A multiplex qPCR kit and method for simultaneously detecting multiple pathogenic bacteria based on new molecular targets
By designing highly specific multiplex qPCR primer and probe sets and optimizing reaction conditions, the problems of cumbersome and misjudgment in traditional detection methods have been solved, enabling rapid and accurate detection of multiple pathogens, suitable for rapid screening of large-scale samples.
Patent Information
- Application Number
- CN202411214743.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-02
- Publication Date
- 2026-02-17
- Estimated Expiration
- 2044-09-02
AI Technical Summary
Existing technologies are insufficient for the rapid and accurate simultaneous detection of four zero-tolerance pathogens in food: Salmonella, Escherichia coli O157:H7, Listeria monocytogenes, and Cronobacter sakazakii. Traditional methods are cumbersome, costly, and prone to misjudgment, while multiplex qPCR methods are difficult to design and have a high false positive rate.
We designed a highly specific multiplex qPCR primer and probe set, including specific primer pairs and fluorescent probes for each pathogen, and combined them with optimized reaction conditions to achieve simultaneous detection of four pathogens in a single tube reaction.
It enables rapid, accurate, and convenient detection of multiple pathogens, reduces false positive rates, and improves detection efficiency and sensitivity, making it suitable for rapid screening of large-scale samples.
Smart Images

Figure CN118957115B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of microbial molecular detection, specifically relating to a multiplex qPCR kit and method for simultaneously detecting multiple pathogenic bacteria, and particularly to a multiplex qPCR kit and method for simultaneously detecting Salmonella, Escherichia coli O157:H7, Listeria monocytogenes and Cronobacter sakazakii based on specific genomic fragments. Background Technology
[0002] In recent years, foodborne illnesses have occurred frequently, seriously threatening public health and causing huge economic losses to society. According to the World Health Organization's 2018 foodborne illness survey report, more than 600 million people worldwide have been infected with foodborne illnesses, resulting in 420,000 deaths, of which more than 230,000 deaths were caused by foodborne pathogens.
[0003] Salmonella is an important zoonotic Gram-negative pathogen belonging to the Enterobacteriaceae family. Infection can cause a range of symptoms including fever, nausea, vomiting, and diarrhea, leading to food poisoning, which can be life-threatening in severe cases. Statistics show that Salmonella-related food poisoning consistently ranks first among various bacterial food poisoning incidents worldwide. In my country, Salmonella is also the leading cause of food poisoning.
[0004] Listeria monocytogenes is a facultative anaerobic zoonotic pathogen that can cause symptoms such as meningitis, sepsis, nervous system damage, and miscarriage after infecting a host. The mortality rate is as high as 30%. Susceptible populations include the elderly, pregnant women, infants, and people with weakened immune systems.
[0005] Escherichia coli O157:H7 is the most important enterohemorrhagic Escherichia coli species relevant to public health, and it can also cause zoonotic diseases. After infecting a host, this bacterium produces Shiga toxin-like cytotoxins and may cause severe intestinal symptoms, such as bloody diarrhea, thrombotic thrombocytopenic purpura, sporadic or fulminant hemorrhagic colitis, renal hemolytic uremic syndrome, and other complications, which can lead to death in severe cases.
[0006] Cronobacter sakazakii is an opportunistic pathogen. It can cause bacteremia, meningitis, and necrotizing enterocolitis after infection, with a mortality rate as high as 40%-80%. Infants and young children are susceptible to Cronobacter sakazakii.
[0007] Studies have shown that the aforementioned pathogens are widely present in dairy products, meat products, grain products, frozen drinks, vegetables, and other foods. Because these pathogens can survive under harsh environmental conditions, such as extreme pH levels, temperatures, and salt concentrations, they are susceptible to contamination at multiple stages of the food supply chain. Currently, the international limits for these pathogens in food are zero detection and zero tolerance. Therefore, establishing rapid, sensitive, and specific detection technologies for these pathogens to identify and monitor them early is crucial for preventing foodborne illnesses and minimizing the recall of contaminated food. In particular, multiple pathogenic microorganisms often coexist in contaminated food, leading to various foodborne illnesses. Therefore, simultaneously detecting these four zero-tolerance pathogens in contaminated food can significantly reduce detection time and costs. Based on this, establishing a simultaneous rapid detection method for Salmonella, Escherichia coli O157:H7, Listeria monocytogenes, and Cronobacter sakazakii in food is of great significance for ensuring food safety.
[0008] Currently, the detection of the aforementioned foodborne pathogens mainly employs the isolation, culture, and biochemical identification methods stipulated by national standards. This method is cumbersome, costly, and time-consuming (typically requiring 2-7 days), hindering large-scale rapid detection. Furthermore, when using traditional culture methods to identify these pathogens through biochemical tests, the biochemical reactions are unstable, and results rely on subjective judgment, leading to frequent misinterpretations and poor repeatability. More importantly, the method based on isolation, culture, and biochemical identification requires separate testing for each pathogen, further complicating the process. Molecular biology detection methods, primarily based on polymerase chain reaction (PCR), are gradually becoming one of the most promising technologies to replace traditional methods due to their speed, accuracy, and simplicity. However, conventional PCR technology is cumbersome and prone to contamination when used for bacterial detection. In contrast, quantitative real-time PCR (qPCR), which incorporates specific fluorescent probes into conventional PCR, further improves detection sensitivity and specificity. qPCR is a simple method, and because it eliminates the need for subsequent gel electrophoresis, it significantly reduces the possibility of cross-contamination. Multiplex qPCR, in particular, can simultaneously amplify multiple fragments in a single reaction system, offering high throughput and making it suitable for rapid screening and detection of large-scale samples. Currently, most reported foodborne pathogen detection methods based on multiplex qPCR technology focus on Salmonella, Listeria monocytogenes, and one or more other common pathogens. However, there are very few multiplex qPCR detection methods and related products that can simultaneously detect Salmonella, Escherichia coli O157:H7, Listeria monocytogenes, and Cronobacter sakazakii—four zero-tolerance pathogens in food.
[0009] Multiplex qPCR is a simple, rapid, highly sensitive, specific, and high-throughput method with significant advantages and broader application prospects. However, due to the mutual interference and competition between multiple qPCR reactions in a single-tube reaction, the requirements for primer and probe specificity and reaction conditions in multiplex qPCR are much higher than those in single-tube qPCR. The design and development difficulty increases exponentially with the number of qPCR reactions included in a single tube reaction. If the primer specificity of the target bacteria is poor, the probability of false positives and false negatives in the multiplex qPCR detection process will increase. Therefore, selecting reliable target genes and designing corresponding specific primers and probes is crucial. Summary of the Invention
[0010] The purpose of this invention is to overcome at least one deficiency of the prior art and provide a multiplex qPCR kit and method for the simultaneous detection of four foodborne pathogens, mainly based on novel molecular targets.
[0011] The technical solution adopted in this invention is:
[0012] The first aspect of the present invention provides:
[0013] A multiplex qPCR primer and probe set for simultaneous detection of multiple pathogenic bacteria includes:
[0014] Primer pairs used for Salmonella detection include Sal-2F: TTCTCAATGCCGCTCAAAAGT and Sal-2R: ATCGCTTTCAACCAAATAGTGATG;
[0015] Primer pairs used for the detection of Cronobacter sakazakii include ES-1F: CGCCGTTTCCAGTACGTTACC and ES-1R: CTTCGTTGCCGCTGCCATAG;
[0016] Primer pairs used for the detection of Listeria monocytogenes include Lister-2F: GAGACAGCACCATTTCCGAAC and Lister-2R: ATCCCAATCTTCCTAACCACTGT;
[0017] Primer pairs for detecting Escherichia coli O157:H7 include O157-1F: CCTTGCAGATAAACTCATCGAAACAA and O157-1R: CCTCAGCTATAGGGTGCTTTTGATATT.
[0018] In some examples of multiplex qPCR primer-probe sets, the probes include:
[0019] Nucleic acid probes for Salmonella detection include Sal-2P: ACTGACGCTCCTGATCTCATTCCCTTATGC;
[0020] Nucleic acid probes for the detection of Cronobacter sakazakii include ES-1P: TCACGGGTCCTGCAACGGCTATTCA;
[0021] Nucleic acid probes for the detection of Listeria monocytogenes include Lister-2P: AGTCTTCAATCTCTTGCTCCAAAATAACCTTC;
[0022] Nucleic acid probes for the detection of Escherichia coli O157:H7 include O157-1P: CTGTCCACACGATGCCAATGTACTCGG.
[0023] In some examples of multiplex qPCR primer-probe sets, different nucleic acid probes are linked to different pairs of quencher and fluorescent groups.
[0024] In some examples of multiplex qPCR primer-probe sets, the nucleic acid probe corresponding to Salmonella is labeled with the fluorescent group ROX at the 5' end and the quencher group BHQ2 at the 3' end; the nucleic acid probe corresponding to Cronobacter sakazakii is labeled with the fluorescent group FAM at the 5' end and the quencher group BHQ1 at the 3' end; the nucleic acid probe corresponding to Listeria monocytogenes is labeled with the fluorescent group VIC at the 5' end and the quencher group BHQ1 at the 3' end; and the nucleic acid probe corresponding to Escherichia coli O157:H7 is labeled with the fluorescent group Cy5 at the 5' end and the quencher group BHQ3 at the 3' end.
[0025] A second aspect of the present invention provides:
[0026] A multiplex qPCR kit for simultaneous detection of multiple pathogenic bacteria, comprising the multiplex qPCR primers and probes described in the first aspect of this invention.
[0027] Preferably, the kit includes a premix, which comprises: 2×qPCR Mix, upstream and downstream primers and probes for Salmonella, upstream and downstream primers and probes for Escherichia coli O157:H7, upstream and downstream primers and probes for Listeria monocytogenes and Cronobacter sakazakii, wherein the concentration of each upstream primer is 0.40 μmol / L, the concentration of each downstream primer is 0.40 μmol / L, the probe concentrations for Salmonella, Listeria monocytogenes and Cronobacter sakazakii are 0.35 μmol / L, and the probe concentration for Escherichia coli O157:H7 is 0.30 μmol / L.
[0028] As a further preferred embodiment, the kit also includes a negative control, a positive control, and a lysis buffer. The positive control is a mixture of DNA extracts from the four target strains for detection; the negative control is DEPC water; and the lysis buffer mainly consists of a 5 mmol / L tris(hydroxymethylaminomethane) and 0.02% sodium dodecyl sulfate (SDS) solution.
[0029] A third aspect of the present invention provides:
[0030] A multiplex qPCR method for simultaneous detection of multiple pathogenic bacteria includes the following steps:
[0031] Extract genomic DNA from the sample to be tested for later use;
[0032] Take 5 μL of genomic DNA from the sample to be tested as a template and add it to the reaction system of a multiplex qPCR kit for amplification. The multiplex qPCR kit is as described in the second aspect of this invention.
[0033] Set up a qPCR program and collect fluorescence signals during the amplification process. Analyze the fluorescence signals to determine whether Salmonella, Cronobacter sakazakii, Listeria monocytogenes, and Escherichia coli O157:H7 are detected.
[0034] Preferably, the total qPCR reaction volume is 25 μL, and the ROX, FAM, VIC, and Cy5 detection channels are used. The qPCR program is 94℃ pre-denaturation for 60 s; 95℃ denaturation for 20 s; 60℃ annealing and extension for 30 s, for a total of 40 cycles. Fluorescence signals are collected during the annealing and extension phase of each cycle.
[0035] As a further preferred embodiment, the positive control exhibits an S-type amplification curve with a Ct value < 30, and the negative control does not show a clear typical S-type amplification curve or has a Ct value > 35, thus determining the validity of the multiplex qPCR detection; the criteria for determining pathogenic bacteria are as follows:
[0036] a) If a gene channel in the sample to be tested has a typical amplification curve after amplification and the Ct value is ≤35, then the sample to be tested is determined to contain the pathogenic bacteria corresponding to that channel.
[0037] b) If a gene channel in the sample to be tested does not have a typical amplification curve after amplification, and the Ct value is ≥37, then it is determined that the sample to be tested does not contain the pathogenic bacteria corresponding to that channel.
[0038] c) If a typical amplification curve is observed after amplification of a gene channel in the sample to be tested, and 35 < Ct < 37, then it is judged as an uncertain sample, and the amount of DNA template needs to be appropriately increased for retesting.
[0039] The beneficial effects of this invention are:
[0040] The multiplex qPCR primer and probe set provided by this invention, which is based on novel molecular detection targets, has high specificity. It detects fluorescence signals only in specific fluorescent signal channels for four target bacteria: Salmonella, Escherichia coli O157:H7, Listeria monocytogenes, and Cronobacter sakazakii. This reduces the probability of false positives or false negatives and makes the detection results more accurate.
[0041] The multiplex qPCR kit provided by this invention offers rapid and efficient detection: compared to the traditional culture and identification process which takes nearly a week, this method can complete the entire sample detection process (including sample pre-enrichment) within 10 hours. More importantly, the method involved in this invention can simultaneously detect and identify four common pathogenic bacteria: Salmonella, Escherichia coli O157:H7, Listeria monocytogenes, and Cronobacter sakazakii, increasing throughput and simplifying result interpretation. Furthermore, the entire qPCR process takes only about 1 hour, significantly improving detection efficiency and reducing costs, making it particularly suitable for large-scale sample screening and actual testing.
[0042] The multiplex qPCR kit provided by this invention has high sensitivity: the limit of detection (LOD) for Salmonella in the TaqMan multiplex qPCR kit is approximately 1.9 CFU / Test, the LOD for Escherichia coli O157:H7 is approximately 6.4 CFU / Test, the LOD for Listeria monocytogenes is approximately 12 CFU / Test, and the LOD for Cronobacter sakazakii is approximately 10.7 CFU / Test.
[0043] The multiplex qPCR kit provided by this invention is simple and convenient to operate: the kit components and ratios are reasonable, the operation is simple and convenient, and cross-contamination is minimized. Attached Figure Description
[0044] Figure 1 This describes the amplification curve and specificity of the singlet qPCR detection method for Salmonella.
[0045] Figure 2 This describes the amplification curve and specificity of the single-pair qPCR detection method for Cronobacter sakazakii.
[0046] Figure 3 This describes the amplification curve and specificity of the single-pair qPCR detection method for Listeria monocytogenes.
[0047] Figure 4 This describes the amplification curve and specificity of the singlet qPCR detection method for Escherichia coli O157:H7.
[0048] Figure 5 This image shows an example of multiplex qPCR detection using a mixture of Salmonella, Cronobacter sakazakii, Listeria monocytogenes, and Escherichia coli O157:H7 positive samples.
[0049] Figure 6 These are amplification curves for detecting different concentrations of Salmonella using a multiplex qPCR kit.
[0050] Figure 7This is an amplification curve of Cronobacter sakazakii detected by a multiplex qPCR kit.
[0051] Figure 8 These are amplification curves of Listeria monocytogenes at different concentrations detected by a multiplex qPCR kit.
[0052] Figure 9 These are amplification curves of different concentrations of Escherichia coli O157:H7 detected by a multiplex qPCR kit.
[0053] Figure 10 The standard curves for detecting different concentrations of bacteria using a multiplex qPCR kit are shown for (A) Salmonella; (B) Listeria monocytogenes; (C) Escherichia coli O157:H7; and (D) Cronobacter sakazakii. Detailed Implementation
[0054] To further illustrate the technical means and effects of the present invention, the technical solution of the present invention will be further explained through specific embodiments below. However, the present invention is not limited to the scope of the embodiments. The materials used in the following embodiments are not limited to those listed above and can be replaced by other similar materials. If the specific conditions of the instruments are not specified, they shall be performed according to conventional conditions or the conditions recommended by the manufacturer. Unless otherwise specified, the reagents and methods used in the present invention are conventional reagents and methods in this technical field.
[0055] Example 1: Design and Screening of Primers and Probes
[0056] 1) Primer and probe design
[0057] Bioinformatics analysis was performed on the whole genome DNA sequences of Salmonella, Listeria monocytogenes, and Cronobacter sakazakii obtained from the GenBank database and our team's own sequencing to screen specific gene fragments of these pathogenic bacteria as molecular detection targets. Novel and specific gene fragments from the genomes of Salmonella, Listeria monocytogenes, and Cronobacter sakazakii, as well as the highly specific rfbE gene of Escherichia coli O157:H7, were designed using Primer5 and Oligo7. The specificity of the designed primers and probes across all bacterial species was confirmed using the NCBI Primer BLAST tool. While adhering to primer and probe design principles, the amplified fragments were ensured to be within 200 bp. The different primer-probe sequence combinations are as follows.
[0058] Table 1. List of different primer and probe sequences
[0059]
[0060]
[0061] 2) The final concentrations of upstream and downstream primers and probes for different pathogenic bacteria were all set to 0.30 μmol / L. Genomic DNA of the target strain was used as a positive control template, while DEPC water was used as a blank control. The four pathogenic bacteria served as negative controls for each other. Singleton qPCR reactions were performed using the same reaction system to demonstrate the effectiveness of the synthesized primers and probes.
[0062] 3) The designed primers and probes were combined in four quadruplets, resulting in a total of 16 combinations. The final concentration of each upstream and downstream primer and probe was set to 0.30 μmol / L. Taking into account the cycle threshold (Ct) and fluorescence signal value (ΔRn), the combination with the best detection result was selected as the optimal primer and probe.
[0063] The results showed that all primer and probe sets amplified typical S-shaped amplification curves only in the corresponding gene channels, and the Ct value was <25, indicating that the designed primers and probes were effective. A unified reaction system was used to test the above 16 combinations, and the combination with the best amplification results for each of the four fluorescence channels was selected. The preferred amplification primers and probes are shown in Table 2, and their amplification curves are shown in... Figures 1-4 As shown.
[0064] Table 2. Preferred primer and probe sequences
[0065] Primer / Probe Name Sequence (5'-3') Sal-2F TTCTCAATGCCGCTCAAAAGT Sal-2R ATCGCTTTCAACCAAATAGTGATG Sal-2P ROX-ACTGACGCTCCTGATCTCATTCCCTTATGC-BHQ2 ES-1F CGCCGTTTCCAGTACGTTACC ES-1R CTTCGTTGCCGCTGCCATAG ES-1P FAM-TCACGGGTCCTGCAACGGCTATTCA-BHQ1 Lister-2F GAGACAGCACCATTTCCGAAC Lister-2R ATCCCAATCTTCCTAACCACTGT Lister-2P VIC-AGTCTTCAATCTCTTGCTCCAAAATAACCTTC-BHQ1 O157-1F CCTTGCAGATAAACTCATCGAAACAA O157-1R CCTCAGCTATAGGGTGCTTTTGATATT O157-1P Cy5-CTGTCCACACGATGCCAATGTACTCGG-BHQ3
[0066] Example 2: Construction and optimization of a multiplex qPCR reaction method
[0067] 1) Based on the preferred primers and probes for each pathogen, primers and probes with different final concentrations (setting concentration gradients of 0.2, 0.3, 0.35, 0.4, 0.45, and 0.5 μmol / L) were selected for single-factor optimization experiments. Taking into account the cycle threshold (Ct) and fluorescence signal value (ΔRn) of the amplification curve, the final single qPCR reaction system was determined.
[0068] 2) Using genomic DNA of the same concentration as a template, and based on the optimal conditions for singleton qPCR, an orthogonal experiment was conducted with appropriate primer concentrations to optimize the multiplex qPCR reaction system. Based on the Ct value, fluorescence intensity changes, and sensitivity of the amplification curves, the optimal conditions for the multiplex reaction were selected, allowing simultaneous detection of four pathogenic bacteria using a single-tube reaction system. The amplification program was: 94℃ pre-denaturation for 60 s; 95℃ denaturation for 20 s; 60℃ annealing and extension for 30 s, for a total of 40 cycles. Fluorescence signals were collected during the annealing and extension phase of each cycle.
[0069] The optimization results of the multiplex qPCR reaction system are shown in Table 3. The amplification curves in the single-tube reaction system are shown in Table 3. Figure 5 As shown.
[0070] Table 3 Results of optimization of multiplex qPCR reaction system
[0071]
[0072] Example 3: Preparation of a multiplex qPCR kit
[0073] 1) Primer synthesis: synthesize oligonucleotide primers and probes according to the sequences provided in Table 2.
[0074] 2) Preparation of premix: Prepare 10× primer / probe mixture according to the optimization results of Example 2. The ratio of each group of premix is: 2×qPCR Mix: 10× primer / probe mixture: DEPC water = 5:1:2.
[0075] 3) Preparation of lysis buffer: Prepare a lysis buffer containing 5 mmol / L tris-base and 0.02% (m / v) sodium dodecyl sulfate (SDS) in a container, sterilize it by filtration, and dispense 1 mL / vial.
[0076] 4) Preparation of positive control: Take 0.5–2 mL of bacterial culture in the logarithmic growth phase (OD500). 600 (Approximately 0.6), DNA was extracted from four pathogenic bacteria using a bacterial genomic DNA extraction kit, and the concentration was determined using an ultra-micro UV-Vis spectrophotometer. The DNA concentration was adjusted with DEPC water to an amplification Ct value of 15–20 and then mixed, and dispensed in 200 μL / vial.
[0077] 5) Prepare negative control: Dispense DEPC water in 200 μL / vial.
[0078] 6) Assemble the kit, including ① Premixed solution: brown screw cap and brown centrifuge tube, 1 tube; ② Lysis solution: red screw cap, 1 tube; ③ Positive control: yellow screw cap, 1 tube; ④ Negative control: green screw cap, 1 tube; provide instructions for use and package.
[0079] Example 4: Sensitivity Validation of Multiplex qPCR Kit Detection System
[0080] Using a sterile inoculation loop, pick up a certain amount of single colonies of Salmonella Typhimurium (FSCC(I)215013), Cronobacter sakazakii (FSCC(I)145010), Listeria monocytogenes (FSCC(I)178006), and Escherichia coli O157:H7 (FSCC(I)149034508), respectively, and transfer them to 4.5 mL of sterile physiological saline and mix well. The bacterial solutions are then serially diluted 10-fold with sterile physiological saline (dilution factors 10:10). 1 10 2 103 10 4 10 5 10 6 10 7 ).
[0081] 1) Sample DNA extraction
[0082] Take 1 mL of diluted bacterial culture into 1.5 mL sterile centrifuge tubes, centrifuge at 5000 rpm for 5 min, and discard the supernatant. Then add 30 μL of lysis buffer, fully resuspend the bacterial cells, gently tap the tube wall to remove air bubbles, and heat lyse at 99℃ for 10 min. After lysis, centrifuge at 12000 rpm for 15 min, and collect the supernatant as the crude genomic DNA.
[0083] 2) Determination of bacterial concentration
[0084] Take another appropriate dilution (10) 2 -10 5 The bacterial suspension (60 μL) was spread onto PDA plates and incubated at 37°C for 16–48 h for counting. Each bacterial suspension concentration was tested in triplicate. The corresponding colony count was determined according to GB 4789.2-2016 "Food Microbiology Examination - Determination of Total Colony Count".
[0085] 3) Multiplex qPCR amplification
[0086] Take the corresponding number of PCR reaction tubes (1 negative control tube + 1 positive control tube + the number of samples to be tested), and add 20 μL of premixed buffer to each tube. Add 5 μL each of the negative control, positive control, and sample DNA to each reaction tube, tighten the cap, centrifuge briefly, and immediately perform the amplification reaction. Repeat the reaction 3 times.
[0087] 4) Result determination.
[0088] The multiplex qPCR kit is considered effective if the positive control shows an S-shaped amplification curve with a Ct value < 30, and the negative control does not show a typical S-shaped amplification curve or has a Ct value > 35. Under these conditions, if a gene channel in the sample shows a typical amplification curve and a Ct value ≤ 35, the sample is considered to contain the pathogen corresponding to that channel; if a gene channel in the sample does not show a typical amplification curve and a Ct value ≥ 37, the sample is considered not to contain the pathogen corresponding to that channel; if a gene channel in the sample shows a typical amplification curve and 35 < Ct < 37, the sample is considered indeterminate and requires retesting with an appropriately increased DNA template amount.
[0089] The limit of detection (LOD) of this multiplex qPCR kit was determined by combining colony count results and multiplex qPCR results. The amplification curve results are shown below. Figures 6-9 As shown, the standard curve results are as follows: Figure 10 As shown, calculations revealed that the LOD of this multiplex qPCR kit for (A) Salmonella was approximately 1.9 CFU / Test, for (B) Escherichia coli O157:H7 it was approximately 6.4 CFU / Test, for (C) Listeria monocytogenes it was approximately 12 CFU / Test, and for (D) Cronobacter sakazakii it was approximately 10.7 CFU / Test. This demonstrates that the kit can sensitively detect four pathogenic bacteria simultaneously.
[0090] Example 5: Specificity validation of the multiplex qPCR kit detection system
[0091] The detection specificity of the multiplex qPCR kit prepared in Example 3 was verified using 100 target and non-target bacteria strains. The kits included 12 strains of *Escherichia coli* O157:H7 (1 standard strain and 11 isolates), 23 strains of *Salmonella* (7 standard strains and 16 isolates), 20 strains of *Cronobacter sakazakii* (1 standard strain and 19 isolates), 18 strains of *Listeria monocytogenes* (5 standard strains and 13 isolates), and 27 other common strains. All laboratory isolates are numbered as shown in Table 4.
[0092] Table 4. Laboratory-isolated strains number
[0093]
[0094]
[0095] A single colony half-loop of each bacterium was picked using a sterile inoculation loop, and sample DNA extraction, multiplex qPCR amplification, and result interpretation were performed according to Example 4. The detection results are shown in Table 5. The positive control and target strains, including Salmonella, Escherichia coli O157:H7, Listeria monocytogenes, and Cronobacter sakazakii, showed positive amplification results only in their corresponding fluorescence channels. Other strains did not show typical positive amplification results. This result indicates that the multiplex qPCR kit of the present invention has high specificity.
[0096] Table 5. Specificity validation results of the multiplex qPCR kit detection system
[0097]
[0098]
[0099] Example 6: Reproducibility Validation of a Multiplex qPCR Kit
[0100] Using the same batch (5 samples) and different batches (5 batches) of multiplex qPCR kits, genomic DNA of the same concentration was amplified according to Example 4 to verify the repeatability of the kit, where the coefficient of variation was calculated as standard deviation / mean. The results are shown in Table 6. The coefficients of variation for both intra-batch and inter-batch detection of the established multiplex qPCR kit were less than 1.3%, indicating that the detection system of this multiplex qPCR kit has good repeatability and stability.
[0101] Table 6. Repeatability verification of the multiplex qPCR kit detection system.
[0102]
[0103]
[0104] Example 7: Multiplex qPCR kit for simultaneous detection of four pathogenic bacteria in artificially contaminated chicken samples
[0105] 1) Chicken sample pretreatment
[0106] Chicken samples were purchased from local supermarkets, sterilized by flaming with alcohol swabs in a laminar flow hood, and then irradiated under a UV lamp for about 20 minutes. Each portion of chicken (25g) was then cut with sterile scissors and placed in a sterile petri dish at 4°C for later use.
[0107] 2) National Standard Method Testing
[0108] The samples must be tested according to national standards to confirm that they do not contain Salmonella (GB 4789.4-2024), Listeria monocytogenes (GB 4789.30-2016), Escherichia coli O157:H7 (GB 4789.36-2016), and Cronobacter sakazakii (GB 4789.40-2024) before they can be used for artificial contamination.
[0109] 3) Artificial inoculation
[0110] Each meat sample was transferred to a sterile homogenizing bag and inoculated with 1 mL of a mixed bacterial culture, with each bacterial strain inoculated at a concentration of 10. 3 ~10 0 CFU / mL was added, followed by 225 mL of TSB, and homogenized for 1 min. Uninoculated samples served as negative controls. The mixture was incubated at 37°C for 4–10 h. Plate counts were used to determine the concentration of the artificially contaminated bacterial suspension, with each concentration tested in triplicate.
[0111] 4) Multiplex qPCR detection
[0112] Genomic DNA was extracted and subjected to multiplex qPCR detection, as described in Example 4.
[0113] The results are shown in Table 7. After culturing chicken meat contaminated with the standard strains of four pathogenic bacteria at 37℃ for 4 hours, the sensitivity of the developed multiplex qPCR kit could reach 10. 2 After incubation at 37℃ for 8 hours, the detection sensitivity increased to 10 CFU / g. 0 CFU / g.
[0114] Table 7. Results of multiplex qPCR detection of four pathogenic bacteria in artificially contaminated chicken samples.
[0115]
[0116]
[0117] Example 8: Multiplex qPCR kit for simultaneous detection of four pathogenic bacteria in meat products
[0118] Fifteen frozen meat samples were purchased from a local supermarket. Each sample (25g) was cut using sterile scissors and homogenized in a sterile container containing 225mL TSB. The samples were then incubated at 37°C for 8 hours (200rpm / min) using a shaker. Following Example 4, nucleic acids were extracted from each of the 15 frozen meat samples and detected using a prepared multiplex qPCR kit. The amplification curves of different fluorescence channels and Ct values were used to determine the negative or positive results for the corresponding pathogen nucleic acids. The samples were also tested using the national standard method.
[0119] The results are shown in Table 8. Among the 15 samples, 3 were positive for Salmonella, 2 for Listeria monocytogenes, and 1 each for Cronobacter sakazakii and Escherichia coli O157:H7. These results indicate that the multiplex qPCR kit and method established in this invention are completely consistent with the national standard method.
[0120] Table 8. Detection results of real samples
[0121] Sample number Multiplex qPCR detection results National Standard Test Results 1 – – 2 salmonella salmonella 3 – – 4 Salmonella, Listeria monocytogenes Salmonella, Listeria monocytogenes 5 Cronobacter sakazakii Cronobacter sakazakii 6 – – 7 Salmonella, Escherichia coli O157:H7 Salmonella, Escherichia coli O157:H7 8 – – 9 – – 10 Listeria monocytogenes Listeria monocytogenes 11 – – 12 – – 13 – – 14 – – 15 – –
[0122] The above embodiments illustrate and describe the basic principles and features of the present invention. The results show that the kit of the present invention has the characteristics of good accuracy and repeatability, and high sensitivity, and is suitable for rapid detection and identification of Listeria monocytogenes, Salmonella, Cronobacter sakazakii and Escherichia coli O157:H7 in large-scale food and environmental samples.
[0123] The above is a further detailed description of the present invention and should not be considered as a limitation on the specific implementation of the present invention. For those skilled in the art, simple deductions or substitutions without departing from the concept of the present invention are all within the protection scope of the present invention.
Claims
1. A multiplex qPCR primer probe set for simultaneous detection of multiple pathogenic bacteria, characterized in that, include: Primer pairs used for Salmonella detection include Sal-2F: TTCTCAATGCCGCTCAAAAGT and Sal-2R: ATCGCTTTCAACCAAATAGTGATG; Nucleic acid probes for Salmonella detection include Sal-2P: ACTGACGCTCCTGATCTCATTCCCTTATGC; Primer pairs used for the detection of Cronobacter sakazakii include ES-1F: CGCCGTTTCCAGTACGTTACC and ES-1R: CTTCGTTGCCGCTGCCATAG; Nucleic acid probes for the detection of Cronobacter sakazakii include ES-1P: TCACGGGTCCTGCAACGGCTATTCA; Primer pairs used for the detection of Listeria monocytogenes include Lister-2F: GAGACAGCACCATTTCCGAAC and Lister-2R: ATCCCAATCTTCCTAACCACTGT; Nucleic acid probes for the detection of Listeria monocytogenes include Lister-2P: AGTCTTCAATCTCTTGCTCCAAAATAACCTTC; Primer pairs used for the detection of Escherichia coli O157: H7 include O157-1F: CCTTGCAGATAAACTCATCGAAACAA and O157-1R: CCTCAGCTATAGGGTGCTTTTGATATT; Nucleic acid probes for the detection of Escherichia coli O157: H7 include O157-1P: CTGTCCACACGATGCCAATGTACTCGG; Different nucleic acid probes are linked to different quencher groups and fluorescent groups.
2. The multiplex qPCR probe set of claim 1, wherein, The nucleic acid probe corresponding to Salmonella is labeled with the fluorescent group ROX at the 5' end and the quencher group BHQ2 at the 3' end; The nucleic acid probe corresponding to Cronobacter sakazakii is labeled with the fluorescent group FAM at the 5' end and the quencher group BHQ1 at the 3' end; The nucleic acid probe corresponding to Listeria monocytogenes is labeled with the fluorescent group VIC at the 5' end and the quencher group BHQ1 at the 3' end; The nucleic acid probe corresponding to Escherichia coli O157:H7 is labeled with the fluorescent group Cy5 at the 5' end and the quencher group BHQ3 at the 3' end.
3. A multiplex qPCR kit for simultaneous detection of multiple pathogenic bacteria, characterized in that, Contains the multiplex qPCR primer and probe set as described in claim 1 or 2.
4. The multiplex qPCR kit according to claim 3, characterized in that, The kit includes a premix, which comprises: 2× qPCR Mix, upstream and downstream primers and probes for Salmonella, Escherichia coli O157:H7, Listeria monocytogenes, and Cronobacter sakazakii. The concentration of each upstream primer is 0.40 µmol / L, and the concentration of each downstream primer is 0.40 µmol / L. The probe concentrations for Salmonella, Listeria monocytogenes, and Cronobacter sakazakii are 0.35 µmol / L, and the probe concentration for Escherichia coli O157:H7 is 0.30 µmol / L.
5. The multiplex qPCR kit according to claim 3 or 4, characterized in that, It also includes a negative control, a positive control, and a lysis buffer. The positive control is a mixture of DNA extracts from four positive strains of the target bacteria. The negative control is DEPC water. The lysis buffer mainly consists of a 5 mmol / L tris(hydroxymethylaminomethane) and 0.02% sodium dodecyl sulfate solution.
6. A multiplex qPCR method for simultaneous detection of multiple pathogenic bacteria, comprising the following steps: Extract genomic DNA from the sample to be tested for later use; Take 5 μL of genomic DNA from the sample to be tested as a template and add it to the reaction system of a multiplex qPCR kit for amplification, wherein the multiplex qPCR kit is as described in any one of claims 3 to 5; Set up a qPCR program and collect fluorescence signals during the amplification process. Analyze the fluorescence signals to determine whether Salmonella, Cronobacter sakazakii, Listeria monocytogenes, and Escherichia coli O157:H7 are detected.
7. The multiplex qPCR method according to claim 6, characterized in that, The total qPCR reaction volume was 25 μL. The ROX, FAM, VIC, and Cy5 detection channels were used. The qPCR program was 94℃ pre-denaturation for 60 s; 95℃ denaturation for 20 s; 60℃ annealing and extension for 30 s, for a total of 40 cycles. Fluorescence signals were collected during the annealing and extension phase of each cycle.
8. The multiplex qPCR method according to claim 6 or 7, characterized in that, A positive control showing an S-type amplification curve with a Ct value < 30, and a negative control showing no obvious typical S-type amplification curve or a Ct value > 35, are considered valid for multiplex qPCR detection; the criteria for determining pathogenic bacteria are as follows: a) If a gene channel in the sample to be tested has a typical amplification curve after amplification and the Ct value is ≤35, then the sample to be tested is determined to contain the pathogenic bacteria corresponding to that channel. b) If a gene channel in the sample to be tested does not have a typical amplification curve after amplification, and the Ct value is ≥37, then it is determined that the sample to be tested does not contain the pathogenic bacteria corresponding to that channel. c) If a typical amplification curve is observed after amplification of a gene channel in the sample to be tested, and 35 < Ct < 37, then it is judged as an uncertain sample, and the amount of DNA template needs to be appropriately increased for retesting.
Citation Information
Patent Citations
Multiplex PCR (Polymerase Chain Reaction) detection primer and kit for detecting ten food-borne pathogenic bacteria
CN114277170A
Multiplex fluorescent quantitative PCR primer group for simultaneously detecting three pathogenic bacteria in food, kit and application
CN116042786A