C and 200 rpm in an LB liquid medium containing 50 μg / mL rifampicin and 50 μg / mL kanamycin.
[0104] (3) Transfer 1% of the culture to a new LB liquid medium containing 50 μg / mL rifampicin and 50 μg / mL kanamycin and reculture until the OD600 reaches 1.5 - 2.0.
[0105] (4) Centrifuge at 4000 rpm for 10 min, discard the supernatant, and collect the bacterial cells. Resuspend the bacterial cells with an appropriate amount of sterile water, centrifuge at 4000 rpm for 10 min, discard the supernatant, and repeat twice to wash the bacterial cells.
[0106] (5) Resuspend the bacterial cells with Agrobacterium induction buffer and adjust the OD600 to about 0.8;
[0107] (6) Incubate in the dark at 28 °C for 2 - 4 h;
[0108] (7) Inject the bacterial suspension into the abaxial surface of Nicotiana benthamiana leaves at the 4 - 8 leaf stage using a needleless syringe, and inject 6 leaves for each combination;
[0109] (8) After injection, place the tobacco back into the original growth environment and spray water to maintain humidity for 2 - 3 d.
[0110] 3. Protein subcellular localization analysis
[0111] Two to three days after inoculating tobacco leaves with Agrobacterium carrying the target gene, use a ZEISS LSM700 laser confocal microscope to observe the fluorescence of the inoculated tobacco leaves. The results show that the yellow fluorescence is mainly concentrated in the cell membrane, indicating that the protein encoded by AfGF14i is subcellularly localized in the cell membrane. The specific results are shown in Figure 1 .
[0112] Example 4: Identification of the flowering function of the AfGF14i gene
[0113] 1. Plant wild-type Arabidopsis thaliana
[0114] (1) Vernalize the wild-type Arabidopsis thaliana seeds at 4 °C for 3 - 4 d after appropriate drying;
[0115] (2) Sterilize the nutrient soil and vermiculite for planting Arabidopsis thaliana at 98 kPa and 121 °C for 30 min to kill the internal insect eggs, and mix them evenly at a ratio of 1:1 after cooling for later use;
[0116] (3) Sow the vernalized seeds into small flower pots, sowing 3 - 4 seeds per pot. After sowing, cover with plastic wrap to maintain humidity, which is beneficial to seed germination. Remove the plastic wrap when observing that the seeds grow four true leaves, and thin out the seedlings;
[0117] (4) During the seedling raising period, water 2 - 3 times a week to keep the soil moist and no water accumulates at the bottom of the tray, and pour 1 - 2 times of nutrient solution before bolting;
[0118] 2. Transform Arabidopsis thaliana by the floral dip method
[0119] (1) When the flower stem of Arabidopsis thaliana grows to 3 - 5 cm after bolting, remove the main inflorescence to promote the development of the secondary inflorescence. Four to eight days later, when the secondary inflorescence forms and only a few peripheral flowers in the whole flower disk are open while most flowers are not open or showing white, it is the best time for transgenic. Water more the day before infection to fully open the stomata;
[0120] (2) Resuspend the Agrobacterium cells carrying the AfGF14i gene recombinant vector in 3 - 5 mL of LB liquid medium containing 100 μg / mL rifampicin and 25 μg / mL kanamycin, culture at 28 °C and 200 rpm for 24 h;
[0121] (3) Transfer 1% of the culture to 100 mL of LB liquid medium, culture at 28 °C and 200 rpm for 12 h;
[0122] (4) Centrifuge at 4 °C and 5000 rpm for 15 min to collect the cells;
[0123] (5) Prepare the infection solution: Suspend the cell pellet in 5% (w / v) sucrose solution to an OD600 ≈ 0.8, add 0.02% Silwet L - 77, and keep on ice for later use;
[0124] (6) Immerse the Arabidopsis inflorescences in the infection solution for 40 s. After infection, culture in the dark for 24 h first and then transfer to light for cultivation;
[0125] (7) Repeat the infection 3 - 5 times, with an interval of 5 - 6 days between each infection. Cut and collect the mature pods to obtain the transgenic Arabidopsis seeds, which are the T0 generation. After drying, store at 4 °C for later use;
[0126] 3. Screening of transgenic plants
[0127] (1) Sterilize the T0 generation Arabidopsis seeds in a laminar flow hood:
[0128] (1 - 1) Place the seeds in a sterile 1.5 mL centrifuge tube, add 1 mL of 75% ethanol, soak for 4 min, centrifuge briefly and discard the ethanol;
[0129] (1 - 2) Add 1 mL of 84 disinfectant, soak for 6 min, centrifuge briefly and discard the disinfectant;
[0130] (1 - 3) Wash the seeds 4 - 5 times with sterile water until the 84 disinfectant is completely removed.
[0131] (2) Suspend the sterilized seeds in an appropriate amount of sterile water. Pipette the seeds and spot them onto MS solid medium containing 30 mg / L hygromycin;
[0132] (3) Vernalize at 4 °C in the dark for 48 h, then transfer to a climate chamber and culture at 23 °C under a light cycle of 16 h light / 8 h dark;
[0133] (4) Approximately two weeks later, select resistant plants with normal true leaves and root development and transplant them into the cultivation substrate for continued cultivation. The cultivation substrate is fully hydrated before transplantation, covered with plastic wrap after transplantation, and the plastic wrap is removed after about 3 days. Thereafter, the management is the same as above. Harvest the T2 generation seeds, make good marks, and continue screening until homozygous transformed plants are obtained.
[0134] 4. Molecular Identification of Transgenic Plants
[0135] Extract total RNA from the leaves of transgenic and wild-type Arabidopsis thaliana and reverse transcribe it into cDNA. Using cDNA as a template, perform PCR detection with specific primers AfGF14i-F / R. Agarose gel electrophoresis shows that the target gene band is amplified in transgenic Arabidopsis thaliana plants, while no band is observed in wild-type Arabidopsis thaliana, indicating that the gene AfGF14i has been successfully transferred into Arabidopsis thaliana. For the specific electrophoresis results, see Figure 2 .
[0136] 5. Observation of Transgenic Phenotypes
[0137] Figure 3 This is the flowering phenotype result diagram of Arabidopsis thaliana. Observe transgenic Arabidopsis thaliana at different growth stages and find that, compared with the wild type, Arabidopsis thaliana overexpressing AfGF14i flowers significantly earlier, indicating that the high expression of AfGF14i promotes the flowering of Arabidopsis thaliana, which is in line with the theoretical speculation.
[0138] The above-disclosed are only the preferred embodiments of the present invention. Of course, the scope of the present invention cannot be limited thereby. Therefore, equivalent changes made according to the claims of the present invention still fall within the scope covered by the present invention.
Claims
1. A Vriesea AfGF14i gene, characterized in that: The nucleotide sequence of this gene is shown as SEQ ID NO.1 in the sequence listing.
2. A cloning method for the genes of Aechmea fasciata AfGF14i which is characterized in that It includes the following steps: (1) Using Aechmea fasciata as the material, total RNA was extracted by the CTAB method; (2) AfGF14i Cloning of genes: (2-1) Reverse transcribe RNA into cDNA using Transcript-Uni One-Step gDNA Removal and cDNA Synthesis SuperMix Kit from Transgene for later use as a PCR template; ® - Use Transcript-Uni One-Step gDNA Removal and cDNA Synthesis SuperMix Kit from Transgene to reverse transcribe RNA into cDNA for later use as a PCR template; (2-2) Design primers for amplifying full-length cDNA; (2-3) After optimizing the PCR conditions according to the Tm values of the primers, PCR amplification was carried out, and the obtained product was transformed into Escherichia coli. After PCR identification, sequence determination was performed; The Aechmea fasciata AfGF14i The nucleotide sequence of the gene is shown as SEQ ID NO.1 in the sequence listing.
3. The Tillandsia ionantha according to claim 2 AfGF14i The gene cloning method is characterized in that The specific extraction of total RNA in step (1) is as follows: (1-1) The mortar used in the experiment needs to be sterilized at 180 °C for 5 h in advance, and after cooling to room temperature, it is reserved for use. The pipette and the experimental bench need to be wiped with alcohol. The centrifuge tubes and pipette tips are free of RNase; (1-2) Take 850 μL of CTAB buffer into a 2 mL centrifuge tube and preheat it in a 65 °C water bath; (1-3) Take 0.2 g of the material and grind it thoroughly in a mortar with liquid nitrogen. After the material is ground into a powder, it can be transferred into the CTAB buffer preheated in (1-2). Before adding the material, first add 25 μL of β-mercaptoethanol; (1-4) Vortex for 30 s to mix well, and incubate in a 65 °C water bath for 6 min; (1-5) Add an equal volume of chloroform / isoamyl alcohol, and the volume ratio of chloroform to isoamyl alcohol is 24:1; shake vigorously, open the lid to release gas, vortex for 30 s, and centrifuge at 11000 rpm for 15 min at room temperature; (1-6) Pipette the supernatant into a new 2 mL centrifuge tube, add an equal volume of chloroform / isoamyl alcohol and extract again, and the volume ratio of chloroform to isoamyl alcohol is 24:1; vortex for 30 s and centrifuge at 11000 rpm for 15 min at room temperature; (1-7) Pipette the supernatant into a new 1.5 mL centrifuge tube, add 1 / 3 volume of 8 M LiCl, invert to mix well, and precipitate at 4 °C for 10 - 12 h; (1-8) Centrifuge at 11000 rpm for 30 min at 4 °C, and discard the supernatant; (1-9) Add 1 mL of 75% ethanol prepared with DEPC water, gently shake the centrifuge tube, centrifuge at 8000 rpm for 5 min at 4 °C, discard the supernatant, and repeat twice to thoroughly wash the precipitate; (1-10) After air-drying the precipitate in a laminar flow hood, add 30 - 40 μL of RNase-free water to dissolve the precipitate; (1-11) Use a SimpliNano micro-spectrophotometer to measure the concentration and purity of RNA. Take 2 μL of the sample and detect the RNA quality by 1.2% agarose gel electrophoresis. The RNA sample is stored at -80 °C for future use.
4. The cloning method of the gene of Aechmea fasciata according to claim 2 AfGF14i , characterized in that The full-length cDNA amplification primers designed in step (2-2) include AfGF14i -F and AfGF14i -R primers, and the sequences are shown as SEQ ID NO.2 and SEQ ID NO.3 in the sequence listing respectively.
5. A Vriesea AfGF14i gene expression vector, characterized in that: An expression vector containing the gene of the Aechmea fasciata described in claim 1 AfGF14i as the target gene.
6. The Aechmea fasciata according to claim 5 AfGF14i A gene expression vector, characterized in that: using the Aechmea fasciata described in claim 1 AfGF14i to ligate the gene into the plant expression vector CaMV35S-yfp, and construct an expression vector containing the Aechmea fasciata AfGF14i gene downstream of the CaMV35S promoter.
7. The Aechmea fasciata according to claim 6 AfGF14i The gene expression vector is characterized in that: According to the sequenced AfGF14i gene sequence, upstream primer P1 with a 27-bp homologous recombination linker containing Kpn I restriction site at the 5' end and downstream primer P2 with a homologous recombination linker containing Xbal I restriction site were designed. Using the plasmid with correct gene sequencing verification as the template, the full length was amplified by PCR, and the CaMV35S-yfp vector was linearized with AfGF14i I and Kpn I restriction endonucleases. The recombinant vector was constructed using the ClonExpressTMII One Step Cloning Kit. After verification by colony PCR and sequencing, the Xba gene expression vector was obtained. AfGF14i 8. The Aechmea fasciata according to claim 7 AfGF14i The gene expression vector is characterized in that: The sequences of the upstream primer P1 and the downstream primer P2 are shown as SEQ ID NO.4 and SEQ ID NO.5 in the sequence listing.
9. A method for subcellular localization of the protein encoded by the gene of the Aechmea fasciata as claimed in claim 1, characterized in that AfGF14i Analysis by transient expression in tobacco leaves AfGF14i For the subcellular localization of the protein encoded by the AfGF14i gene, after transferring the expression vector CaMV35S- AfGF14i- yfp carrying the CDS sequence of the Nicotiana benthamiana gene into Agrobacterium tumefaciens EHA105, the tobacco leaves of Nicotiana benthamiana ( Nicotiana benthamiana ) were injected, and the distribution of fluorescence signals was observed using a laser confocal microscope to determine the subcellular localization of the AfGF14i protein. It was observed that the AfGF14i protein was distributed on the cell membrane. 10. Use of the AfGF14i gene of Aechmea fasciata described in claim 1 in regulating the flowering of Arabidopsis plants, characterized in that, High expression of the AfGF14i gene promotes flowering in Arabidopsis thaliana.
Citation Information
Patent Citations
Dragonfly pineapple AfCAL gene, cloning method, expression vector and application
CN114672498A
Dragonfly pineapple AfFT3 gene, cloning method, expression vector and application
CN114774434A