A kind of amplicon variant marker for identifying two kinds of horse hoof screws

Abstract

The application discloses a kind of amplicon variation markers for identifying two kinds of horse hoof screws.The application finds that there is amplicon variation marker in the position of the 214th position of nucleotide sequence shown in SEQ ID NO.1 of mitochondrial cytochrome oxidase I gene of horse hoof screw, which can distinguish Rochia nilotica and Rochia maxima.If the base of the site is A, the horse hoof screw species is Rochia maxima, and if the base of the site is G, the horse hoof screw species is Rochia nilotica, which is suitable for identifying the two species from eDNA sequence when there is no physical sample, or when the physical form cannot distinguish them.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically an amplicon mutation marker for identifying two types of horseshoe snails and its application. Background Technology

[0002] Horseshoe snails live on coral reef rocks from the low tide line to shallow seas and are a functional species in the coral reef ecosystem.

[0003] Trochia nilotica belongs to the class Gastropoda, family Trochidae, and genus Rochia (formerly known as Trochius, and sometimes used interchangeably with Tectus). Figure 1 ) and Rochia maxima ( Figure 2 These two species are quite similar in morphology and difficult to distinguish, and were once confused as one species. There are some differences in morphology as adults: the shell of *Rochia nilotica* is thicker and heavier, while the shell of *Rochia maxima* is relatively thinner and lighter; the shell height and width of *Rochia nilotica* are similar, while the shell height of *Rochia maxima* is greater than its width; the basal convexity of the snail shell in *Rochia nilotica* is more pronounced than that in *Rochia maxima*. However, overall, distinguishing these two species morphologically is quite difficult.

[0004] With the development of molecular biology techniques and bioinformatics, DNA barcoding-based identification and classification has become a prominent new direction and research hotspot in biological taxonomy. The DNA sequence information of the same organism at different growth stages is identical, and specific species possess specific DNA sequence information. Morphological identification features can lead to errors in species identification due to convergence and variation; therefore, molecular marker identification offers high accuracy. Mitochondrial DNA has been widely used for species identification, especially cytochrome oxidase I (COI) within mitochondrial DNA, which has been recommended by internationally renowned scholars as a DNA barcode. This allows for convenient and rapid identification of biological species and is widely used for environmental DNA (eDNA) detection and labeling. Summary of the Invention

[0005] One objective of this invention is to provide an amplicon variant marker for distinguishing between two species of horseshoe snails and its application. This invention discovers an amplicon variant marker from the mitochondrial COI sequence that can differentiate between *Rochia nilotica* and *Rochia maxima*.

[0006] A marker for identifying amplicon variants in horseshoe snails is located at position 214 of the nucleotide sequence shown in SEQ ID NO.1, with the amplicon variant type being A / G.

[0007] In some embodiments, the base at this site is A, then the species of horseshoe snail is Rochia maxima.

[0008] In some embodiments, the base at this site is G, then the species of horseshoe snail is Rochia nilotica.

[0009] The region TA(G)GCTGG containing the amplicon variation is a conserved region among species (the first 1 base and the last 5 bases of the SNP).

[0010] >SEQ ID NO.1

[0011] TCTGGCTGGAAATTTGGCACATGCTGGTGCGTCAGTTGATCTAGCTATTTTCTCTCTTCATTTAGCAGGGGTATCCTCTATTTTGGGTGCTTGTTAACTTTATTACTACGGTAATTAATATACGTTGACATGGAATGAAGTTCGAACGATTACCTCTATTTGTTTGGTCTGTAAAGATTACAGCAATTTTGTTGTTGTTATCCTTGCCTGTAT TA(G) GCTGG AGCCATTACTATGCTTCTGA CGGATCGAAATTTTAACACATCTTTTTTTGATCCAGCCGGAGGTGGGGATCCTATTCTGTA TCAGCATTTGTTT (The underlined base is the conserved base of this label).

[0012] Another object of the present invention is to provide the application of the above-mentioned marking in the identification of horseshoe snails, specifically in the identification of two species of horseshoe snails, Rochia maxima and Rochia nilotica.

[0013] The marker is located at position 214 of the nucleotide sequence shown in SEQ ID NO.1. If the base at this position is A, the species of horseshoe snail is Rochia maxima; if the base at this position is G, the species of horseshoe snail is Rochianilotica.

[0014] Another object of the present invention is to provide a method for identifying horseshoe snails by detecting the mitochondrial cytochrome oxidase I gene of horseshoe snails and determining the species of horseshoe snails based on the genotype located at position 214 of the nucleotide sequence shown in SEQ ID NO.1.

[0015] In the identification method described above, if the base at position 214 of the nucleotide sequence shown in SEQ ID NO.1 is A, then the species of horseshoe snail is Rochia maxima; if the base at position 214 is G, then the species of horseshoe snail is Rochianilotica.

[0016] The detection methods used for identification include direct sequencing, specific probe hybridization, specific primer extension, or PCR.

[0017] Another object of the present invention is to provide the application of the above-described identification method in identifying two species of horseshoe snails, Rochia maxima and Rochia nilotica.

[0018] The present invention has the following beneficial effects:

[0019] Horseshoe snails inhabit coral reef rocks from the low tide line to shallow waters and are functional species in coral reef ecosystems. Two species within the genus *Rochia*, *Rochia nilotica* and *Rochia maxima*, are morphologically very similar and are often confused, making morphological differentiation difficult. This invention discovers an amplicon variant marker at position 214 of the nucleotide sequence of the mitochondrial cytochrome oxidase I gene in horseshoe snails, as shown in SEQ ID NO.1, which can distinguish between *Rochia nilotica* and *Rochia maxima*. If the base at this site is A, the species is *Rochia maxima*; if it is G, the species is *Rochia nilotica*. This method is suitable for identifying these two species from eDNA sequences when physical samples are unavailable, or when physical morphology cannot distinguish them. Attached Figure Description

[0020] Figure 1 The appearance of Rochia nilotica.

[0021] Figure 2 For the appearance of Rochia maxima.

[0022] Figure 3 This is the alignment result for blanstn.

[0023] Figure 4 The results show the sequence homology alignment of samples rochia-1 to rochia-8.

[0024] Figure 5 The results show the sequence homology alignment of samples ASV72215, ASV586902, and ASV38174.

[0025] Figure 6Phylogenetic cluster analysis of samples ASV72215, ASV586902, and ASV38174. Detailed Implementation

[0026] The following are specific implementation examples of the present invention. It should be noted that these embodiments are merely exemplary and do not constitute any limitation on the scope of the present invention. Modifications and substitutions to the details and form of the implementation schemes made within the scope and spirit of the present invention all fall within the protection scope of the present invention.

[0027] Unless otherwise defined, the technical terms used in the following embodiments have the same meanings as commonly understood by those skilled in the art. Unless otherwise specified, the experimental reagents used in the following embodiments are conventional biochemical reagents.

[0028] Example 1

[0029] 1. Sampling

[0030] In May 2023, water samples were collected at a depth of 20 meters in different areas of the South China Sea using a water sampler. One liter of water was collected from each site. The collected water samples were filtered using sterile 0.45 μm cellulose hydration membranes (Shanghai Xinya). After filtration, each membrane was individually placed into a 25 mL centrifuge tube using sterile forceps and stored at low temperature. Environmental DNA (eDNA) was extracted from the samples using the OMEGA WaterDNA kit (Omega, Norcross, USA) according to the instructions.

[0031] 2. PCR amplification

[0032] The extracted eDNA was amplified by PCR using COI universal primers. The COI primer sequences are as follows:

[0033] MlCOIintF:5'-GGWACWGGWTGAACWGTWTAYCCYCC-3';

[0034] JghHCO2198:5'-TAIACYTCIGGRTGICCRAARAAYCA-3'.

[0035] The PCR reaction system consisted of: 4 μL 5×FastPfu Buffer, 2 μL 2.5 mM dNTPs, 0.8 μL each of forward and reverse primers, 0.4 μL FFastPfu Polymerase, 10 ng eDNA, and ddH2O to a final volume of 20 μL.

[0036] The PCR reaction conditions were: 95℃ pre-denaturation for 5 min; 95℃ for 30 s, 58℃ for 30 s annealing, 72℃ for 45 s extension, 35 cycles; 72℃ for 10 min final extension. The PCR products were mixed and detected by 2% agarose gel electrophoresis. The PCR products were recovered by gel cutting using the AxyPrep DNA Gel Extraction Kit (AXYGEN), eluted with Tris-HCl, and detected by 2% agarose gel electrophoresis. Based on the preliminary quantification results from electrophoresis, the PCR products were analyzed using QuantiFluor... TM The samples were quantified using the ST blue fluorescence quantitative system (Promega), and then mixed in the appropriate proportions according to the sequencing volume requirements of each sample before sequencing on the Illumina PE250 platform.

[0037] 3. Data optimization and species annotation

[0038] After quality control, filtering, splicing and clustering of the raw sequencing reads of each sample, the obtained consistent sequences were compared with the local NT database using blastn for taxonomic analysis.

[0039] The methods and parameters for optimizing the raw sequencing reads data of high-throughput sequencing are as follows: (1) Filter the bases with a quality value of less than 20 at the end of the read and set a 50bp window. If the average quality value within the window is less than 20, cut off the bases at the end of the window and filter the reads with a quality control value of less than 50bp; (2) According to the overlap relationship between PE reads, merge the paired reads into a single sequence with a minimum overlap length of 10bp; (3) The maximum mismatch ratio allowed in the overlap region of the assembled sequence is 0.2, and non-compliant sequences are screened out; (4) Differentiate the samples according to the barcodes and primers at the beginning and end of the sequence and adjust the sequence orientation. The number of mismatches allowed for the barcode is 0, and the maximum number of mismatches for the primer is 2; (5) Use Usearch software and the Gold database to remove chimeras by combining de novo and reference methods to obtain high-quality sequences.

[0040] High-quality sequences were clustered at a 100% similarity level using Vsearch software 2.3.4 to generate operational taxonomic units (OTUs). The parameters for the species annotation blastn alignment were set as follows: Identity > 80%, Coverage > 80%, and E-value < 10. -10 The sequence with the smallest evalue and a score of 350 or higher is selected as the final alignment result.

[0041] 4. Interspecific COI sequence alignment and variant marker discovery

[0042] In the annotation results, according to the comparison criteria, multiple OTUs are simultaneously annotated as Rochia nilotica and Rochia maxima. The one with the highest score is then annotated as Rochia nilotica. Figure 3 ).

[0043] To further confirm the accuracy of the results, we took the corresponding OTU sequences (rochia 1-8) and the COI sequences of these two species from the GenBank database, and performed cluster W alignment, using the COI sequence of Tectus pyramis as the outgroup. The results showed that the OTU sequence (rows 1-8) at position 214 was identical to that of Rochia maxima (A), while Rochia nilotica had G and Tectus pyramis had T. Furthermore, the first base at this position was T in all three species, and the last five bases were GCGGG. This means that the species previously annotated as both Rochia maxima and Rochianilotica in eDNA sequencing should be identified as Rochia maxima; the species annotated as Rochia nilotica with the highest score should also be identified as Rochia maxima. In other words, the alignment parameters could not distinguish these two species, or the annotation was incorrect; amplicon variation can accurately distinguish and identify these two species. Figure 4 ).

[0044] Figure 4In the diagram, rows 1-8 (rochia-1 to rochia-8) are OTU sequences, simultaneously annotated as *Rochia maxima* and *Rochia nilotica* during eDNA amplicon sequence annotation. Row 9 (rmncbi) is the COI sequence of *Rochia maxima* in GenBank, rows 10-13 (rnn1 to rnn4) are the COI sequences of *Rochia nilotica* in GenBank, and rows 14-15 (Tyncbi1, Tyncbi2) are the COI sequences of *Tectus pyramis* in GenBank. This alignment shows that the 214th base (red-marked column) in rows 1-8 is A, the same as in row 9. Therefore, the species originally annotated as both *Rochia maxima* and *Rochia nilotica* should be identified as *Rochia maxima*, as the COI sequence of *Rochia nilotica* has a G base at that position, indicating a difference between the two species. Moreover, compared with similar species, the region where the mutated base is located is more conserved (shown in blue box), making this specific variation easier to distinguish from other species-identifying variations.

[0045] Example 2

[0046] Following the method in Example 1, eDNA sequencing was performed on samples from May 2024. Three sequences (ASV72215, ASV586902, and ASV38174) were labeled as *Rochia nilotica*. Alignment revealed that the 214th base of the sequences in rows 1-3 was an A, identical to the *Rochia maxima* sequence in row 4. Rows 5-8 contained a G at this position, indicating that the sequence labeled *Rochia nilotica* in the eDNA analysis should actually be *Rochia maxima*. Figure 5 Further phylogenetic tree construction revealed that ASV72215, ASV586902, and ASV38174 clustered in the same branch as Rochia maxima, while the four sequences of Rochia nilotica clustered in another branch. Figure 6 This result indicates that the genotype located at position 214 of the mitochondrial cytochrome oxidase I (COI) sequence of the horseshoe snail, as shown in SEQ ID NO.1, can serve as a SNP marker to identify two horseshoe snail species, Rochia maxima and Rochia nilotica. If the base at this SNP site is A, the species is Rochia maxima; if the base is G, the species is Rochia nilotica.

[0047] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. The application of a reagent for detecting and identifying molecular markers in horseshoe snails in the identification of horseshoe snails, characterized in that, The molecular marker is located at position 214 of the nucleotide sequence shown in SEQ ID NO.1, and the polymorphism type at this site is A / G; when the base at position 214 of the nucleotide sequence shown in SEQ ID NO.1 is A, then the species of horseshoe snail is... Rochia maxima When the nucleotide sequence shown in SEQ ID NO.1 has a base of G at position 214, then the species of horseshoe snail is... Rochia nilotica .

2. A method for identifying horseshoe snails, characterized in that, The species of horseshoe snail was determined by detecting the mitochondrial cytochrome oxidase I gene and identifying the genotype located at position 214 of the nucleotide sequence shown in SEQ ID NO.

1. When the base at position 214 of the nucleotide sequence shown in SEQ ID NO.1 is A, the species of horseshoe snail is [missing information]. Rochia maxima When the base at this site is G, then the species of horseshoe snail is... Rochia nilotica .

3. The method according to claim 2, characterized in that, The detection methods used for identification include direct sequencing or PCR.

Images