A primer pair and identification method for distinguishing male and female litchi peduncle borer

Abstract

The invention discloses a primer pair for distinguishing male and female litchi pedicle borers and a method for distinguishing male and female litchi pedicle borers. The primer pair comprises a forward primer: 5'-AGACCAAACCCCTAGCTCCT-3' and a reverse primer: 5'-GTTGATGACGTTCTCGCAGC-3'. The invention utilizes molecular biological technology to achieve efficient and accurate male and female sex identification of litchi pedicle borers, providing a reliable reference for scientific research and prevention and control technology development of the insect.

Description

Technical Field

[0001] The invention belongs to the field of insect control, and particularly relates to a primer pair for distinguishing male and female litchi peduncle borers and an identification method. Background Art

[0002] Litchi is the fruit industry with the largest planting area, the most distinctive varieties and the most obvious location advantages in Guangdong Province. According to statistics, the planting area of ​​lychees in Guangdong Province in 2024 was 4.0327 million mu, accounting for about 51.36% of the national planting area. Litchi grows in tropical and subtropical regions with simultaneous humidity and heat. There are many types of diseases and pests, which spread quickly, seriously restricting the increase of its production.

[0003] The lychee stem borer is one of the most important pests in lychee production. It has the characteristics of larval borers, small and scattered eggs, and overlapping generations. When it breaks out, the fruit borer rate can be as high as 60%-90%. It is a "zero tolerance" control target for the lychee industry. According to statistics, in general lychee orchards, chemical pesticides need to be sprayed 13-15 times a year against lychee stem borers, accounting for more than 80% of the annual use of chemical pesticides. The intensive and unscientific application of pesticides has caused the lychee stem borer to develop increased resistance to pesticides, excessive pesticide residues in fresh fruits, and polluted the orchard's ecological environment. At present, the research reports on the lychee stem borer mainly focus on its biology, ecology, and integrated control technology, while there are few reports on male and female identification. However, male and female identification is very important for the study of insect biology, evolution, hybridization, pheromone extraction, and control. Therefore, studying the individual differences between male and female lychee stem borers and building accurate and rapid identification methods are of great significance to understanding and sustainable control of lychee stem borers.

[0004] At present, the sex identification of insects is mainly determined by their morphological differences. Most of the litchi stem borers collected in the orchard are in the pupal stage, and the morphological characteristics of male and female are not obvious. The adult individuals are small and have strong mobility. The identification by observation depends on the morphological phenotype and the operator's experience and judgment, and the accuracy is low and unstable. Therefore, on the basis of morphological identification, it is urgent to develop a molecular marker for early sex identification of litchi stem borers, and use molecular biology technology to achieve efficient and accurate sex identification of male and female litchi stem borers, providing a reliable reference for scientific research and prevention and control technology development of the insect. Summary of the invention

[0005] The invention aims to provide a primer pair for distinguishing male and female litchi peduncle borers and a method for distinguishing male and female litchi peduncle borers.

[0006] The first object of the present invention is to provide a primer pair for distinguishing male and female litchi peduncle borer, which comprises a forward primer: 5'-AGACC AAACCCCTAGCTCCT-3' and a reverse primer: 5'-GTTGATGACGTTCTCGCAGC-3'.

[0007] The second object of the present invention is to provide a kit for distinguishing the sexes of litchi peduncle borers, which contains the above-mentioned primer pair.

[0008] A third object of the present invention is to provide a method for distinguishing males and females of litchi peduncle borers, which comprises the following steps:

[0009] The RNA of the litchi pedicle borer is extracted and then reverse transcribed into cDNA, and then PCR amplification is performed using the above primer pair, and then agarose electrophoresis is performed. The one with a band at the 481bp position is a male litchi pedicle borer, while the one without a band is a female litchi pedicle borer.

[0010] Preferably, the litchi stalk borer can be litchi stalk borer in various insect stages, such as pupa, adult or mature larva.

[0011] Preferably, the reaction system of the PCR amplification is: 10 μL of 2×Taq HiFi PCR mix, 0.5 μL of 10 μM forward primer, 0.5 μL of 10 μM reverse primer, 1 μL of cDNA template, and RNase Free Water added to 20 μL.

[0012] Preferably, the reaction procedure of the PCR amplification is: pre-denaturation at 95°C for 3 min; denaturation at 94°C for 25 s; annealing at 62°C for 25 s; extension at 72°C for 8 s; denaturation-annealing-extension repeated for 34 cycles; and extension at 72°C for 5 min.

[0013] The present invention utilizes molecular biological technology to achieve efficient and accurate identification of male and female litchi peduncle borers, providing a reliable reference for scientific research and development of prevention and control technologies for the insect. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 This is a schematic diagram of sex identification of mature larvae, pupae and adults of litchi peduncle borer, where M: DL2000Marker; 1: mature larva 1; 2: mature larva 2; 3: mature larva 3; 4: mature larva 4; 5: pupa 1; 6: pupa 2; 7: pupa 3; 8: pupa 4; 9: adult 1; 10: adult 2; 11: adult 3; 12: adult 4. DETAILED DESCRIPTION

[0015] The following examples are provided to further illustrate the present invention, rather than to limit the present invention.

[0016] Embodiment 1:

[0017] 1. Experimental Methods

[0018] 1. Primer design and specificity detection

[0019]

[0020] Primer 5 software was used for primer design, and a pair of primers with good specificity was obtained after screening and sent to Guangzhou Tianyi Huayu Biotechnology Co., Ltd. for synthesis. The forward primer sequence was: 5`-AGACCAAACCCCTAGCTCCT-3`; the reverse primer sequence was: 5`-GTTGATGACGTTCTCGCAGC-3`.

[0021] The nucleotide sequence of the amplified product is: 5`-AGACCAAACCCCTAGCTCCTGCAGCAGCAGCGGCTCC TCAGATATCGTCCGCCGGTACACCTGGACCACTAAGAACAGGATGACCGTGCAGGTTATAACTTACGGCGCGACCATCACGAGTATCCAAGTACCGGACCGGAAGGGTGTGCCAGATGACGTGATCGCAGGCTTCGAGTCTTTGCCTGATTACATGCAGCCTCGCAATCCGTACTTTGGCGCGCTGATTGGTCGGTGCGCGAACTACGTGCGCGAGGGCACCAT GGCCATCCGGCCGTTCAGCCGCATCTACATGCTGTCACTCAACAAGGGAGTACACCACTACCATGGAGGTGTCGTGGGATTTGACAAGGTGAACTGGCGCTCGTACATGACCGGCAAGAAGGTGATAATGAGCCACGTGTCGCAACGCTACAACGAGGGGTACCCCGGCTGCGTGATGACGCAGATCTGCTTCGAAGTGAGCTGCGAGAACGTCATCAAC-3`.

[0022] 2. RNA Extraction from Litchi Stem Borer Samples

[0023] Fallen fruits were collected from the litchi orchard, brought back to the laboratory, and covered with a layer of corrugated paper. Male and female mature larvae were collected on the morning of the second day, and male and female pupae were collected on the fourth day after pupation. After the pupae emerged as adults, the male and female adults were identified by the external genitalia and collected. The collected mature larvae, pupae and adults were washed twice with 1×PBS buffer and placed in 1.5 mL centrifuge tubes. The RNA of the litchi peduncle borer samples to be tested was extracted using a micro RNA extraction kit (Adlai Biotechnology, Beijing). The integrity and purity of the extracted RNA were detected by 1.5% agarose gel electrophoresis and a microplate reader, respectively, and stored at -80°C for later use.

[0024] 3. Synthesis of cDNA Library of Litchi Stem Borer Samples

[0025] The RNA of the above-extracted litchi pedicle borer sample was reverse transcribed into cDNA using the Evo M-MLV reverse transcription premix kit. The reverse transcription reaction system was:

[0026]

[0027] The reaction conditions were: 37°C, 15 min; 85°C, 5 s; 4°C, hold.

[0028] 4. PCR Amplification of Litchi Stem Borer Samples

[0029] According to the primer sets designed for mature larvae of litchi pedicle borer, PCR amplification was performed using the obtained cDNA diluted 30 times as a template to obtain PCR products corresponding to different litchi pedicle borer samples. The amplification system is:

[0030]

[0031] The reaction conditions were as follows: pre-denaturation at 95°C for 3 min; denaturation at 94°C for 25 s; annealing at 62°C for 25 s; extension at 72°C for 8 s; denaturation-annealing-extension repeated for 34 cycles; extension at 72°C for 5 min; and storage at 4°C.

[0032] 5. Agarose gel detection of PCR products

[0033] Prepare an agarose gel with a concentration of 1.5%, take 2.5 μL of the PCR product in the previous step for electrophoresis, and end when the bromophenol blue dye migrates to the 1 / 4 of the lower edge of the gel. Identify male and female litchi pedicle borers by gel imaging results. The male litchi pedicle borer is the one that can amplify a band near 500 bp (specifically 481 bp), while the female litchi pedicle borer is the one that fails to amplify a band.

[0034] 2. Experimental Results

[0035] Depend on Figure 1 It can be seen that the mature larval samples 1-2, pupal samples 5-6 and adult samples 9-10 can amplify a specific band of 481bp, so 1-2, 5-6 and 9-10 are male litchi pedicle borers; the mature larval samples 3-4, pupal samples 7-8 and adult samples 11-12 did not amplify specific bands, so 3-4, 7-8 and 11-12 are female litchi pedicle borers, which is consistent with the actual situation.

[0036] This detection method has good sensitivity.

Claims

1. A primer pair for distinguishing male and female litchi peduncle borers, characterized in that: Include the forward primer: 5'-AGACCAAACCCCTAGCTCCT-3' and the reverse primer: 5'-GTTGATGACGTTCTCGCAGC-3'.

2. A kit for distinguishing the sexes of litchi peduncle borers, characterized in that: Containing the primer pair according to claim 1.

3. A method for distinguishing the sexes of litchi peduncle borers, characterized in that: The following steps are involved: RNA of the litchi pedicle borer sample is extracted and then reverse transcribed into cDNA, and then PCR amplification is performed using the primer pair described in claim 1, and then agarose electrophoresis is performed. The one with a band at the 481bp position is a male litchi pedicle borer, and the one without a band is a female litchi pedicle borer.

4. The method for distinguishing males and females of litchi peduncle borers according to claim 3, characterized in that: The litchi stalk borer sample is a pupa, an adult or a mature larva of the litchi stalk borer.

5. The method for distinguishing males and females of litchi peduncle borers according to claim 3, characterized in that: The reaction system of the PCR amplification is: 2× Taq HiFi PCR mix 10 μL, 10 μM forward primer 0.5 μL, 10 μM reverse primer 0.5 μL, cDNA template 1 μL, and RNase Free Water added to 20 μL.

6. The method for distinguishing males and females of litchi peduncle borers according to claim 3, characterized in that: The reaction procedure of the PCR amplification is: pre-denaturation at 95°C for 3 min; denaturation at 94°C for 25 s; annealing at 62°C for 25 s; extension at 72°C for 8 s; denaturation-annealing-extension repeated for 34 cycles; and extension at 72°C for 5 min.

Images