Engineered escherichia coli and uses thereof
By knocking out the type I fimbriae gene in Escherichia coli and expressing a fusion protein with membrane anchoring and targeting domains, the toxicity and efficiency problems of existing CAF targeting strategies have been solved, achieving specific targeting and killing of tumor cells with high biosafety and sustained anti-tumor effects.
Patent Information
- Application Number
- CN202411060906.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-08-02
- Publication Date
- 2025-12-19
- Estimated Expiration
- 2044-08-02
AI Technical Summary
Existing strategies targeting cancer-associated fibroblasts (CAFs) suffer from systemic toxicity, high cost, low efficiency, and poor durability. Furthermore, viral vector vaccines require strict storage conditions, making it difficult to achieve safe, efficient, and sustained cancer treatment.
By knocking out the type I fimbriae gene in Escherichia coli, a fusion protein of membrane anchoring and targeting domains is expressed, which reduces non-specific adhesion and specifically targets and kills tumor cells.
It achieves specific targeting and killing of tumor cells, reduces non-specific adhesion, has high biosafety and sustained anti-tumor effect, can be rapidly detected in vitro and colonized inside tumors, secretes anti-cancer substances to accelerate the induction of tumor cell apoptosis and inhibit tumor growth.
Smart Images

Figure HDA0004978276260000011 
Figure HDA0004978276260000012 
Figure HDA0004978276260000013
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of biotechnology, in particular to an engineered Escherichia coli and application thereof. BACKGROUND
[0002] Cancer-associated fibroblasts (CAFs) as one of the most abundant stromal components in the tumor microenvironment can improve the ability of tumor immune escape, distant migration and local drug resistance, and have been widely studied as a target cell for tumor treatment. The current strategies targeting cancer-associated fibroblasts based on the high specificity of fibroblast activation protein (FAP) biomarker expressed on the surface of CAFs include FAP antibody, FAP inhibitor, FAP-targeted liposome nanoparticles (FAP-LNPs), FAP vaccine, chimeric antigen receptor (CAR) T cells targeting FAP, etc. An ideal strategy targeting CAFs should have high safety, the ability to continuously and effectively eliminate the pro-tumor function of CAFs and activate the anti-tumor immune response in vivo, and the conditions of cost, etc. Among the existing strategies, the in vivo application of liposomes has the potential problem of systemic toxicity; the personalized preparation and application of CAR-T have the problems of high consumption of time and funds, poor persistence, and poor clinical effect; the DNA vaccine and viral vector vaccine targeting FAP have the potential for sustained immunity, but the efficiency is low, the required dose is large, and the storage conditions of viral vector vaccines are strict, and the cost of storage and transportation is high. SUMMARY
[0003] To solve at least one of the above problems, the present disclosure provides an engineered Escherichia coli and application thereof, which has reduced non-specific adhesion of cells and can target and / or kill tumor cells.
[0004] According to one aspect of the present disclosure, an engineered Escherichia coli is provided, which is knocked out of one or more coding genes in the type I pilus fimA-fimH operon, and has a fusion protein on the cell membrane of the engineered Escherichia coli, the fusion protein comprising: a membrane anchoring domain comprising a full length or a fragment derived from a bacterial autotransporter protein; and a targeting domain.
[0005] In some embodiments, the E. coli lacks or partially lacks a pilus gene. In some embodiments, the pilus gene includes, but is not limited to, fimA, fimB, fimC, fimD, fimE, fimF, fimG, fimH, or fiml. In some embodiments, the E. coli is knocked out of one or more of the coding genes in the fimA-H operon that encodes Type I pilus.
[0006] In some embodiments, the genome of the engineered E. coli has a nucleotide sequence as set forth in SEQ ID NO: 25 or 26, or a nucleotide sequence that is at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical thereto.
[0007] In some embodiments, the engineered E. coli can be selected from, but not limited to, BL21, MG1655, DH5a, Transetta, Rosetta Blue, Origami, Rosetta, or Trans5a.
[0008] In some embodiments, the membrane-anchoring domain comprises a full length of a Ve-type autotransporter protein or a fragment thereof derived from a bacterium.
[0009] In some embodiments, the fusion protein comprises, from N-terminus to C-terminus, the membrane-anchoring domain and the targeting domain.
[0010] In some embodiments, the membrane-anchoring domain comprises a full length of intimin or intimin-like adhesin (YeeJ) or a fragment thereof.
[0011] In some embodiments, the membrane-anchoring domain comprises an amino acid sequence as set forth in SEQ ID NO: 1 or 2, or an amino acid sequence that is at least 85% identical thereto.
[0012] In some embodiments, the membrane-anchoring domain comprises an amino acid sequence as set forth in SEQ ID NO: 1 or 2, or an amino acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical thereto.
[0013] In some embodiments, the targeting domain comprises an antibody or an antigen-binding fragment thereof that specifically binds to a tumor cell surface antigen. In some embodiments, the antigen-binding fragment comprises, but is not limited to, a scFab, a scFv, a di-scFv, or a single-domain antibody (VHH) that specifically binds to a tumor cell surface antigen.
[0014] In some embodiments, the targeting domain comprises a single-domain antibody against fibroblast activation protein (FAP). In some embodiments, the targeting domain comprises an amino acid sequence as set forth in SEQ ID NO: 3 or 4, or an amino acid sequence having at least at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity thereto.
[0015] The engineered E. coli of the present disclosure has reduced non-specific adhesion to cells, particularly tumor cells, and is capable of targeted binding and / or killing of tumor cells.
[0016] In some embodiments, the tumor cells comprise, but are not limited to, solid tumors, soft tissue tumors, hematopoietic tumors, glandular tumors, primary tumors, and metastatic tumors. In specific embodiments, the tumor cells comprise tumor cells or stromal cells thereof. In specific embodiments, the tumor cells comprise cancer-associated fibroblasts. In some embodiments, the tumor cell surface can express fibroblast activation protein (FAP).
[0017] In some embodiments, the targeting domain is tagged with a protein tag.
[0018] In some embodiments, the protein tag is selected from any of the tags routinely used in the art. For example, the protein tag is selected from, but not limited to, one or more of a His tag, a Flag tag, a HA tag, a c-Myc tag, a V5 tag, an AviTag tag, a GST (glutathione S-transferase) tag, a SUMO tag, a Halo tag, a SNAP tag, an MBP (maltose binding protein) tag, a fluorescent protein (e.g., eGFP / eCFP / eYFP / mCherry), a luciferase.
[0019] In some embodiments, any two of the membrane anchoring domain, the targeting domain, and the anti-cancer agent domain are directly or indirectly linked.
[0020] In some embodiments, any two of the membrane anchoring domain, the targeting domain, and the anti-cancer agent domain are indirectly linked via a linker.
[0021] In some embodiments, the linker comprises a flexible linker and a rigid linker.
[0022] In some embodiments, the linker comprises (G n S) m , (G) n or (EA3K) n , wherein n and m are each independently selected from an integer from 0 to 5.
[0023] In some embodiments, the fusion protein comprises an amino acid sequence as set forth in SEQ ID NO: 3 or 4, or an amino acid sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity thereto.
[0024] In some embodiments, the targeting domain is displayed on the cell membrane surface of the engineered E. coli.
[0025] In some embodiments, one end of the membrane-anchoring domain is inserted into the cell membrane of the engineered E. coli.
[0026] In some embodiments, the engineered E. coli further expresses a cytotoxic molecule or an active fragment thereof.
[0027] In some embodiments, the cytotoxic molecule comprises, but is not limited to, IFNγ, GM-CSF, TNFα, IL-2, IL-4, IL-5, IL-6, IL-9, IL-10, IL-13, IL-16, IL-17, IL-23, IL-32, granzyme B, perforin, or a combination thereof.
[0028] In some embodiments, the cytotoxic molecule can comprise cytolysin A. In some embodiments, the cytotoxic molecule can have an amino acid sequence as set forth in SEQ ID NO: 8, or an amino acid sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity thereto.
[0029] According to yet another aspect of the present disclosure, there is provided a method of preparing the engineered E. coli as described in the present disclosure.
[0030] In some embodiments, the method comprises: 1) knocking out the pilus genes of E. coli using a CRISPR / Cas gene editing system to obtain E. coli with the pilus genes knocked out; and 2) expressing a fusion protein in the E. coli with the pilus genes knocked out, the fusion protein comprising a membrane anchoring domain and a targeting domain.
[0031] In some embodiments, the pilus genes comprise, but are not limited to, fimA, fimB, fimC, fimD, fimE, fimF, fimG, fimH, or fimI. In some embodiments, the E. coli is knocked out of one or more of the coding genes in the fimA-H operon of type I pilus, preferably the coding genes in the fimA-H operon of type I pilus.
[0032] In some embodiments, the method employs sgRNAs targeting fimB and / or fimH. In some embodiments, the sgRNA targeting fimB can have a nucleotide sequence as set forth in SEQ ID NO: 15 or 16. In some embodiments, the sgRNA targeting fimH can have a nucleotide sequence as set forth in SEQ ID NO: 17 or 18.
[0033] In some embodiments, the method further comprises expressing a cytotoxic molecule in the engineered E. coli.
[0034] According to yet another aspect of the present disclosure, there is provided a composition comprising the engineered E. coli of the present disclosure, or a culture supernatant derived from the engineered E. coli.
[0035] According to yet another aspect of the present disclosure, there is provided a method of detecting a tumor, the method comprising using the engineered E. coli of the present disclosure, and observing the extent of aggregation of the engineered E. coli around tumor cells.
[0036] In some embodiments, the tumor cells comprise, but are not limited to, tumor cells and / or tumor stromal cells in solid tumors, soft tissue tumors, hematopoietic tumors, glandular tumors, primary tumors, and metastatic tumors.
[0037] According to yet another aspect of the present disclosure, there is provided a method of screening for an antibody or antigen-binding fragment thereof, the method comprising using the engineered E. coli of the present disclosure to screen for a target antibody or antigen-binding fragment thereof.
[0038] According to yet another aspect of the present disclosure, there is provided use of the above-mentioned engineered E. coli of the present disclosure in detecting, treating, or preventing tumor cells.
[0039] According to another aspect of the present disclosure, there is provided use of the above-mentioned engineered E. coli of the present disclosure in the preparation of a reagent for detecting, treating or preventing a tumor. In some embodiments, the tumor includes, but is not limited to, a solid tumor, a soft tissue tumor, a hematopoietic tumor, an adenoid tumor, a primary tumor and a metastatic tumor, such as breast cancer and / or colorectal cancer.
[0040] Advantages:
[0041] The present disclosure finds that the knockout of the natural type I pilus in the engineered bacteria can effectively reduce the non-specific targeting adhesion rate of the engineered bacteria without changing the growth conditions and morphology of the engineered bacteria, which provides a new idea for the development of other engineered bacteria for specific targeting.
[0042] The specific adhesion rate of cells expressing the fusion single-domain antibody adhesin to cells is significantly increased. By replacing the single-domain antibody sequence of the adhesin (intimin or YeeJ) artificially synthesized by the engineered bacteria for extracellular display, flexible targeting of various target cells can be achieved, which has the potential to become a precision treatment toolkit.
[0043] Under in vitro co-culture conditions, the enrichment of the engineered bacteria can be detected in even less than 1 hour. Real-time observation of bacterial cell co-culture makes the binding of antigen and antibody visualized at the cell level, and is convenient and time-saving, providing a powerful tool for evaluating the affinity of antibodies in antibody screening work.
[0044] The engineered bacteria provided by the present disclosure can specifically colonize inside the tumor, have a tumor growth inhibition effect to some extent, and have high biological safety. Further, on the basis of targeted adhesion, anticancer substances such as cytotoxic molecules are added, which can have a greater impact on the cell activity of tumor stromal cells. On the basis of targeted adhesion of the engineered bacteria, the secretion of anticancer substances such as clyA protein can accelerate the induction of tumor cell apoptosis, destroy tumor tissue, inhibit tumor growth and produce a tumor regression effect, and has a significant anticancer effect. BRIEF DESCRIPTION OF DRAWINGS
[0045] Figure 1 PCR verification results of 8 EcB1 monoclonal genomes after knockout of the fimA-H operon encoding the type I pilus of E. coli E. coli BL21 are shown.
[0046] Figure 2 The 24-hour growth curve of EcB1 after knockout of the type I pilus is shown.
[0047] Figure 3 The strain morphology of EcB1 after knockout of the type I pilus is shown.
[0048] Figure 4The results of PCR validation of the genomes of eight EcM1 monoclonal strains after knockout of the fimA-H operon of type I fimbriae encoding E. coli K12 MG1655 are shown.
[0049] Figure 5 The 24-hour growth curve of EcM1 after knockout of type I fimbriae is shown.
[0050] Figure 6 The strain morphology of EcM1 after knockout of type I fimbriae is shown.
[0051] Figure 7 The results of fluorescence confocal imaging of EcB1 and EcM1 before and after pili knockout are shown.
[0052] Figure 8 The results show the enrichment and quantification of fluorescence intensity of EcB1 and EcM1 bacteria around single cells before and after fimbriae knockout.
[0053] Figure 9 This demonstrates that both EcM1 and EcB1 express synthetic adhesin (SA). intimin fap or SA YeeJ Comparison results of fap levels.
[0054] Figure 10 The images show different strains (E. coli BL21, EcB1, EcB1SA) under a laser scanning confocal microscope. intimin EcB1SA intimin fap, EcB1SA YeeJ EcB1SA YeeJ Results of fap enrichment around iBCAFs and MCF-7 cells.
[0055] Figure 11 correspond Figure 10 The quantitative analysis results of bacteria enriched around each cell in each experimental group were repeated three times, with 500 cells counted each time.
[0056] Figure 12 EcB1SA as observed using laser scanning confocal microscopy is shown. intimin gfp, EcB1SA YeeJ Adhesion experiment results of gfp, EGFP-positive Hela, and WT Hela bacteria.
[0057] Figure 13 This shows the colonization of bacteria in mouse tumor sites 24 hours after detection using three-dimensional in vivo imaging.
[0058] Figure 14 The images show the distribution of bacteria in the liver, spleen, lungs, heart, tumors, and tumor epithelium as detected by tissue anatomical imaging.
[0059] Figure 15 Show the changes of bacterial colonization in tumor sites within 72 hours by small animal three-dimensional live imaging.
[0060] Figure 16 Show the changes of tumor volume in mice within 15 days.
[0061] Figure 17 Show the changes of tumor weight in mice within 15 days.
[0062] Figure 18 Show the double expression pattern of SAfap and Cm recombinant protein.
[0063] Figure 19 Show the expression level of SAfap and Cm double protein.
[0064] Figure 20 Show the changes of mcherry fluorescence intensity reflecting the expression level of Cm recombinant protein.
[0065] Figure 21 Show the mcherry fluorescence intensity in bacterial supernatant medium reflecting the secretion level of Cm recombinant protein.
[0066] Figure 22 Show the apoptosis level of iBCAFs cells detected by flow cytometry after overnight treatment (16 hours) with cell culture medium without Cm recombinant protein and cell culture medium containing Cm recombinant protein.
[0067] Figure 23 Show the apoptosis level of iBCAFs cells detected by flow cytometry after treatment (4 hours) with engineered bacteria not expressing Cm recombinant protein and engineered bacteria expressing Cm recombinant protein.
[0068] Figure 24 Show Figure 22 Statistical analysis results of cell activity after corresponding 3 biological repeated experiments.
[0069] Figure 25 Show Figure 23 Statistical analysis results of cell activity after corresponding 3 biological repeated experiments.
[0070] Figure 26 Show the bacterial colonization in tumor sites in mice after 24 hours by small animal three-dimensional live imaging.
[0071] Figure 27 Show the distribution of bacteria in liver, spleen, lung, heart, tumor, and tumor epidermis sites by histological imaging.
[0072] Figure 28 Show the changes of tumor volume in mice within 15 days.
[0073] Figure 29 Show the change of mouse weight within 15 days.
[0074] Figure 30 Show tumor section hematoxylin-eosin staining, white arrow indicates the tumor site destroyed by the engineered bacteria.
[0075] Figure 31 Show tumor section immunohistochemical staining, black arrow indicates the tumor site destroyed by the engineered bacteria. DETAILED DESCRIPTION
[0076] In order to make the objects, technical solutions and advantages of the present application clearer, the present application will be further described in detail below with examples. The specific examples described herein are only used to explain the present application and do not constitute any limitation to the present application. In addition, in the following description, the description of well-known structures and technologies is omitted to avoid unnecessary confusion of the concept of the present disclosure. Such structures and technologies are also described in many publications.
[0077] The engineered bacteria provided by the present disclosure knock out the pilus, which can significantly reduce the non-specific adhesion rate. The expression vector used is pET28a SA intimin and pET28aSA YeeJ is a single-domain antibody display platform that is highly induced and expressed on the surface of bacteria. The FAP single-domain antibody display system on the surface of the engineered bacteria and its own tumor-targeting colonization ability can achieve specific targeting and colonization of FAP+CAFs, solving the problem of effectively eliminating the pro-tumor function of CAFs and continuously activating the anti-tumor immune response in vivo. By replacing the single-domain antibody part in the surface display system of the engineered bacteria, specific targeting of different target cells can be achieved. The preparation and production of the engineered bacteria only require the culture medium required for their growth, and storage at 0-4°C can inhibit growth, solving the cost problem.
[0078] In a specific embodiment, the engineered Escherichia coli of the present disclosure displays FAP single-domain antibody on the surface, which can achieve tumor-targeting colonization, thereby achieving specific targeting of FAP antigen on CAF cells and colonization in the tumor microenvironment, effectively eliminating the pro-tumor function of CAFs and continuously activating the anti-tumor immune response in vivo.
[0079] The present disclosure constructs a mouse cancer model, which verifies that the provided engineered bacteria can specifically colonize inside the tumor in vivo in mice, have tumor growth inhibition effect, and have no effect on the growth of mice.
[0080] In the detailed description of the disclosure, on the basis of targeting adhesion, the clyA cytotoxic molecule is increased, so that the adhesion factor-FAP single-domain antibody is co-expressed with the cytotoxic molecule for a mouse cancer model. The results show that the engineered bacteria target adhesion around cancer cells, while the secretion of clyA protein accelerates the induction of apoptosis.
[0081] Definitions
[0082] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. For the purposes of interpreting this specification, the following definitions will apply and, where appropriate, terms used in the singular will also include the plural and vice versa.
[0083] The expressions "a" and "an" as used herein include plural references unless the context clearly dictates otherwise.
[0084] The expression "about" as used herein is as understood by one of ordinary skill in the art and varies in its scope depending on the context of its usage. If one of ordinary skill in the art is not apprised of the usage of the term "about" in a particular context, then "about" will mean a particular value plus or minus 10% at most.
[0085] The term "fusion protein" as used herein refers to a polypeptide or protein comprising two or more subunits. In some embodiments, the fusion proteins described herein comprise two or more subunits that can be linked by covalent or non-covalent bonds. Preferably, the fusion protein is a translational fusion between two or more subunits. This translational fusion can be produced by genetically engineering the coding sequence of one subunit within the reading frame of the coding sequence of another subunit.
[0086] As used herein, the term "pilus" describes a sensory and motile apparatus that evolved specifically for bacterial locomotion. Type I pilus is a hair-like protein protrusion on the surface of most Gram-negative bacteria and a few Gram-positive bacteria. For example, in E. coli, type I pilus is encoded by fimA-H operon. The fimA-H operon has a full length of 8754 bp, including two transcriptional regulatory genes fimB and fimE, four structural genes fimA, fimE, fimG and fimH, and fimC and fimD genes responsible for encoding chaperone and pilin, respectively. Type I pilus plays an important role in bacterial adhesion, colonization and biofilm formation. The tip adhesin encoded by fimH gene is exposed on the bacterial surface and can recognize various mammalian cell surface mannose glycosylated receptor proteins, and is also a key gene for E. coli biofilm formation and a virulence factor. In some embodiments of the present disclosure, the problem of non-specific adhesion of most engineered bacteria is solved by knocking out the natural type I pilus of the engineered bacteria.
[0087] As used herein, the term "autotransporter" is a class of proteins widely present in Gram-negative bacteria, which usually serves as outer membrane protein or secretory protein of bacteria and plays an important role in various life activities of bacteria. Autotransporters are generally composed of a signal peptide, an N-terminal passenger domain and a C-terminal transmembrane domain (also known as a β-barrel domain). According to the difference of the transmembrane domain, autotransporters can be divided into five types Va, Vb, Vc, Vd and Ve. Among them, Ve type has a reverse structure, with the N-terminal being a transmembrane domain and the C-terminal being a passenger domain.
[0088] As used herein, the term "cancer-associated fibroblast (CAF)" or "tumor-associated fibroblast" refers to a cell that is affected by the tumor microenvironment (TME) and is activated from a normal fibroblast, a mesenchymal cell, an epithelial cell, an endothelial cell, an adipocyte, a pericyte, a stellate cell, etc. originally present at the tumor site through different pathways. CAFs can modulate the structure and / or function of the TME, for example, by extracellular matrix (ECM) remodeling and / or secretion of soluble factors (e.g., growth factors and / or inflammatory factors). CAFs can contribute to tumorigenesis, tumor growth, tumor invasion, angiogenesis, or metastasis. CAFs can impair anti-tumor immunity.
[0089] The term "fibroblast activated protein (FAP)" as used herein refers generally to a membrane-integral glycoprotein found on activated fibroblasts, which belongs to the serine protease family and shares 52% homology with the dipeptidyl peptidase family member dipeptidyl peptidase IV (DPP IV), and possesses both dipeptidyl peptidase and collagenase activity, and is capable of cleaving the bond between amino acids at the carbon terminus of proline.
[0090] The term "tumor" as used herein refers to a mass or neoplasm, which is itself defined as an abnormal new growth of cells that typically grow more rapidly than normal cells and, if left untreated, will continue to grow, sometimes leading to damage of adjacent structures. Tumors can vary greatly in size. Tumors can be solid or fluid-filled. Tumor can refer to a benign (non-malignant, generally harmless) or malignant (capable of metastasis) growth. Some tumors can contain both benign neoplastic cells (e.g., carcinoma in situ) as well as malignant cancer cells (e.g., adenocarcinoma). It is to be understood to include neoplasms located at multiple sites throughout the body. Thus, for purposes of the present disclosure, tumors include primary tumors and metastatic tumors.
[0091] The term "cancer" as used herein refers to a disease or disorder resulting from the proliferation of a cell that has undergone a carcinogenic transformation. "Cancer" shall encompass any one or more of a wide range of benign or malignant tumors, including those capable of invasive growth and metastasis through the lymphatic system and / or bloodstream and through the human or animal body or portions thereof. Although the present invention is directed, inter alia, to the diagnosis or detection of malignant tumors and solid cancers, as used herein, the term "tumor" encompasses both benign and malignant tumors or solid masses. Examples of cancer include, but are not limited to, solid tumors, blood tumors, lymphomas (e.g., Hodgkin's and non-Hodgkin's lymphomas), blastomas, sarcomas, e.g., squamous cell carcinoma, small cell lung cancer, non-small cell lung cancer, lung adenocarcinoma, lung squamous cell carcinoma, peritoneal cancer, hepatocellular cancer, gastrointestinal cancer, pancreatic cancer, glioma, cervical cancer, ovarian cancer, bladder cancer, liver cancer, breast cancer, colon cancer, colorectal cancer, endometrial or uterine cancer, peritoneal cancer, salivary cancer, renal cancer, prostate cancer, vulvar cancer, thyroid cancer, hepatocellular cancer, leukemia and other lymphoproliferative disorders, and various types of head and neck cancer.
[0092] The term "cancer cell" as used herein is a variant cell that is the causative agent of cancer. Cancer cells differ from normal cells by the three major characteristics of unlimited proliferation, transformability, and metastaticity, and are capable of unlimited proliferation and destruction of normal tissue. In addition to uncontrolled division (capable of unlimited division), cancer cells also invade locally into surrounding normal tissues and even metastasize to other parts of the body via the circulatory system or lymphatic system.
[0093] The term “cancer-associated fibroblasts (CAF)”, as used herein, is a group of cells present in the tumor microenvironment that play an important regulatory and supportive role. CAF cells can be classified into different subtypes according to their origin, function, and expressed characteristics, such as expression of specific cytokines, signaling pathways, and cell markers.
[0094] The term “operably linked”, as used herein, denotes physical or functional linkage between two or more elements (e.g., polypeptide sequences or polynucleotide sequences) that allows them to operate in their intended manner. For example, when used in the context of a nucleic acid molecule or coding sequence and a promoter sequence in a nucleic acid molecule described herein, the term “operably linked” means that the coding sequence and the promoter sequence are in frame and within appropriate spatial and distance to allow the respective binding of transcription factors or RNA polymerase to exert influence on transcription. It will be appreciated that operably linked elements can be contiguous or non-contiguous (e.g., connected to each other by a linker). In the context of a polypeptide construct, “operably linked” refers to a physical linkage (e.g., directly or indirectly connected) between amino acid sequences (e.g., different segments, portions, regions, or domains) to provide the described activity of the construct. Segments, portions, regions, and domains of a polypeptide or nucleic acid molecule disclosed herein that are operably linked can be contiguous or non-contiguous (e.g., connected to each other by a linker).
[0095] As used herein, the term "linker" refers to a (peptide) linker of natural and / or synthetic origin, consisting of linear amino acids. Each domain in the bispecific fusion polypeptides of the present application can be linked by a linker, wherein each linker is fused and / or otherwise linked (e.g., via a peptide bond) to at least two polypeptides or domains. Linkers are classified, for example, as flexible linkers, rigid linkers, etc. A "rigid linker" is composed of amino acid residues that readily form stable secondary structures, in many cases, it is more effective than a flexible linker in separating functional domains and maintaining their independent functions because it can form a more stable secondary structure. A rigid linker can be selected for use when the separation of functional domains in space is critical for the stability and biological activity of the fusion protein. Many natural rigid linkers form an alpha helix structure. A commonly used rigid alpha helix linker is (EAAAK)n (n < 6). The alpha helix structure is rigid and stable due to the presence of hydrogen bonds within and a tight backbone. A "flexible linker" is composed of small, non-polar amino acids (such as glycine) or polar amino acids (such as serine or threonine). Small amino acids provide more flexibility, allowing the connected functional domains to not interfere with each other and thus better perform their functions. Polar amino acids such as serine and threonine can form hydrogen bonds with water molecules, thus ensuring the stability of the linker in aqueous solution while reducing the adverse reactions of the linker with the protein region.
[0096] The linker should have a length suitable for linking two or more domains, and the linker should ensure that the different domains it connects are properly folded and presented appropriately to perform their biological activity functions. In various embodiments, the linker has a flexible conformation. Suitable flexible linkers include, for example, having glycine, glutamine and / or serine residues. In some embodiments, the linker can be selected from (GnS)m, (G)n, (EAAAK)n or (XP)n, wherein n and m are each independently selected from an integer from 0 to 5. For example, n is selected from 0, 1, 2, 3, 4 or 5, and m is selected from 1, 2, 3, 4 or 5.
[0097] As used herein, the term "antibody" refers to a polypeptide substantially encoded by an immunoglobulin gene or immunoglobulin genes or fragments thereof which specifically binds and recognizes an analyte (e.g., an antigen or immunogen), such as a RSV F protein or an antigenic fragment thereof. The immunoglobulin genes include the kappa, lambda, alpha, gamma, delta, epsilon and mu constant region genes, as well as myriad immunoglobulin variable region genes. The term "antibody" as used herein includes antibody fragments, e.g., produced by the modification of whole antibodies and those synthesized de novo using recombinant DNA methods.
[0098] The terms "antigen binding fragment," "fragment," and "antibody fragment" as used herein are used interchangeably to refer to any fragment of an antibody of the application that retains the antigen binding activity of the antibody. Examples of antibody fragments include, but are not limited to, single chain antibodies, Fab, Fab', F(ab')2, Fv, or scFv. Further, the term "antibody" as used herein includes both antibodies and antigen binding fragments thereof.
[0099] The term "operon" as used herein refers to a functional unit of DNA containing a cluster of genes under the control of a single regulatory signal or promoter. Operons are commonly found in prokaryotes, such as bacteria, which can efficiently regulate gene expression.
[0100] The term "sequence identity" as used herein refers to the "percent sequence identity" or "percent sequence identity" between two polynucleotides, i.e., the number of matching identical positions in the sequences shared by the sequences within a comparison window, taking into account additions or deletions (i.e., gaps) that must be introduced for optimal alignment of the two sequences. A matching position is any position where the same nucleotide is present in both the target sequence and the reference sequence. Gaps present in the target sequence are not counted as they are not nucleotides. Likewise, gaps present in the reference sequence are not counted as they are not counted as they are not nucleotides from the reference sequence. At least 60% sequence identity includes a contiguous stretch of at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the length of the sequence having sequence identity.
[0101] The percentage sequence identity can be calculated by determining the number of positions at which the same amino acid residue or nucleic acid base occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the comparison window, and multiplying the result by 100 to yield the percentage of sequence identity. The comparison of sequences and determination of the percentage sequence identity between two sequences can be accomplished using software programs which are readily available online and for download. Suitable software programs are available from various sources for the alignment of protein and nucleotide sequences. One suitable program for determining percentage sequence identity is bl2seq, which is part of the BLAST suite of programs available from the National Center for Biotechnology Information's BLAST website (blast.ncbi.nlm.nih.gov). Bl2seq uses either the BLASTN or BLASTP algorithm for comparison between two sequences. BLASTN is used for comparing nucleic acid sequences, while BLASTP is used for comparing amino acid sequences. Other suitable programs are, for example, Needle, Stretcher, Water or Matcher, which are part of the EMBOSS suite of bioinformatics programs, and are also available from the European Bioinformatics Institute (EBI) at www.ebi.ac.uk / Tools / psa.
[0102] The term "cell adhesion" as used herein refers to the adhesion of one or more cells to the surface of another cell with any force. Cell adhesion occurs, for example, by specific binding of an antibody on the surface of a cell to an antigen on the surface of another cell.
[0103] The following examples and drawings are provided to aid in the understanding of the present application. It should be understood that these examples and drawings are provided only to illustrate the present application and should not be construed as limiting the present application in any way. The actual scope of the present application is set forth in the appended claims. It should be understood that any modifications and changes can be made to the present application without departing from the spirit thereof.
[0104] Examples
[0105] Example 1. Knockout of fimA-H operon of E. coli BL21 strain
[0106] To solve the problem of non-specific adhesion of E. coli, we knocked out the type I pilus encoded by the fimA-H operon in E. coli BL21(DE3) to reduce the probability of non-specific adhesion of the engineered bacteria. The E. coli BL21 mutant strain with the fimA-H operon deleted is named EcB1.
[0107] Specifically, the CRISPR / Cas gene editing system (pCas9 and pTarget2N20) was used to knockout the fimA-H operon of E. coli BL21(DE3), and the steps were as follows:
[0108] 1. Design sgRNA sequences targeting fimB and fimH genes respectively:
[0109] fimB sgRNA1 N20_F: 5'-CATATTATCTCGACTTCCGG-3' (SEQ ID NO: 15);
[0110] fimB sgRNA1 N20_R: 5'-CCGGAAGTCGAGATAATATG-3' (SEQ ID NO: 16);
[0111] fimH sgRNA2 N20_F: 5'-GACTATGTCACACTGCAACG-3' (SEQ ID NO: 17);
[0112] fimH sgRNA2 N20_R: 5'-CGTTGCAGTGTGACATAGTC-3' (SEQ ID NO: 18).
[0113] pTarget2N20 plasmid was constructed using sgRNA1 and sgRNA2. Meanwhile, a 1 kb Donor fragment was synthesized, which was composed of about 500 bp on each side of the fimA-H operon.
[0114] fimA-H operon upstream 500 bp (5'-3'):
[0115] catggcgtaagctgacgaatcagcaggaataatcgctagggacctaagaattagcatgataatagccactaagaaattactgcgctccatgaaatagccattttgtggcaaatggagttgactaataatgtcatatgtgagacggctagttgaacgaatattaaattttgctgaattttttatgttgattttacttgttacagaacatatcacatgatatatagataagattagttgcattaatgatgagggttattattagattcgtatccgattgataaatatataaaggtacatagcatgcaagagcatggcgtttgtatggcaacgttattataattaacagttgctactccatttaagttcactcagaagaactggtccacttacgttagttattaagcaaacgttcgcttttataaacataatcaggataaaaatgttggattattgctaacccagcacagctagtgcgcgtctgtaattataagggaaaaacg (SEQ ID NO: 19)
[0116] fimA-H operon 500bp downstream (5’-3’):
[0117] agaaatcacaggacattgctaatgctggtacgcaatattacctgaagctaaaaacctgcacgttagccctttgtaggccagataagacgcgtcagcgtcgcatctggcataaacaaagcgcactttgctggtctgttcccctcaccctaaccctctccccggaggggcgaggggactgtccgggcacatttttagactttgtcatcagtctgagcctgccattggcaggctctggtgtccttttacgctaccatgctaataatcagcacaataatcagcccaaccacggagttgaccagctccagcagaccccaggttttcaacgtgtcttttactgacaggtcaaagtaacctttgaacaaccagaaagatgcatcgttaatgtgggtgagggtgttggaacccgcagccgtcgccagtaccagcagcgccggattcacgccaaccagctgaccagttgctggatctaggattgcagcactgataatcccggcggcggt (SEQ ID NO: 20)
[0118] 2. Simultaneously transform pTarget2N20 and Donor fragment into E. coli BL21::pCas9 competent cells expressing Cas9 protein. Obtain cells in which fimA-H operon coding sequence has been successfully knocked out, i.e. type I pilus mutant strain EcBl::pCas9::pTarget2N20 (abbreviated as EcBl). Perform genomic PCR on the obtained mutant strain cells by the following primer pairs.
[0119] Primer A: ATCAGTGTTTACCCGCCATC (SEQ ID NO: 21)
[0120] Primer B: CGATTTCACTATGGGTCAGGA (SEQ ID NO: 22)
[0121] Primer C: CTGGTTCAGTGCCAATTCCT (SEQ ID NO: 23)
[0122] Primer D: TGCTGAAGCAGACCATCATC (SEQ ID NO: 24)
[0123] Primer A and primer D target upstream and downstream of the donor fragment, respectively, primer B targets the fimB gene fragment, and primer C targets the fimH gene fragment. The PCR verification results are shown in Figure 1 FIG. 1B, in which lanes 1-8 are 8 clones of the type I pilus mutant EcB1, and BL is the genomic PCR result of BL21, and the Sanger sequencing nucleotide sequence of the amplification products of primers A and D is shown in SEQ ID NO: 25.
[0124] Figure 2 The 24-hour growth curve determination of BL21 and mutant EcB1 is shown. Figure 3 The morphological observation of BL21 and mutant EcB1 is shown in Figure 3 The results show that the deletion of type I pilus has no significant effect on the growth and morphology of EcB1.
[0125] Example 2. Knockout of fimA-H operon of E. coli K12 MG1655 bacteria
[0126] This example also uses the CRISPR / Cas gene editing system (pCas9 and pTarget2N20) to knockout the fimA-H operon (sgRNA and donor fragment are the same as EcB1) in the genome of E. coli K12 MG1655 bacteria, which encodes type I pilus, and the strain after knockout is named EcM1.
[0127] Genomic PCR verification (primers are the same as EcB1), and the results are shown in Figure 4 FIG. 2B. The genomic PCR verification results of 6 EcM1 monoclonal strains, and MG is the genomic PCR result of E. coli K12 MG1655. The Sanger sequencing nucleotide sequence of the amplification products of primers A and D is shown in SEQ ID NO: 26.
[0128] The 24-hour growth curve determination of EcM1 and E. coli K12 MG1655 is shown in Figure 5 and the strain morphological observation results are shown in Figure 6 The results show that the deletion of type I pilus has no significant effect on the growth and morphology of EcM1.
[0129] Example 3. Detection of the effect of the deletion of type I pilus on non-specific adhesion of cells
[0130] The specific adhesion efficiency of the engineered bacteria is verified by bacterial cell co-culture.
[0131] 8 mm cell crawling sheets are placed in a 24-well plate, and 2x10 5 iBCAF breast cancer-related fibroblasts (FAP-positive cell line) and 4x105 Human breast cancer cells MCF-7 cells (FAP-negative cell line). The type I pilus deletion engineering bacteria EcM1 and EcB1 obtained in Example 1 and Example 2 were resuspended in 50 μL of E. coli serum type O / K polyclonal antibody (1:1000, Invitrogen Corporation) at a concentration of 1-2 x 10 8 CFU / mL, incubated at room temperature for 45 minutes. Centrifuged again and washed twice with PBS. Resuspended with 50 μL of Cy3-conjugated secondary antibody (1:500, ABclonal), incubated at room temperature for 45 minutes in the dark. Centrifuged, washed twice with 100 μL of PBS, and resuspended the bacterial particles in fresh cell culture medium at a final concentration of 6 x 10 7 CFU / mL. Add 1 mL of bacterial suspension to each well of the 24-well plate containing the cell slides, with a MOI of 300:1. After 1 hour of infection at 37°C, wash the cells 5 times with PBS. Fix with 300 μL of 4% PFA at room temperature for 15 minutes. Wash twice with PBS, then stain the cell nuclei with 1 μg / mL DAPI for 20 minutes, then gently mount the cell slides onto clean glass slides with an anti-fading mounting medium. Examine using a fluorescence microscope and use the imaging analysis system to quantitatively analyze the bacteria enriched around the cells, and the results are shown in Figure 7 and Figure 8 .
[0132] As shown in Figure 7 and Figure 8 , the knockout of fimA-H, which encodes type I pili, can significantly reduce the non-specific adhesion of EcM1 and EcB1 to cells.
[0133] Example 4. Artificial synthetic adhesins expressing FAP single-domain antibody and GFP single-domain antibody on the surface of EcB1 and EcM1
[0134] In order to endow EcB1 and EcM1 with specific targeting function, we tried to express artificial synthetic adhesins fused with FAP single-domain antibody on the surface of EcB1 and EcM1, and also constructed artificial synthetic adhesins fused with green fluorescent protein GFP single-domain antibody as a control (the amino acid sequence of FAP single-domain antibody is shown in SEQ ID NO: 7, and the sequence of GFP single-domain antibody is derived from Xiong Z, et al. Elife. 2021; 10: e64631).
[0135] Two transmembrane domains of bacterial adhesins were selected as the display platform of antibodies: (1) Intimin (659 amino acids, amino acid sequence as shown in SEQ ID NO: 1) derived from enterohemorrhagic E. coli (EHEC) E. coli, which contains a signal peptide, a N-terminal lysin motif (LysM) located in the periplasmic space, a transmembrane β-barrel domain and a conserved domain D0 at the C-terminus. (2) Intimin-like adhesin YeeJ (515 amino acids, amino acid sequence as shown in SEQ ID NO: 2) derived from wild-type E. coli E. coli MG1655, which also contains a signal peptide, a N-terminal lysin motif (LysM) located in the periplasmic space, a transmembrane β-barrel domain and a linker domain at the C-terminus as a conserved domain.
[0136] At the C-terminus of Intimin or YeeJ, a V5 tag (SEQ ID NO: 12, located between Hind III and Nhe I restriction sites), a 6×His tag (SEQ ID NO: 13, located between Nhe I and BamH I restriction sites) and a c-myc tag sequence (SEQ ID NO: 14) were fused in sequence, and the N-terminus was fused with FAP single-domain antibody sequence or GFP single-domain antibody sequence.
[0137] The nucleic acid sequences encoding Intimin (SEQ ID NO: 1), YeeJ (SEQ ID NO: 2), Intimin-FAP single-domain antibody (SEQ ID NO: 3), YeeJ-FAP single-domain antibody (SEQ ID NO: 4), Intimin-GFP single-domain antibody (SEQ ID NO: 5) and YeeJ-GFP single-domain antibody (SEQ ID NO: 6) were synthesized and constructed into pET28a+ vectors to obtain expression vectors pET28a-intimin, pET28a-YeeJ, pET28a-intimin-FAP, pET28a-YeeJ-FAP, pET28a-intimin-GFP and pET28a-YeeJ-GFP, respectively. The constructed expression vectors were electroporated into EcB1 competent cells and EcM1 competent cells, respectively. After overnight culture, the obtained monoclonal was transferred into fresh LB medium at a ratio of 1:100 and cultured at 37°C until OD = 0.7, then 0.05 mM IPTG (isopropyl-β-d-thiogalactoside) was added, and the expression was induced at 37°C for 8-16 hours. V5 tag antibody was co-incubated with an appropriate amount of bacteria for flow cytometry detection to verify the expression of synthetic adhesin (SA) SA intimin , SA intiminfap, SA intimin GFP, SA YeeJ , SA YeeJ fap and SA intimin GFP level in EcM1 and EcB1. The results are shown in Figure 9 The engineered bacteria expressing synthetic adhesin (SA) are named EcB1SA intimin fap, EcB1SA YeeJ fap, EcB1SA intimin gfp and EcB1SA YeeJ gfp.
[0138] Example 5. Adhesion experiment of engineered bacteria specifically targeting cancer-associated fibroblasts
[0139] According to the similar method as in Example 3, the specific adhesion efficiency of engineered bacteria EcB1SA intimin , EcB1SA intimin fap, EcB1SA YeeJ , EcB1SA YeeJ fap to iBCAF breast cancer-associated fibroblasts (FAP-positive cell line) and MCF-7 cells (FAP-negative cell line) was verified by bacterial cell co-culture.
[0140] The enrichment of bacteria around the cells was observed under a fluorescence microscope and the bacteria enriched around the cells were quantitatively analyzed by using an imaging analysis system. The results are shown in Figure 10 and Figure 11 .
[0141] As shown in Figure 10 and Figure 11 , it can be seen that EcB1SA intimin fap, EcB1SA YeeJ fap was significantly enriched around iBCAF cells. There were only a small amount of engineered bacteria around MCF-7 cells, and EcB1 significantly reduced the non-specific adhesion compared with E. coli BL21. EcB1SA intimin , EcB1SA YeeJ increased the probability of non-specific adhesion due to the absence of FAP single-domain antibody part. From the observation and quantitative analysis results, it can be concluded that the synthetic adhesin fused with single-domain antibody can endow the engineered bacteria with the ability to specifically target and adhere to the target cells.
[0142] Example 6. Adhesion experiment of engineered bacteria specifically targeting EGFP
[0143] The nucleotide sequence encoding enhanced green fluorescent protein EGFP was inserted into the pDisplay vector (Mcll Biosciences) to construct the pDisplay EGFP plasmid according to a method similar to that of Example 4. Hela cells were transfected with the pDisplay EGFP plasmid to express GFP (SEQ ID NO: 11) on the surface of the cell membrane, and then co-cultured with EcBISA intimin gfp, EcBISA YeeJ gfp at 37°C for 1 hour. The specificity adhesion efficiency of the engineered bacteria to the cell membrane was verified by bacterial cell co-culture according to a method similar to that of Example 3, and observed by laser scanning confocal microscopy. The results are shown in Figure 12
[0144] As Figure 12 shown, EcBISA intimin gfp, EcBISA YeeJ gfp was observed to be rich around the cell membrane GFP-positive Hela, but only a small amount of bacteria was observed around the WT Hela cells.
[0145] Example 7. In vivo verification of specific targeting and colonization of tumors by the engineered bacteria
[0146] First, a colon adenocarcinoma model was constructed using the MC38 cell line (a mouse colon adenocarcinoma cell line) according to the following method:
[0147] 1. The MC38 cells were collected and counted, and washed once with pre-chilled PBS, and centrifuged at 300g for 5 min.
[0148] 2. A number of 1.5 mL centrifuge tubes were prepared, and 50 μL Matrigel was added to each centrifuge tube.
[0149] 3. The cells obtained in step 1 were gently resuspended in 2 mL PBS, and aliquoted into the centrifuge tubes containing 50 μL Matrigel, 50 μL MC38 cells (about 1 x 10 6 ) were added to each tube, and gently mixed by pipetting to obtain 100 μL Matrigel and MC38 mixture.
[0150] 4. The 100 μL Matrigel and MC38 mixture was gently aspirated using a sterile disposable insulin syringe, and subcutaneously injected into the right side of the back of an 8-week-old C56BL / 6N mouse (1 x 10 6 ).
[0151] 5. The mice were observed daily for tumor formation, and after about 7-9 days, the tumor volume reached 200-300 mm 3 Post (tumor volume = 0.5 x length x width 2 ), the tumor-bearing mice were randomly grouped for subsequent experiments.
[0152] The bacteria were injected into MC38 tumor-bearing mice through the tail vein, and the distribution of the engineered bacteria in the tumor-bearing mice was detected by a small animal three-dimensional live imaging instrument to test the tumor targeting colonization ability of the engineered bacteria in vivo. The specific experimental method is as follows:
[0153] 1. Prepare E. coli BL21, EcB1, EcB1SA intimin , EcB1SA intimin fap fresh bacterial culture solution, respectively.
[0154] 2. Take 1 mL of bacterial solution with OD600 = 1, centrifuge at 5000 rpm for 2 min. Wash the bacterial cells with PBS for 2 times.
[0155] 3. Add 100 μL of PBS to resuspend the bacterial cells, and add 2 μL of 1 mg / mL Dir dye (Bid pharmaceutical). After mixing evenly, incubate at room temperature for 1 h in the dark.
[0156] 4. Centrifuge at 5000 rpm for 2 min. Wash the bacterial cells with PBS for 2 times.
[0157] 5. Resuspend the bacterial cells with 1 mL of PBS. The tail vein injection amount of each tumor-bearing mouse is 100 μL of bacterial solution (CFU = 1 x 10 8 ).
[0158] 6. After 24 h of bacterial injection, the mice were imaged in vivo to detect the in vivo distribution of the bacteria.
[0159] 7. Within 15 days after bacterial injection, the tumor volume and body weight of the mice were measured and recorded at a fixed time every day. During the experiment, 1M IPTG was added to the drinking water of the mice to continuously induce the expression of the artificial adhesin by the engineered bacteria.
[0160] The results are shown in Figures 13-17 .
[0161] Figure 13 After 24 h of tail vein injection of bacterial solution, the bacterial distribution in tumor-bearing mice in each experimental group was detected by a small animal live imaging system. Some E. coli BL21 can naturally escape into the tumor to avoid the attack of the immune system. EcB1, which lacks natural type I pili, has greatly reduced adhesion ability and is easily affected by mouse metabolism, accumulating in the liver. EcB1SA intimin expresses the exogenous tight adhesion intimin, restores part of the adhesion ability, and a small part can escape to the tumor site, and most are metabolized by the kidney. EcB1SA intiminFAP strain can target and colonize tumor sites massively.
[0162] Figure 14 For Figure 13 EcB1SA intimin and EcB1SA intimin The results of imaging of each tissue of the mouse after 24h of injection of FAP engineered bacteria. Most of the EcB1SA intimin and EcB1SA intimin FAP can accumulate in the liver and spleen, which is probably due to the fact that the liver and spleen can clear metabolic waste and toxic substances in the body. Different from EcB1SA intimin , EcB1SA intimin FAP can locate to the tumor cortex site, which is the tumor protective barrier formed by the tumor stromal cells in the outer layer of the tumor.
[0163] Figure 15 For observing the dynamic changes of EcB1SA intimin and EcB1SA intimin FAP distribution in the tumor. EcB1SA intimin and EcB1SA intimin FAP can quickly locate to the tumor site within 4h, but the enrichment of EcB1SA intimin in the mouse tumor gradually decreases with time, while EcB1SA intimin FAP can colonize the tumor site massively and continuously due to the support of FAP antigen antibody binding effect. The enrichment of EcB1SA intimin in the mouse tumor is significantly lower than that at 4h. While EcB1SA intimin FAP has no obvious change in the enrichment in the mouse tumor from 4h to 72h, and always maintains a high enrichment level.
[0164] Figure 16 For measuring the tumor volume changes of tumor-bearing mice within 15 days. Compared with other groups, the tumor growth of tumor-bearing mice in EcB1SA intimin FAP experimental group is more stable and the tumor volume after 15 days is the smallest, proving that the engineered bacteria EcB1SA intimin FAP can colonize the inside of the mouse tumor and has a certain tumor growth inhibition effect. While EcB1SA intimin without FAP antibody surface display, the colonization in the tumor site is not strong, although the tumor volume is reduced at day 9, showing a certain tumor inhibition effect, but after day 11, the tumor volume begins to rise linearly. E. coli BL21 and EcB1 have similar effects on the growth of tumor volume.
[0165] Figure 17 The weight change of tumor-bearing mice was measured within 15 days. The body weight of mice in each group showed a growth trend, indicating that tail vein injection of E. coli BL21, EcB1, EcB1SA intimin and EcB1SA intimin fap had no effect on the growth of mice. Among them, the mice receiving tail vein injection of EcB1SA intimin fap maintained a high level of body weight, indicating that EcB1SA intimin fap had high biological safety.
[0166] Example 8. Secretion of therapeutic factors (ClyA) by engineered bacteria to inhibit tumor growth
[0167] Cytolysin A (ClyA) is a cytotoxic protein that can form pores on the cell surface, which can be secreted by various E. coli or Salmonella through outer membrane vesicles (OMVs) without signal peptide modification. At high concentrations, ClyA can induce cell lysis, while at low concentrations, ClyA can affect intracellular signal transduction. Because ClyA can be expressed on the surface of bacteria or OMVs secreted by bacteria as an antigen to cause an immune response, it has also been used for vaccine development and anti-tumor drug research.
[0168] This example studies the induction of apoptosis in target cells based on the directional targeting of the target cells by engineered bacteria, while secreting ClyA. The protein double expression plasmid pETDuet-SAfap-Cm was constructed based on the pET28-SAfap plasmid in Example 2. As Figure 18 illustrated, the expression of SAfap protein and ClyA-mcherry (Cm) fusion protein was respectively regulated by two T7 promoters. By using the recombinant protein of ClyA (SEQ ID NO: 8) fused with mcherry fluorescent protein (SEQ ID NO: 9) to express ClyA-mcherry fusion protein (Cm, SEQ ID NO: 10), the engineered bacteria were provided with red fluorescence, and the fluorescence intensity of mchery could also reflect the expression and secretion of ClyA.
[0169] Two protein double expression plasmids, pETDuet-SA intimin fap-Cm and pETDuet-SA YeeJ fap-Cm, were respectively constructed and transformed into EcB1 electrocompetent cells to obtain EcB1SA intimin fapCm and EcB1SA YeeJ fapCm strains. After IPTG induction, the OD 600 of the bacterial solution was measured, and the bacteria were diluted to 1 OD600 =1×10 9 Take 0.5 OD of bacterial culture, centrifuge, wash twice with PBS, and add an appropriate amount of V5-tagged monoclonal antibody diluted in PBS. TM Resuspend the cell clumps in 647 (Invitrogen) solution, incubate on ice for 45 min, centrifuge, discard the supernatant, wash twice with PBS, and finally resuspend the cell clumps in 400 μL PBS. Using a flow cytometer, select the fluorescence signal detection channel corresponding to the V5 tag antibody and mCherry to detect the expression of SA and Cm in the same strain, as well as EcB1 and EcB1SA. intimin fap and EcB1SA YeeJ FAP strain was used as a negative control. Results are shown in Figure 19 middle.
[0170] like Figure 19 As shown, EcB1SA intimin fap and EcB1SA YeeJ FAP strains do not express Cm protein, but express SA at high levels. intimin fap and SA YeeJ fap; EcB1SA intimin fapCm and EcB1SA YeeJ fapCm strain also expresses SA at high levels intimin / YeeJ fap and Cm proteins. EcB1SA intimin SA induced in fapCm intimin The bacterial cell count of cells expressing both fap and Cm proteins can reach 82%.
[0171] Next, select the above EcB1SA intimin fapCm and EcB1SA YeeJ Single clones of the fapCm strain were cultured at 37°C and 220 rpm for 12–16 h. The overnight culture was transferred to fresh liquid medium at a 1:100 ratio and cultured at 37°C and 220 rpm for another 2–2.5 h. When OD600 ≈ 0.7, 0.05 mM IPTG was added and thoroughly mixed with the bacterial solution before aliquoting into black 96-well plates. Three wells were set for each single clone of the strain, with 120 μL of bacterial solution added to each well. A pre-programmed detection program was used in a high-throughput analyzer: the mcherry fluorescence intensity was recorded every 10 min from the bottom of the 96-well plate, with an incubation temperature of 37°C and a oscillating incubation mode, for a total of 16 h. The results are shown below. Figure 20 middle.
[0172] Figure 20 The results show the real-time monitoring of mcherry fluorescence intensity changes using a high-throughput screening detector. The results show EcB1SA intiminfapCm and EcB1SA YeeJ fapCm strain Cm protein expression dynamic results. EcB1SA intimin fapCm and EcB1SA YeeJ fapCm strain under IPTG induction high level expression of Cm, 4h within the expression level of exponential growth period, 4~16h time period has remained stable level. Without IPTG induction, EcB1SA intimin fapCm and EcB1SA YeeJ fapCm strain will appear Cm background expression, but the expression level is low.
[0173] Figure 21 The mcherry fluorescence intensity of the corresponding bacterial culture supernatant is shown in Figure 20 The results show the extracellular secretion of Cm. Under IPTG induction, EcB1SA intimin fapCm and EcB1SA YeeJ fapCm bacteria culture medium mcherry fluorescence intensity is much higher than that without IPTG induction. The above results prove that EcB1SA intimin fapCm and EcB1SA YeeJ fapCm strain under IPTG induction conditions can simultaneously express high level of SAfap and Cm, and successfully secret Cm to the extracellular.
[0174] The Cm recombinant protein and EcB1SA-fap-Cm engineering bacteria induced apoptosis were tested in vitro. Briefly, the bacterial culture supernatant containing Cm and EcB1SAfapCm were respectively co-incubated with iBCAFs cells. The cells treated with LB medium were used as control group, and iBCAFs were respectively co-incubated with EcB1SA intimin fap, EcB1SA YeeJ fap strain culture supernatant, EcB1SA intimin fapCm and EcB1SA YeeJ fapCm strain culture supernatant was incubated overnight for 12~16h. After staining with Annexin V-APC / PI apoptosis detection kit (Vazyme), the survival of iBCAFs cells was detected by flow cytometry, and the results are shown in Figure 22 The statistical analysis results of cell activity after 3 biological repeats are shown in Figure 24 .
[0175] As shown in Figure 22 and Figure 24 , EcB1SA intimin fapCm and EcB1SAYeeJ The apoptosis rate of iBCAFs cells incubated with the supernatant of fapCm strain overnight was about 47% and 42%, which was significantly higher than that of iBCAFs cells in LB control group and two groups of medium without Cm recombinant protein, which proved that the cytotoxicity of Cm recombinant protein could effectively induce iBCAFs cell apoptosis. Compared with LB control group, iBCAFs cells were co-cultured with EcB1SA intimin fapand EcB1SA YeeJ The cell activity was also reduced to a certain extent after the overnight incubation of EcB1SA
[0176] Similarly, EcB1SA intimin fapand EcB1SA YeeJ fapstrains and EcB1SA intimin fapCmand EcB1SA YeeJ fapCmstrains were co-cultured with iBCAFs cells for 4h, respectively, to verify the ability of the engineered bacteria to target and induce apoptosis. Figure 23 and Figure 25 The results of flow cytometry analysis of iBCAFs cell activity and statistical analysis after 3 biological replicates are shown.
[0177] As Figure 23 and Figure 25 shown, compared with the Mock negative control group under normal culture conditions, EcB1SA intimin fapand EcB1SA YeeJ fapstrains could significantly reduce the cell activity after co-culturing with iBCAFs cells for 4h, which indicated that the engineered bacteria could greatly affect the cell survival state after targeting and adhering to the cells, and induce nearly 50% of iBCAFs cells to die. Compared with EcB1SA intimin fapand EcB1SA YeeJ fapstrains, EcB1SA intimin fapCmand EcB1SA YeeJ fapCmstrains increased the toxic effect of Cm recombinant protein on the basis of targeted adhesion, increased the early apoptosis rate of iBCAFs cells, and further reduced the iBCAFs cell activity to about 35%. And EcB1SA intimin fapCmand EcB1SA YeeJ fapCmengineered bacteria co-cultured with iBCAFs cells for 4h induced apoptosis, which was basically consistent with the apoptosis of cells after overnight incubation with Cm recombinant protein.
[0178] The above results show that the Cm recombinant protein can effectively induce apoptosis. And the engineering bacteria targeted adhesion around iBCAFs cells can have a greater impact on cell activity. On the basis of engineering bacteria targeted adhesion, the secretion of Cm recombinant protein can accelerate the induction of apoptosis.
[0179] Example 9. In vivo verification of tumor treatment effect of EcB1SAfapCm engineering bacteria
[0180] First, a mouse colon cancer model was constructed, and the experimental method was the same as in Example 7. When the tumor volume reached 150-300 mm 3 The tumor-bearing mice were randomly divided into 4 groups, and 1x10 8 CFUEcB1SA intimin , EcB1SA intimin fap, EcB1SA intimin fapCm and 100 μL PBS were injected into the tumor site of each group of tumor-bearing mice.
[0181] Figure 26 The distribution of bacteria was detected by a live imaging instrument after 24 h. It can be seen that all strains are only distributed in the tumor site.
[0182] Figure 27 The EcB1SA intimin and EcB1SA intimin fap engineering bacteria were injected for 24 h, and the mouse tissues were dissected and imaged. The same as the result of tail vein injection of engineering bacteria in Example 7, the engineering bacteria were injected in the tumor site, EcB1SA intimin fap will target and enrich in the tumor cortex, while EcB1SA intimin Due to the interference of antigen-antibody affinity, it can successfully enter the tumor and colonize. It is proved that EcB1SA intimin fap has strong specific targeting ability of CAFs.
[0183] Figure 28 The tumor volume change of each group of tumor-bearing mice within 15 days was counted. Compared with other groups, the tumor volume of the EcB1SA intimin fapCm experimental group of tumor-bearing mice was always lower than 500 mm 3 . It is proved that EcB1SA intimin fapCm can effectively inhibit the growth rate of tumor and produce tumor regression effect in the internal of mouse tumor and the cytotoxicity of Cm recombinant protein.
[0184] Figure 29 The weight change of each group of tumor-bearing mice within 15 days was counted. Compared with other groups, the EcB1SA intiminThe fapCm experimental group mice had lower body weight, but overall still showed a growth trend. EcB1SA intimin Intratumoral injection of fapCm had no effect on the growth of mice.
[0185] Figure 30 For tumor section HE staining, the pathological changes inside the tumor were detected. Compared with PBS and EcB1SA intimin fap, EcB1SA intimin fap and EcB1SA intimin fapCm can significantly destroy tumor tissue, and EcB1SA intimin fapCm has stronger destruction ability.
[0186] Figure 31 For tumor section IHC results, the distribution of FAP antigen and E. coli K / O antigen inside the tumor was detected. Compared with PBS and EcB1SA intimin fap, EcB1SA intimin fap and EcB1SA intimin fapCm experimental group mice had a large number of engineering bacteria enrichment at the tumor site. Due to the targeted colonization and apoptosis induction of engineering bacteria, the distribution of FAP antigen was more diffuse. EcB1SA intimin fap and EcB1SA intimin fapCm can effectively colonize the tumor, and EcB1SA intimin fapCm can effectively induce apoptosis by secreting Cm recombinant protein, destroy tumor tissue, inhibit tumor growth and produce tumor regression effect.
Claims
1. An engineered E. coli, wherein the engineered E. coli is knocked out of the coding genes of type I pilus fimA ~ fimH operon, and The engineered E. coli has a fusion protein on its cell membrane, wherein the fusion protein comprises: a membrane anchoring domain comprising a full length or a fragment thereof derived from a self-transporter of bacteria; and a targeting domain; the membrane anchoring domain comprises a full length or a fragment thereof of a cadherin or a cadherin-like adhesion molecule; the targeting domain comprises a single-domain antibody against fibroblast activation protein; the amino acid sequence of the fusion protein is set forth in SEQ ID NO: 3 or 4.
2. The engineered E. coli according to claim 1, characterized in that, the genome of the engineered E. coli has a nucleotide sequence set forth in SEQ ID NO: 25 or 26.
3. The engineered E. coli of claim 1, wherein, the engineered E. coli is selected from BL21, MG1655, DH5α, Transetta, RosettaBlue, Origami, Rosetta or Trans5α.
4. The engineered E. coli of claim 1, wherein, the E. coli further comprises a cytotoxic molecule or an active fragment thereof.
5. The engineered E. coli according to claim 4, characterized in that, the cytotoxic molecule comprises IFNγ, GM-CSF, TNFα, IL-2, IL-4, IL-5, IL-6, IL-9, IL-10, IL-13, IL-16, IL-17, IL-23, IL-32, granzyme B, perforin or a combination thereof.
6. The engineered E. coli according to claim 4, wherein, the cytotoxic molecule is perforin.
7. The engineered E. coli according to claim 6, characterized in that, the perforin comprises an amino acid sequence set forth in SEQ ID NO:
8. 8.A method for preparing the engineered E. coli of any one of claims 1-7.
9. The method of claim 8, wherein, the method comprises the following steps: 1) using a CRISPR / Cas gene editing system to knock out one or more coding genes in the type I pilus fimA ~ fimH operon of E. coli, to obtain a pilus gene-knocked-out E. coli; and 2) expressing a fusion protein in the pilus gene-knocked-out E. coli, wherein the fusion protein comprises a membrane anchoring domain and a targeting domain.
10. The method of claim 9, wherein, in step 1), sgRNAs targeting fimB and / or fimH are used, wherein the sgRNA targeting fimB has a nucleotide sequence set forth in SEQ ID NO: 15 and / or 16, or the sgRNA targeting fimH has a nucleotide sequence set forth in SEQ ID NO: 17 and / or 18.
11. The method of claim 9, wherein, the method further comprises expressing a cytotoxic molecule in the engineered E. coli. 12.A composition comprising the engineered E. coli of any one of claims 1-7, or a culture supernatant derived from the engineered E. coli. 13.A method for detecting tumor cells for non-diagnostic purposes, the method comprising using the engineered E. coli of any one of claims 1-7, and observing the aggregation of the engineered E. coli around tumor cells, wherein the tumor cells express fibroblast activation protein on the cell surface. 14.Use of the engineered E. coli of any one of claims 1-7 in the preparation of a reagent for detecting tumors, wherein the tumor cells express fibroblast activation protein on the cell surface.
15. Use of the engineered E. coli of any one of claims 1-7 in the manufacture of a medicament for the treatment of colorectal cancer, liver cancer, pancreatic cancer, breast cancer, ovarian cancer, lung cancer, prostate cancer, sarcoma, and head and neck cancer.
Citation Information
Patent Citations
Fibroblast binding agents and use thereof
CN112074267A
Pharmaceutical composition for preventing or treating cancer comprising salmonella strain and immune checkpoint inhibitor as active ingredients
CN118338909A
Fibroblast binding agents and use thereof
US20210023167A1