An InDel marker for identification of golden autumn sugar orange and its application

Abstract

The present invention relates to the field of molecular biology technology, and discloses an InDel marker for the identification of golden autumn tangerines, wherein the InDel marker is located at a site where an InDel deletion fragment exists on chromosome 2 of the tangerine gene. The nucleotide sequence of the InDel deletion fragment is shown in SEQ ID NO.1. The present invention also aims to propose the application of the InDel marker in the identification of golden autumn tangerines. The molecular marker provided by the present invention has good specificity and wide applicability. The screened ST‑10 primer can specifically obtain two polymorphic bands of 441bp and 607bp respectively after amplification of the 'Golden Autumn' variety, and the golden autumn tangerine can be identified from 16 existing main cultivated varieties / lines of tangerines.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular biology, and in particular to an InDel marker for identifying golden autumn sugar oranges and an application thereof. Background Art

[0002] The variety of Golden Autumn Sugar Mandarin is named 'Zhonggansuo No. 5'. It is a hybrid variety bred by the Citrus Research Institute of the Chinese Academy of Agricultural Sciences using Ehime No. 30 hybrid mandarin (female parent) and sugar mandarin (male parent). Golden Autumn Sugar Mandarin is its trade name and is well known to consumers. Golden Autumn Sugar Mandarin stands out for its advantages such as early maturity, high sugar and low acid, seedless and high yield, tender and slag-free, and strong adaptability. Its fruit matures early, has a high soluble solids content and is resistant to storage and transportation. These characteristics give it a significant competitive advantage in the market. However, there are often counterfeit Golden Autumn Sugar Mandarin seedlings on the market. At present, there is a lack of efficient Golden Autumn Sugar Mandarin variety-specific molecular marker identification technology, and it is impossible to efficiently identify it from other sugar mandarin varieties / lines, which brings great risks to the development of the citrus industry.

[0003] InDel (Insertion / Deletion) markers are molecular markers based on whole genome resequencing. They have been widely used in the identification of horticultural crops such as citrus, apples, and corn. InDel molecular marker technology is a molecular marker method based on insertion / deletion polymorphism and has a wide range of applications in genome research and breeding. Its advantages are as follows: by detecting insertion and deletion variations in the genome, it can reveal rich genetic diversity and is suitable for genome analysis of different species and individuals; InDel markers are usually evenly distributed and can provide high-resolution genetic maps, which is conducive to the fine positioning of genes and QTLs (quantitative trait loci); InDel variations are relatively stable and not easily affected by environmental and growth conditions, so they perform consistently in different experiments and repetitions; the detection method of InDel markers is relatively simple, and can usually be achieved through conventional experimental techniques such as PCR amplification and gel electrophoresis, with low cost and convenient operation; InDel marker technology can not only be used for genome research of plants and animals, but also for variation detection and disease research of microbial and human genomes; with the help of modern high-throughput sequencing technology, InDel markers can be detected in large-scale parallel, which improves the efficiency and data output of genome research; InDel molecular marker technology has become an important tool in genome research and molecular breeding with its high efficiency, stability and economy.

[0004] The present invention aims to develop a variety-specific InDel molecular marker for the Golden Autumn Sugar Mandarin Orange (Zhonggan Institute No. 5), which is conducive to distinguishing and defining this variety from the currently main cultivated sugar mandarin orange varieties at the molecular level, and at the same time can provide technical support for variety protection and rapid identification. Summary of the invention

[0005] In order to solve the technical problems raised in the background technology, the present invention provides an InDel marker and application for the identification of Golden Autumn Sugar Mandarin oranges.

[0006] The present invention is implemented by the following technical scheme: an InDel marker for identifying golden autumn sugar oranges, characterized in that the InDel marker is located at an InDel site where a deleted fragment exists on chromosome 2 of the sugar orange gene.

[0007] The nucleotide sequence of the InDel deletion fragment is shown in SEQ ID NO.1.

[0008] The present invention also aims to propose the application of the InDel marker in the identification of Golden Autumn Sugar Orange.

[0009] The present invention provides an InDel-labeled primer pair, wherein the nucleotide sequence of the upstream primer is shown as SEQ ID NO.2, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO.3.

[0010] The invention aims to propose the application of primer pairs in the identification of golden autumn sugar oranges.

[0011] The present invention also aims to provide a kit, which contains the primer pair as described above.

[0012] Based on the above content, the present invention also proposes a method for identifying golden autumn tangerines, which comprises the following steps:

[0013] Step 1: After whole genome resequencing of the sugar orange varieties / lines, the clean reads obtained by filtration were compared with the reference genome of Nanfeng mandarin orange using bwa software, and the differential InDel sites between the 'Jinqiu sugar orange' and the other 15 sugar orange varieties / lines were compared and analyzed, so as to screen out the specific InDel sites between the two;

[0014] Step 2: Select InDel sites with insertion / deletion fragments larger than 3 bp according to the results, and remove InDel sites with other insertion / deletion fragments 50 bp upstream and downstream, and finally obtain a differential InDel site library;

[0015] Step 3: Based on the whole genome sequence of sweet orange, the selected InDel site was located on the genome, and primers were designed with 300 bp base length on both sides of the InDel site, for a total of 600 bp fragment length;

[0016] Step 4: Perform PCR amplification on the Golden Autumn Sugar Orange using the designed and synthesized primers, and screen to obtain a primer pair in which the nucleotide sequence of the upstream primer is as shown in SEQ ID NO.2 and the nucleotide sequence of the downstream primer is as shown in SEQ ID NO.3;

[0017] Step 5, using the primer pair to amplify in Golden Autumn Sugar Orange to obtain an amplified product;

[0018] Step 6: Perform electrophoresis on the amplified product and identify it based on the inspection results.

[0019] Specifically, the amplified product is two bands of 441 bp and 607 bp, which is the 'Golden Autumn' variety.

[0020] Preferably, the tangerine varieties include common tangerine, August tangerine, Golden Autumn tangerine (Zhonggansuo No. 5), Golden Sunflower, Lipu large-fruit tangerine, Lingchuan early-maturing tangerine, Zhongshan early-maturing tangerine, Lantern tangerine, Guangdong late-maturing tangerine, Zhaoping large-fruit tangerine, Chongzuo large-fruit Lipu, Qingxiang honey tangerine (large leaf), Qingxiang honey tangerine (small leaf), Guangdong tangerine superior series No. 1, Guangdong tangerine superior series No. 2, and Guangdong tangerine superior series No. 3.

[0021] Preferably, the primer pair proposed in the above scheme or a kit containing the primer pair can be used for identification.

[0022] Compared with the prior art, the present invention has the following beneficial effects:

[0023] 1. The molecular marker primers proposed in the present invention can be amplified in sugar orange materials to obtain DNA molecular bands of different fragment sizes. The molecular marker amplification is stable and can be directly used for the rapid identification of golden autumn sugar oranges.

[0024] 2. The molecular marker provided by the present invention has good specificity and wide applicability. The screened ST-10 primer can specifically obtain two polymorphic bands of 441bp and 607bp respectively after amplification of the 'Golden Autumn' variety, and can be used to identify the Golden Autumn Sugar Orange from 16 existing main varieties / lines of Sugar Orange. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 This is a graph of the amplification results of 16 sugar orange varieties / lines drawn based on InDel primer ST-10;

[0026] Among them: 1. Ordinary sugar mandarin; 2. August mandarin; 3. Golden Autumn sugar mandarin (No. 5 of China Orange Institute); 4. Golden sunflower; 5. Lipu large-fruit sugar mandarin; 6. Lingchuan early-maturing sugar mandarin; 7. Zhongshan early-maturing sugar mandarin; 8. Lantern mandarin; 9. Guangdong late-maturing sugar mandarin; 10. Zhaoping large-fruit sugar mandarin; 11. Chongzuo large-fruit sugar mandarin; 12. Large-leaf green fragrant mandarin; 13. Small-leaf green fragrant mandarin; 14. Guangdong sugar mandarin superior series No. 1, 15. Guangdong sugar mandarin superior series No. 2; 16. Guangdong sugar mandarin superior series No. 3. DETAILED DESCRIPTION

[0027] The present invention is further described below in conjunction with the accompanying drawings and specific implementation methods. It should be noted that, under the premise of no conflict, the various embodiments or technical features described below can be arbitrarily combined to form a new embodiment.

[0028] Example:

[0029] This study proposes an identification method for the early-maturing variety of sugar orange, 'Jinqiu'

[0030] After whole genome resequencing of 16 sugar orange varieties / lines (Table 1), the clean reads obtained by filtering were compared with the reference genome of Nanfeng mandarin orange using bwa software. The differential InDel sites between the 'Sandangju' variety and the other 16 sugar orange varieties / lines were further compared and analyzed to screen out the specific InDel sites between the two. Based on the results, InDel sites with insertion / deletion fragments greater than 3 bp were selected, and InDel sites with other insertion / deletion fragments 50 bp upstream and downstream were eliminated, and finally a library of differential InDel sites was obtained. Subsequently, based on the whole genome sequence of sweet orange, the screened InDel sites were located on the genome, and primers were designed with 300 bp base length on both wings of the InDel site, for a total of 600 bp fragment length.

[0031] The nucleotide sequence of the InDel deletion fragment is shown in SEQ ID NO.1.

[0032] TCTAACCAAGTTCTCGGAGAGACATAATTAACTGCATTGATCTCGGTAGCTACTCCACCCACAGAATTTAAAGAACCTAAAGGAGCATGAGTCAGTCCAGCACTGACTCTTCGATATATTTCTTGCTGAAAGTATCCCTGATCCCATTGATAACGGGTGGGACCAA.

[0033] Table 1 16 varieties / lines of sugar orange

[0034]

[0035] The designed and synthesized InDel primers were further used to perform PCR amplification on the 'Golden Autumn' variety of sugar orange and the other 15 sugar orange varieties / lines ST-10: ST-10-F: CCCTTACTTTA AAATAACGGACAGGG (SEQ ID NO.2); ST-10-R: AAGGTACACGC TCTGAGAAAAGA (SEQ ID NO.3).

[0036] This example proposes the use of molecular marker primers for variety identification of Sugar Orange 'Golden Autumn' in variety identification, and the steps are as follows:

[0037] Step 1: CTAB method was used to extract DNA from 16 sugar orange varieties / lines (specific sample names are shown in Table 1)

[0038] Step 2: Use 16 portions of sugar orange DNA as templates to perform the following PCR amplification reaction.

[0039] Condition a. PCR reaction system, configuration of 25 μL reaction system:

[0040]

[0041] Condition b. PCR reaction conditions

[0042] Pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 60°C-50°C (-1°C / cycle) for 30 s, extension at 72°C for 30 s, 10 cycles; denaturation at 95°C for 30 s, annealing at 47°C-60°C (specific values ​​are set according to primer annealing temperature) for 30 s, extension at 72°C for 30 s, 30 cycles; extension at 72°C for 5 min, hold at 12°C.

[0043] Step 3: The amplified product was detected by 2.0% agarose gel electrophoresis in a horizontal electrophoresis tank of an electrophoresis apparatus, using 1xTAE buffer (0.04M Tris-acetate, 0.001M EDTA, pH 8.0), voltage 8V / cm, and electrophoresis for 20 minutes. After the electrophoresis, the BIO-RAD gel imaging system (UVP) was used to take pictures and save them.

[0044] The molecular marker primers provided by the present invention have wide applicability and can be used to identify the 'Golden Autumn' variety from 16 existing main varieties / lines of sugar oranges. The screened ST-10 primers can specifically obtain two polymorphic bands of 441 bp and 607 bp respectively after amplification of the 'Golden Autumn' variety.

[0045] The above-mentioned embodiments are only preferred embodiments of the present invention and cannot be used to limit the scope of protection of the present invention. Any non-substantial changes and substitutions made by technicians in this field on the basis of the present invention shall fall within the scope of protection required by the present invention.

Claims

1. A kit comprising the following primer pair, characterized in that: The nucleotide sequence of the upstream primer is shown in SEQ ID NO.2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.

3.

2. The use of the kit according to claim 1 in the identification of golden autumn sugar oranges, characterized in that: Using the primer pair as described in claim 1, an amplification product is obtained in the Golden Autumn Sugar Mandarin Orange, and the amplification product is two bands of 441 bp and 607 bp, which is the Golden Autumn Sugar Mandarin Orange.

3. The identification method of golden autumn tangerine is characterized by: The method comprises the following steps: using the primer pair as described in claim 1 to amplify in Golden Autumn Sugar Mandarin oranges to obtain an amplified product; performing electrophoresis detection on the amplified product and performing identification according to the inspection result; if the amplified product is two bands of 441 bp and 607 bp, it is Golden Autumn Sugar Mandarin orange.

4. The identification method according to claim 3, characterized in that: The identification was performed using the kit as described in claim 1.

Images