A method and application of preparing hybridoma monoclonal antibody by immunizing mice with recombinant influenza virus

Abstract

The present application provides a method and application of preparing hybridoma monoclonal antibodies using recombinant influenza virus immunized mice, the recombinant influenza virus PA-antigen fusion gene used in the method, the PA-antigen fusion gene includes PA gene, codon conversion signal peptide sequence, 2A sequence, IL-2 signal peptide sequence, antigen gene sequence and CD80 C-terminal sequence from 5' segment. The present invention uses recombinant influenza virus to immunize mice by nasal infection. During the infection and immunity process, the replication of influenza virus in the upper respiratory tract of mice efficiently presents the target antigen and also stimulates the immune system of mice, so that the plasma cells secreting antibodies mature rapidly, and the antibody titer can be detected in about 10 days, so the time for preparing monoclonal antibodies can be greatly shortened; at the same time, the monoclonal antibodies obtained by the immunization method described in the present invention have a wider antigen binding area and higher affinity.

Description

Technical Field

[0001] The present application belongs to the field of biotechnology. Specifically, the present application provides a method for preparing hybridoma monoclonal antibodies by immunizing mice with recombinant influenza viruses and its application. Background Art

[0002] Influenza viruses are widely prevalent in poultry, mammals and humans. They have a wide host distribution and mutate quickly, often bringing a large disease burden to humans and animal husbandry such as poultry and pigs. From the perspective of virus taxonomy, influenza viruses are enveloped RNA viruses, and their RNA is negative stranded. The inner core of the influenza virus particle is a ribosomal nucleoprotein wrapped with single-stranded RNA, and the inner outer core is wrapped with matrix protein M1. The influenza virus genome consists of eight segmented linear gene fragments (influenza C virus has only seven gene fragments), and the eight gene fragments encode ten proteins, namely: RNA-dependent RNA polymerase (PB2, PB1, PA), nucleoprotein NP that forms the nucleocapsid, matrix membrane protein (M1, M2), two surface membrane proteins (hemagglutinin HA and neuraminidase NA), non-structural protein NS1 and nuclear export protein NEP. The transcription and replication of viral genes occur in the host cell nucleus, and the virus assembles and buds on the host cell membrane. Gene reassortment occurs when two different influenza viruses infect a cell at the same time. The eight gene segments of influenza virus encode a total of nine structural proteins (PB2, PB1, PA, HA, NP, NA, M1, M2, NEP) and one non-structural protein NS1.

[0003] Influenza viruses produce many natural gene deletions or insertions during genetic evolution, but deletions are the most common. These deletions or insertions play an important role in the pathogenicity of the virus, the expansion of the host range, and the adaptation to new hosts. Gene deletions are mainly concentrated in the NA gene and the NS1 gene, especially in animal-derived influenza viruses, which often occur during the process of infecting and adapting to new hosts, and the specific location and number of deletions vary between different strains. Insertions mainly occur when low-pathogenic influenza viruses become highly pathogenic influenza viruses, and multiple basic amino acids, such as KRRK, are inserted before the cleavage site / GLF motif of the HA gene. This type of insertion of multiple basic amino acids in the HA protein only occurs in H5 and H7 subtype influenza viruses. These deletions and insertions of influenza viruses indicate that the genome of the virus can tolerate mutations at these positions, so people try to modify influenza viruses through the positions of deletions, such as NS1 gene deletion viruses.

[0004] At the same time, studies have shown that foreign genes, such as the human interleukin 15 (IL15) gene, can be added to the NS1 deletion region. Such recombinant viruses can express the target protein IL15, thereby using the influenza virus as an expression system for foreign genes and playing a certain role in immune regulation in vivo. By taking advantage of the NA deletion and adding the GFP protein gene to the NA gene, the recombinant influenza virus can express GFP during replication, and the recombinant virus has biological characteristics similar to those of the wild virus, so that the virus can be visualized when it infects the body. The foreign genes carried by the modified influenza virus are mostly used as more sensitive reporter viruses to screen antiviral drugs or study pathogenic mechanisms.

[0005] Hybridoma monoclonal antibody technology is to immunize mice with appropriate antigens, then take the spleen cells (antibody-forming cells) of the immune mice (PEG) and mice or take the spleen cells of in vitro immunization, and fuse them with polyethylene glycol myeloma cell lines to form hybridomas that secrete monoclonal antibodies. This method is currently the mainstream technology for monoclonal antibody preparation and screening, among which the selection and application of antigens are important factors in the quality and success rate of monoclonal antibody preparation. Summary of the invention

[0006] The present invention utilizes the 5' and 3' end virus particle packaging signal sequences of the influenza A virus polymerase gene PA, clones the gene fragment encoding the target protein (influenza virus H7N9 subtype hemagglutinin HA, herpes zoster virus surface glycoprotein gE, norovirus nucleocapsid protein VP1) to the 3' end of the influenza virus PA gene by genetic engineering, and rescues and packages recombinant influenza viruses with infection and replication activity as immunogens by reverse genetic technology. The recombinant viruses are named FluVec-H7, FluVec-gE, and FluVec-NoV / VP1. Two weeks after mice were immunized with the above recombinant viruses through nasal drops, mouse spleen cells were collected and fused with SP20 to screen monoclonal hybridoma cell lines that secrete the target protein. Compared with the traditional method of screening hybridomas by immunizing mice with protein antigens, the above method of immune screening of mouse monoclonal antibodies has a large number of monoclonal antibodies screened by the present invention, high quality, and greatly shortened the time required for the entire process. It has a high application prospect.

[0007] On the one hand, the present application provides a method for preparing hybridoma monoclonal antibodies by immunizing mice with recombinant influenza virus. The recombinant influenza virus PA-antigen fusion gene used in the method comprises, from the 5' segment, a PA gene, a codon conversion signal peptide sequence, a 2A sequence, an IL-2 signal peptide sequence, an antigen gene sequence, and a C-terminal sequence of CD80.

[0008] Furthermore, the antigen is influenza virus H7N9 subtype hemagglutinin HA, herpes zoster virus surface glycoprotein gE or norovirus nucleocapsid protein VP1.

[0009] Furthermore, the sequence of the PA gene is shown in SEQ ID NO.13.

[0010] Furthermore, the sequence of the codon conversion signal peptide sequence is shown as SEQ ID NO.14.

[0011] Furthermore, the sequence of the 2A sequence is shown as SEQ ID NO.15.

[0012] Furthermore, the sequence of the IL-2 signal peptide sequence is shown as SEQ ID NO.16.

[0013] Furthermore, the sequence of the C-terminal sequence of CD80 is shown as SEQ ID NO.17.

[0014] Furthermore, the antigen gene sequence is selected from any one of SEQ ID NO.9-12.

[0015] Furthermore, the recombinant influenza virus is obtained by rescue preparation through a reverse genetics system.

[0016] Furthermore, the method includes the step of immunizing mice with the recombinant influenza virus.

[0017] Furthermore, mice were immunized by intranasal drip at a dose of 1×10 4 -10 6 pfu.

[0018] The method of the present application can be used for antibody preparation.

[0019] In the traditional mouse hybridoma monoclonal antibody technology, the immune process requires the protein antigen and adjuvant to be matched and then injected intramuscularly or subcutaneously. In order to achieve a higher immune titer against the antigen, multiple booster immunizations are usually required, so that the entire immune process usually takes 6 weeks, and before the spleen fusion, the mouse serum needs to be collected to determine the reaction titer of its antibody and the target antigen. Usually, it can reach 1:100000 times before fusion can be performed to screen more specific monoclonal antibodies. The present invention uses recombinant influenza virus to immunize mice using the route of nasal infection. During the infection and immunization process, the influenza virus replicates in the upper respiratory tract of the mouse and efficiently presents the target antigen while also stimulating the mouse's immune system, so that the plasma cells that secrete antibodies mature rapidly, and the antibody titer can be detected in about 10 days, so the time for preparing monoclonal antibodies can be greatly shortened. In addition, through in-depth analysis of the monoclonal antibodies screened out by different immunization methods for the same antigen, it is found that the monoclonal antibodies obtained by the immunization method described in the present invention have a wider binding area with the antigen and a higher affinity, and there is a broad space in scientific research, clinical and industrial applications. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This is a diagram of the genetic modification model of the PA gene (taking H7 subtype influenza virus HA as an example). DETAILED DESCRIPTION

[0021] Example 1 Preparation of carrier

[0022] The pHW2000 empty vector is described in the following literature: A DNA transfection system for generation of influenza A virus from eight plasmids. PNAS (97) 11;6108-6113; the public can obtain it from Zoonogen Innovation Research Center. Bsm The sequences of the BI recognition site were transformed into the universal sequences of influenza A virus, uni12 (5-'AGCGAAAGCAGG-3') and uni13 (5'-AGTAGAAACAAGG-3'). After the uni12 and uni13 sequences were connected, a StuI recognition sequence (AGG / CCT) was formed in the middle. This vector was named pHKU_FluA vector, which is recorded in the following literature, Multiple basic amino acids in the cleavage site of H7N9 hemagglutinin contribute to high virulence in mice JThorac Dis 2021;13(8):4650-4660;. The public can obtain it from the Zoonogen Innovation and Research Center.

[0023] For pHKU_FluA vector and rCutSmart restriction buffer, This I 10U, total volume 50µL, 37°C overnight digestion. The fragment of about 3000bp was recovered from the electrophoresis gel, which was the linearized pHW2000 vector. The linearized fragment was in-fused with the PCR product of the HA gene from A / PuertoRico / 8 / 1934 (H1N1, PR8) to obtain the recombinant vector pHW2000-PR8_HA (after sequencing, the vector was obtained by inserting the H1 gene shown in sequence 1 into the pHW2000 vector);

[0024] Sequence 1:

[0025]

[0026] use This I linearized pHW2000 vector and then in-fusion connected with the NA gene PCR product derived from A / PR / 8 / 1934 (H1N1) to obtain the recombinant vector pHW2000-PR8_NA (after sequencing, the vector was obtained by inserting the N1 gene shown in sequence 2 into the pHW2000 vector);

[0027] Sequence 2:

[0028]

[0029] use This I linearized pHW2000 vector and in-fusion ligated it with the PB2 gene PCR product derived from A / PR / 8 / 1934 (H1N1) to obtain the recombinant vector pHW2000-PR8_PB2 (after sequencing, the vector was obtained by inserting the gene PB2 shown in sequence 3 into the pHW2000 vector);

[0030] Sequence 3:

[0031]

[0032] use This I linearized pHW2000 vector and in-fusion connected it with the PB1 gene PCR product derived from A / PR / 8 / 1934 (H1N1) to obtain the recombinant vector pHW2000-PR8_PB1 (after sequencing, the vector was obtained by inserting the gene PB1 shown in sequence 4 into the pHW2000 vector);

[0033] Sequence 4:

[0034]

[0035] use This I linearized pHW2000 vector and in-fusion connected it with the PA gene PCR product derived from A / PR / 8 / 1934 (H1N1) to obtain the recombinant vector pHW2000-PR8_PA (after sequencing, the vector was obtained by inserting the gene PA shown in sequence 5 into the pHW2000 vector);

[0036] Sequence 5

[0037]

[0038] use This I linearized pHW2000 vector and in-fusion ligated it with the NP gene PCR product derived from A / PR / 8 / 1934 (H1N1) to obtain the recombinant vector pHW2000-PR8_NP (after sequencing, the vector was obtained by inserting the gene NP shown in SEQ ID NO: 6 into the pHW2000 vector);

[0039] Sequence 6

[0040]

[0041] use This I linearized pHW2000 vector and in-fusion ligated it with the M gene PCR product derived from A / PR / 8 / 1934 (H1N1) to obtain the recombinant vector pHW2000-PR8_M (after sequencing, the vector was obtained by inserting the gene NP shown in SEQ ID NO: 7 into the pHW2000 vector);

[0042] Sequence 7

[0043]

[0044] use This I linearized pHW2000 vector and in-fusion ligated it with the NS gene PCR product derived from A / PR / 8 / 1934 (H1N1) to obtain the recombinant vector pHW2000-PR8_NS (after sequencing, the vector was obtained by inserting the gene NP shown in sequence 8 into the pHW2000 vector);

[0045] Sequence 8

[0046] Agcaaaagcagggtgacaaaaacataatggatccaaacactgtgtcaagctttcaggtagattgctttctttggcatgtccgcaaacgagttgcagaccaagaactaggcgatgccccattccttgatcggcttcgccgagatcagaaatccctaagaggaaggggcagtactctcggtctggacatcaagacagccacacgtgctggaaagcagatagtggagcggattctgaaagaagaatccgatgaggcacttaaaatgaccatggcctctgtacctgcgtcgcgttacctaactgacatgactcttgaggaaatgtcaagggactggtccatgctcatacccaagcagaaagtggcaggccctctttgtatcagaatggaccaggcgatcatggataagaacatcatactgaaagcgaacttcagtgtgatttttgaccggctggagactctaatattgctaagggctttcaccgaagagggagcaattgttggcgaaatttcaccattgccttctcttccaggacatactgctgaggatgtcaaaaatgcagttggagtcctcatcggaggacttgaatggaatgataacacagttcgagtctctgaaactctacagagattcgcttggagaagcagtaatgagaatgggagacctccactcactccaaaacagaaacgagaaatggcgggaacaattaggtcagaagtttgaagaaataagatggttgattgaagaagtgagacacaaactgaagataacagagaatagttttgagcaaataacatttatgcaagccttacatctattgcttgaagtggagcaagagataagaactttctcgtttcagcttatttagtactaaaaaacacccttgtttctact

[0047] Specifically:

[0048] Will ThisI linearized pHW2000 vector and various gene PCR products were subjected to 1% agarose electrophoresis buffer; the target fragment and vector were cut and recovered into a weighed 1.5 mL EP tube, and purified using QIAEXII Gel Extraction Kit: add 3 volumes of Buffer QXl (100 mg plus 300µL QX1). Add 30µL Buffer QIAEX II and then water bath at 50℃ for 10 minutes, vortexing every two minutes. Centrifuge at 13,000 rpm for 30 seconds, discard the supernatant, add 500µL QIAEX I to wash once, add 500µL Buffer PE to wash twice, discard the supernatant, and air dry for 15 minutes until the precipitate turns white. Add 20µL TE, vortex for 30 seconds, incubate for 5 minutes, centrifuge at 13,000 rpm for 30 seconds, transfer the supernatant into a 1.5 mL EP tube, and measure the concentration.

[0049] According to the principle of in-fusion technology, the linearized pHW2000 vector and HA and other gene fragments have 15 bases overlapped. In-fusion technology can make them spliced ​​according to the overlapped parts. Using Clonetech's in-fusion kit, the specific operation is as follows: 5 × in-fusion buffer 2µL, Enzyme 1µL, linearized pHW2000 vector, target gene fragment, water, total volume 10µL. The amount of vector and each fragment meets the molar ratio of 2:1. The in-fusion mixture is treated at 37℃ for 15 minutes and 50℃ for 15 minutes. 40µL TE buffer is added to make up to 50µL, and 2.5µL is taken to transform into competent cells. The transformed competent cells are placed in ice for 30 minutes, heated at 42℃ for 45 seconds, and then placed in ice for 1 minute. LB medium is added and shaken at 37℃ for 60 minutes. Take 100 µL of LB agar plate containing ampicillin and culture at 37°C for 16 hours to form a single colony. Pick a single colony and culture it in LB medium containing ampicillin for 8 hours. Use QIAprepSpin Miniprep Kit to extract plasmids from the 8-hour culture liquid: Pour the bacterial liquid into a labeled 1.5mL centrifuge tube, centrifuge at 13,000 rpm, 4°C for 3 minutes, discard the supernatant; add 250 µL Buffer P1, mix well, add 250 µL Buffer P2, quickly and gently invert 4-6 times; add 350 µL Buffer N3, invert 4-6 times to mix, white flocs precipitate, 13,000 rpm, 4°C for 10 minutes; put the QIAprep spin column in a 1.5mL EP tube (to collect waste liquid) and then transfer the supernatant to the QIAprep spincolumn, 8000rpm 4°C for 1 minute; discard the waste liquid, add 750 µL Buffer PE, 13,000 rpm, 4℃, 1 min, discard the waste liquid, centrifuge at 13,000 rpm, 4℃, 1 min, transfer the QIAprep spin column to a new 1.5mL centrifuge tube, vertically add 30 µL Buffer EB on the membrane, let it stand for 1 min, and centrifuge at 4℃, 13,000 rpm, 1min to obtain the liquid monoclonal plasmid.

[0050] The sequencing results were correct, and the recombinant vectors pHW2000-PR8_HA, pHW2000-PR8_NA, pHW2000-PR8_PB2, pHW2000-PR8_PB1, pHW2000-PR8_PA, pHW2000-PR8_NP, pHW2000-PR8_M, pHW2000-PR8_NS and pHW2000-PR8_PA-H7, pHW2000-PR8_PA-gE, and pHW2000-PR8_PA-VP1 were obtained.

[0051] The gene sequences used in the preparation of recombinant influenza virus and the expression of corresponding antigens are respectively from Flu / A / H7 HA: GenBankEPI2474083; VZV / gE PDB ACCESSION: P09259, NoV / VP1: GenBank: JQ911594.1

[0052] Sequence 9 Flu / A / H7 HA gene sequence:

[0053] GACAAAATCTGCCTCGGACATCATGCCGTGTCAAACGGAACCAAAGTAAACACATTAACTGAAAGAGGAGTGGAAGTCGTCAATGCAACTGAAACAGTGGAACGAACAAACACCCCCAGGATCTGCTCAAAAGGGAAAAGGACAGTTGACCTCGGCCAATGTGGACTCCTGGGGGCAATCACTGGACCACCTCAATGTGACCAATTCCTAGAATTTTCGGCCGATTTAATTATTGAGAGGCGAGAAGGAAGTGATGTCTGTTATCCTGGAAAATTCGTGAATGAAGAAGCTCTGAGGCAAATTCTCAGAGAATCAGGCGGAATTGACAAGGAACCCATGGGATTCACATACAATGGAATAAGAACTAATGGGGTGACCAGTGCATGTAGGAGATCAGGATCTTCATTCTATGCAGAAATGAAATGGCTCCTGTCAAACACAGATAATGCTGCATTCCCGCAGATGACTAAGTCATATAAAAATACAAGAGAAAGC CCAGCTATAATAGTATGGGGGATCCATCATTCCGTTTCAACTGCAGAGCAAACCAAGCTATATGGGAGTGGAAACAAACTGGTGACAGTTGGGAGTTCTAATTATCAACAATCTTTCGTACCGAGTCCAGGAGCAAGACCACAAGTTAATGGTCAATCTGGAAGAATTGACTTTCATTGGCTAATACTAAATCCCAATGATACAGTCACTTTCAGTTTCAATGGGGCTTTCATAGCTCCAGACCGTGCAAGCTTCCTGAGAGGAAAATCTATGGGAATCCAGAGTGGAGTACAGGTTGATGCCAATTGTGAAGGGGACTGCTATCATAGTGGAGGGACAATAATAAGTAACTTGCCATTTCAGAACATAGATAGCAGGGCAGTTGGAAAATGTCCGAGATATGTTAAGCAAAGGAGTCTTCTGCTGGCAACAGGGATGAAGAATGTTCCTGAGGTTCCAAAGAGAAACGGACTGCGAGAGGCCTATTTGGTTAA

[0054]

[0055] Sequence 11: NoV / VP1GII.4 (used in subsequent experiments):

[0056]

[0057] Sequence 12 NoV / VP1 GII.17:

[0058]

[0059] Using the recombinant vector pHW2000-PR8_PA as a template, the mutated packaging sequence (CSPS), PTV-1-2A sequence, signal peptide sequence, three target antigen genes (FluVec-H7, FluVec-gE, FluVec-NoV / VP1), and PB8-PA gene packaging signal sequence were linked in sequence by the in-fusion method to obtain the recombinant vectors pHW2000-PR8_PA-H7, pHW2000-PR8_PA-gE, and pHW2000-PR8_PA-VP1 (after sequencing, the vector was a recombinant vector obtained by inserting the three genes shown in sequences 9-11 into the pHW2000 vector).

[0060] Recombinant PA plasmid sequence 1, sequence 13 for reverse genetics:

[0061]

[0062] Mutated packaging sequence, Sequence 14:

[0063] CTCGAGCCAGGAACGTTCGACCTAGGAGGACTGTACGAGGCGATCGAAGAATGTCTCATAAACGACCCTTGGGTATTACTAAACGCATCATGGTTTAACTCGTTCCTGACTCACGCTTTAAGC

[0064] 2A sequence, Sequence 15:

[0065] GGATCTGGAGCCACGAACTTCTCTCTGTTAAAGCAAGCAGGAGATGTTGAAGAAAACCCCGGGCCT

[0066] IL-2 signal peptide sequence, Sequence 16:

[0067] ATGTACAGGATGCAACTCCTGTCTTGCATTGCACTAAGTCTTGCACTTGTCACGAATTCG

[0068] C-terminal 237 - 306 of CD80, Sequence 17:

[0069] CCACCAGAAGATCCACCAGATTCAAAAAATACACTTGTGCTTTTCGGAGCAGGATTCGGAGCAGTGATAACAGTGGTGGTGATAGTGGTGATAATAAAATGCTTCTGCAAACATAGATCATGCTTCAGAAGAAATGAAGCATCAAGAGAAACAAATAATTCACTTACATTCGGACCAGAAGAAGCACTTGCAGAACAAACAGTGTTCCTTTAA

[0070] PA packaging sequence, Sequence 18:

[0071] CTGGAACCTGGGACCTTTGATCTTGGGGGGCTATATGAAGCAATTGAGGAGTGCCTGATTAATGATCCCTGGGTTTTGCTTAATGCTTCTTGGTTCAACTCCTTCCTTACACATGCATTGAGTTAGTTGTGGCAGTGCTACTATTTGCTATCCATACTGTCCAAAAAAGTACCTTGTTTCTACT

[0072] Recombinant PA plasmid sequence 2 for reverse genetics, sequence 19:

[0073] CCACCAGAAGATCCACCAGATTCAAAAAATACACTTGTGCTTTTCGGAGCAGGATTCGGAGCAGTGATAACAGTGGTTGGTGATAGTGGTGATAATAAAATGCTTCTGCAAACATAGATCATGCTTCAGAAGAAATGAAGCATCAAGAGAAACAAATAATTCACTTACATTCGGACCAGAAGAAGCACTTGCAGAACAA ACAGTGTTCCTTTAACTGGAACCTGGGACCTTTGATCTTGGGGGGCTATATGAAGCAATTGAGGAGTGCCTGATTAATGATCCCTGGGTTTTGCTTAATGCTTCTTGGTTCAACTCCTTCCTTACACATGCATTGAGTTAGTTGTGGCAGTGCTACTATTTGCTATCCATACTGTCCAAAAAAGTACCTTGTTTCTACT

[0074] Examples of PA gene genetic modification models are shown in Figure 1 .

[0075] Example 2 Transfection rescue virus

[0076] For details on the recombinant virus preparation and identification methods, please refer to our company's related invention patent CN113073115B.

[0077] The recombinant vectors constructed above were transfected into mixed cells of 293T cells according to the following combinations to obtain recombinant viruses.

[0078] 0.5 μg of each of pHW2000-PR8_HA, pHW2000-PR8_NA, pHW2000-PR8_PB2, pHW2000-PR8_PB1, pHW2000-PR8_NP, pHW2000-PR8_M, pHW2000-PR8_NS and three target genes (pHW2000-PR8_PA-H7, pHW2000-PR8_PA-gE, pHW2000-PR8_PA-VP1) were mixed to prepare an 8-plasmid system to obtain a mixed vector A required for virus packaging;

[0079] 1) Take a bottle of 293T cells (ATCC-CRL-3216) T75 with good growth status, digest them with 0.25% EDTA-trypsin, and centrifuge at 1,000 rpm for 10 minutes. Disperse them after centrifugation and resuspend them with 10mL Opti-MEM. Take the resuspended 293T and add Opti-MEM to 20mL. Take a six-well plate and add 3mL of resuspended 293T cell suspension (5×10 4 ) and then placed in 37 nights.

[0080] 2) Take 0.5 µg of each recombinant vector obtained in 2 above and mix them to make the vectors have equal mass;

[0081] 3) Add 10 µL of the above-mentioned mixed vector A and liposomes, place at room temperature for 20 minutes, and then add Opti-MEM to 1 mL. Aspirate the waste liquid in the six-well plate, add Opti-MEM mixed with plasmids, and place in a 37℃ 5% CO2 incubator overnight. The next day, each well was supplemented with 1mL of Opti-MEM containing 2µg / mL TPCK-Trypsin, and the cells were cultured in a 37℃ 5% CO2 incubator in a Class II biosafety laboratory for 48 hours before collecting the cell suspension. The collected transfection supernatant is the E0 generation virus, and its hemagglutination titer is determined using 1% turkey red blood cells.

[0082] 4) Select 9- to 11-day-old SPF chicken embryos and inspect them to observe the vitality of the embryos. Mark the edge of the embryo surface and the air chamber, avoiding blood vessels and the head of the chicken embryo, to be the injection point. Disinfect the marked area and the surrounding area with 75% alcohol, and drill holes with an egg drill without damaging the shell membrane.

[0083] 5) 0.2 mL / chicken embryo of the cell transfection suspension was used for inoculation into the allantoic cavity of the chicken embryos. Two chicken embryos were inoculated for each sample.

[0084] 6) Seal the chicken embryo with wax and place it in a 37°C incubator for culture. Harvest the chicken embryo allantoic fluid after 48-72 hours, and use 1% turkey red blood cells to determine the hemagglutination titer (World Health Organization, Manual on Animal InfluenzaDiagnosis and Surveillance, Serologic diagnosis of influenza virus infections by hemagglutination inhibition, edition 4, 78-79, 2004). Hemagglutination positive is the packaged recombinant virus PB1-RBD, and the virus generation is chicken embryo 1 (E1). The hemagglutination titers of the recombinant viruses obtained are all 128 HAU / 50L (i.e. 2 7 )above.

[0085] The recombinant virus was propagated for five consecutive generations by lysing chicken embryos, and the antibody gene was amplified by nucleic acid and sequenced to verify that the antibody gene had no mutations.

[0086] Detection of exogenous genes of recombinant influenza virus:

[0087] Detect transgenic fragments in influenza A virus (IAV) rgH1N1(PR8)-PA-H7, rgH1N1(PR8)-PA-gE, rgH1N1(PR8)-PA-VP1.

[0088] Identification of target antigens expressed by recombinant influenza viruses:

[0089] The colloidal gold swabs produced by our company were used to qualitatively determine the target antigens expressed by the recombinant influenza virus during the virus amplification process, and the antigens were qualitatively detected in the allantoic fluid after 48-72 hours of chicken embryo culture (blank and irrelevant recombinant viruses were used as controls). The results showed that on average, all three target antigen swabs were positive, indicating that the recombinant virus successfully expressed the target protein during the chicken embryo replication process.

[0090] The prepared recombinant influenza viruses were named FluVec-H7, FluVec-gE, and FluVec-NoV / VP1.

[0091] Example 3 Immunization and Antibody Screening Experiments

[0092] Insect baculovirus was used to infect insect cells sf9 to express influenza virus H7 subtype HA trimer antigen, and Escherichia coli prokaryotes were used to express VZV virus gE antigen and Norovirus VP1 antigen. The gene sequences expressing the above three recombinant antigens were consistent with the gene sequences used to package recombinant influenza viruses (4.①.1) at the protein level. The expressed recombinant proteins were identified for biological activity and used for traditional subcutaneous muscle immunization and antigen coating.

[0093] Mouse immunization:

[0094] Recombinant influenza virus nasal immunization

[0095] The mice were anesthetized with isoflurane inhalation and 25 μl of 10 5 8-year-old female BALB / C mice were immunized with pfu recombinant influenza virus intranasally (in), and 5 mice were immunized with each recombinant influenza virus antigen. About 30 μl of serum was collected from the eye sockets of the mice on the 12th day after infection, and the antibody titer against the target antigen in the serum was determined using the method described in 4③.

[0096] Recombinant protein antigen subcutaneous / muscular immunization

[0097] 40 μg of recombinant protein was mixed with an equal volume of Freund's complete adjuvant to a total volume of 100 μl (Sigma-Aldrich, CAT: F5881) and immunized by multiple injections (ip / im) in the abdomen and footpads of 8-week-old female BALB / C mice. Five mice were immunized with each of the three antigens (reFlu / A-H7, reVZV-gE, and reNoV-VP1); immunization was repeated once at 0, 2, and 4 weeks according to the above method, for a total of three immunizations. Six weeks after the first immunization, mouse serum was collected to detect antibody titers. The mouse with the highest titer was selected and boosted with 20 μg of recombinant protein through the tail vein. Three days later, the mouse spleen was taken for fusion and preparation of hybridoma cells.

[0098] Fusion and mAb screening:

[0099] ELISA method to identify recombinant proteins / screen positive hybridomas

[0100] A 96-well microplate was coated with purified recombinant proteins (including H7 subtype HA trimer antigen: reFlu / A-H7, VZV virus gE antigen: reVZV-gE, Norovirus VP1 antigen: reNoV-VP1 in the present invention), and the reactivity of the above three antigens with the corresponding positive mouse serum or commercial monoclonal antibodies was identified by ELISA method. First, the recombinant protein was coated in the microplate (coating buffer carbonate buffer sodium carbonate 1.59g sodium bicarbonate 2.93g fixed to 1L pure water), the coating concentration was 1μg / mL, and it was incubated at 4°C overnight; 1% gelatin was blocked, 150 μL per well, 37°C for 2 hours, the plate was washed once with detergent, and patted dry; the antigen-specific positive serum was diluted (PBS) at a gradient of 1:100, 1:1000, 1:10000, 1:10000, and 50 μL was added to the microplate coated with the antigen, and the reaction was carried out at 37°C for 30 minutes. The liquid in the wells was shaken off, and the plate was washed 4 times with PBST washing solution. After patting dry, 50 μL / well of HRP-labeled goat anti-mouse secondary antibody (diluted with PBS at 1:10000) was added. The plate was reacted at 37°C for 30 min, and then the plate was washed 4 times. After patting dry, 100 μL / well of TMB color developing solution was added for color development at room temperature for 10 min. Finally, 0.5 M sulfuric acid was added to terminate the reaction, and the OD450 nm value was measured with an enzyme reader. Negative control and blank control wells were set at the same time.

[0101] Mouse spleen cells were fused with myeloma cells SP2 / 0 by PEG1450 (Merk) to prepare hybridoma cells that secrete antibodies. Ten days after fusion, the antibodies specifically secreted against the target antigen were screened by the ELISA method described in 4③. After the positive hybridoma cells were limitedly diluted to a monoclonal state, the titer of the cell culture supernatant was determined, and the label protein, irrelevant antigen, etc. were used as background controls to screen out the cell strains that can secrete the three antigen-specific antibodies described in the present invention.

[0102] For the same target antigen, the monoclonal antibodies screened by different immunization methods were characterized, including affinity activity, approximate binding area with antigen, linear / conformational epitopes, neutralization activity, etc. The results showed that the monoclonal antibodies screened by the recombinant influenza virus infection immunization method were superior to the traditional screening methods in the above aspects (see Table 1). We define the multiple monoclonal antibodies screened for the same target antigen as high-quality monoclonal antibodies with a. high affinity (ELISA detection OD reading value exceeds 1.2), b. extensive binding to different positions of the antigen (binding to different fragments of the antigen, such as H7 monoclonal antibodies mainly concentrated in the HA1 site, and if there is binding to HA2, it is considered to be a wide binding position; the other two antigens are similar, with the N-terminal and C-terminal fragments of the antigen as reference), and c. clones with neutralization activity; the proportion of these high-quality monoclonal antibodies (any two of the above three indicators appearing at the same time can be counted as a high-quality monoclonal antibody) to all positive monoclonal antibodies is called the high-quality monoclonal antibody rate, that is, the proportion of "good" monoclonal antibodies.

[0103] The present invention selects three antigens and uses viral vector infection immunization to compare with traditional immunization methods. The fusion rates of the three antigens remain consistent under different immunization strategies, but the positive rate and high-quality monoclonal antibody rate are significantly better than traditional immunization methods in the three projects (see Table 2). The positive rate refers to the ratio of the wells that specifically bind to the antigen detected in the supernatant of the fusion plate to all fusion wells (5X96X fusion rate) after 2 weeks of fusion of 5 96-well plates per mouse spleen. The fusion rate refers to the ratio of the number of wells in which the spleen is fused with sp20 into hybridoma cells to all wells (5X96) after 10 days of fusion of 5 96-well plates per mouse spleen.

[0104] Table 1 Comparison of different immunization methods

[0105]

[0106] Table 2 Comparison of monoclonal antibodies obtained by infection immunization and traditional immunization in different projects

[0107]

[0108] In summary, the method of preparing mouse monoclonal antibodies using hybridoma technology and using recombinant influenza virus as an immunogen for mouse immunization described in the present invention has obvious advantages over the existing hybridoma technology.

Claims

1. A method for preparing hybridoma monoclonal antibodies by immunizing mice with recombinant influenza virus, characterized in that: The recombinant influenza virus PA-antigen fusion gene used in the method includes, from the 5' segment, the PA gene, the codon conversion signal peptide sequence, the 2A sequence, the IL-2 signal peptide sequence, the antigen gene sequence and the C-terminal sequence of CD80; the antigen is the influenza virus H7N9 subtype hemagglutinin HA, and the gene sequence of the antigen is shown in SEQ ID NO.9; The sequence of the PA gene is shown in SEQ ID NO.13; The sequence of the codon conversion signal peptide sequence is shown in SEQ ID NO.14; the sequence of the 2A sequence is shown in SEQ ID NO.15; the sequence of the IL-2 signal peptide sequence is shown in SEQ ID NO.16; the sequence of the CD80 C-terminal sequence is shown in SEQ ID NO.17; The recombinant influenza virus is obtained by rescue preparation through a reverse genetics system.

2. The method according to claim 1, comprising the step of immunizing mice with recombinant influenza virus, wherein the mice are immunized by nasal drops at a dose of 1×10 4 -10 6 pfu.

Images