Primer set and detection method for simultaneous qualitative and quantitative detection of five pathogens and their application

Abstract

The present invention relates to a primer set and a detection method for simultaneously qualitatively and quantitatively detecting five pathogens and their application, belonging to the technical field of pathogen detection. The specific sequence of the detection primer set is shown in SEQ ID NO.1-10. The present invention also provides a kit and a detection method containing the primer set. The detection primer set and the detection method of the present invention have strong specificity, simple and convenient operation, short detection time, high sensitivity, and can simultaneously qualitatively and quantitatively detect EHP, DIV1, IHHNV, WSSV and V AHPND Five pathogens.

Description

Technical Field

[0001] The invention belongs to the technical field of pathogen detection, and specifically relates to a primer set and a detection method for simultaneously qualitatively and quantitatively detecting five pathogens, and applications thereof. Background Art

[0002] As an important part of global food production, the aquaculture industry has developed rapidly in recent years. Crustaceans play an important role in aquaculture, including economically important species such as shrimp and crab. However, in recent years, the intensive farming of crustaceans has become increasingly challenging due to diseases, becoming a key bottleneck for the sustainable development of the industry. Various diseases not only lead to large-scale deaths of farmed organisms, but also severely reduce economic benefits.

[0003] Decapod iridovirus 1 (DIV1) is highly pathogenic to shrimp and other crustaceans. Infected shrimp usually show obvious pathological changes, including decreased vitality and high mortality. Outbreaks of DIV1 have caused huge economic losses to the aquaculture industry, especially in Asia, seriously affecting the yield and quality of farmed shrimp. White spot syndrome virus (WSSV) is highly contagious and can be horizontally transmitted to a variety of crustaceans, including shrimp and crabs. Once infected, the virus replicates rapidly in the host, eventually leading to high mortality. Infectious hypodermal and hematopoietic necrosis virus (IHHNV) infection usually causes shrimp growth retardation and deformity, resulting in a significant decrease in aquaculture production. The epidemic of IHHNV has caused huge economic losses to the aquaculture industry. IHHNV can be transmitted horizontally and vertically to infect juvenile and adult shrimp. Infected shrimp may not have obvious symptoms in the early stage, but as the virus replicates, the pathological changes become more severe. Acute hepatopancreatic necrosis disease (AHPND), mainly caused by Vibrio carrying pirAB genes, infects the hepatopancreas of shrimp, causing acute necrosis of the hepatopancreatic tissue. Infected shrimp show symptoms such as loss of appetite, darkening of body color, lethargy and rapid death. Enterocytozoa (EHP) mainly infects the hepatopancreas of shrimp. EHP infection can usually be transmitted through contaminated water, feed or infected shrimp. Although EHP does not directly cause death, it significantly slows the growth rate of shrimp and causes economic losses to farmers. In addition, in recent years, simultaneous infection with multiple pathogens has often occurred. Therefore, it is urgent to strengthen the early rapid diagnosis and large-scale screening of pathogens and develop multi-target detection methods for simultaneous detection of multiple pathogens.

[0004] In order to cope with the current situation in which aquatic animals are simultaneously infected by multiple pathogens, the multiple EvaGreen fluorescence quantitative method has emerged. This technology not only has the advantages of fluorescence quantitative detection technology such as short time, simple operation, high sensitivity and specificity, but also can realize the simultaneous detection of multiple pathogens, greatly shortening the time of single detection of multiple pathogens. It is a relatively promising multi-target rapid detection technology. Although the multiple EvaGreen fluorescence quantitative technology has so many advantages, its research on rapid detection of aquatic animal pathogens is still in its infancy, and existing research is still mainly focused on multi-target rapid detection of shrimp pathogens. There is still a big gap in the multi-target rapid detection of crustacean pathogens by the multiple EvaGreen fluorescence quantitative method. It can simultaneously detect five important crustacean pathogens (EHP, DIV1, IHHNV, WSSV and V AHPND ) has never been reported. Summary of the invention

[0005] The purpose of the present invention is to overcome the shortcomings of the prior art and provide a method for simultaneously detecting EHP, DIV1, IHHNV, WSSV and V AHPND The multiple EvaGreen fluorescence quantitative detection primer set and detection method have strong specificity, are easy to operate, and can clearly distinguish between various pathogens.

[0006] The present invention utilizes multiplex EvaGreen fluorescence quantitative technology to analyze the gene sequence corresponding to the SWP protein of EHP (GenBank accession number KX258197.1), the gene sequence corresponding to the MCP protein of DIV1 (GenBank accession number KY681039.1), the gene sequence corresponding to the NS1 protein of IHHNV (GenBank accession number JN616415.1), the gene sequence corresponding to the WSV313 protein of WSSV (GenBank accession number NC_075105.1) and the V AHPND The gene sequence corresponding to the PirB protein of isoform (GenBank accession number KM067908.1) is taken as the specific target gene, specific primers are designed, screened and optimized, a multiplex EvaGreen fluorescence quantitative detection method is established, and the reaction conditions are optimized. A positive control group and a negative control group are added during the reaction, and the melting curve is analyzed to achieve a high-accuracy, economical, rapid and sensitive detection effect, thereby achieving the purpose of the present invention.

[0007] The first object of the present invention is to provide a primer set for simultaneously qualitatively and quantitatively detecting five pathogens, wherein the five pathogens are EHP, DIV1, HHNV, WSSV and V AHPNDThe EHP is shrimp hepatocellular carcinoma, DIV1 is decapod iridovirus 1, IHHNV is infectious hypodermal and hematopoietic necrosis virus, WSSV is white spot syndrome virus, V AHPND For Vibrio causing acute hepatopancreatic necrosis, the specific sequence of the detection primer set is shown in Table 1;

[0008] Table 1 Primer names and nucleotide sequences

[0009] .

[0010] The second object of the present invention is to provide a multiple EvaGreen fluorescent quantitative primer set for simultaneous qualitative and quantitative analysis of multiple pathogens, wherein the multiple pathogens are EHP, DIV1, IHHNV, WSSV and V AHPND .

[0011] The third object of the present invention is to provide a multiplex EvaGreen fluorescence quantitative detection kit for simultaneously qualitatively and quantitatively detecting multiple pathogens, wherein the kit comprises the primer set.

[0012] The fourth object of the present invention is to provide a multiplex EvaGreen fluorescence quantitative detection method for simultaneously qualitatively and quantitatively detecting multiple pathogens, wherein the pathogens are EHP, DIV1, IHHNV, WSSV and V AHPND , the method specifically comprises the following steps:

[0013] (1) Collect samples and extract genomic DNA from samples as template for fluorescence quantitative reaction, EHP, DIV1, IHHNV, WSSV and V AHPND The positive samples served as positive controls;

[0014] (2) using the primer set, mixing with EvaGreen fluorescence quantitative premix and sample genomic DNA to form an amplification reaction system, and performing EvaGreen fluorescence quantitative amplification reaction;

[0015] (3) After the amplification reaction, the samples were tested for the presence of EHP, DIV1, IHHNV, WSSV and V by melting curve analysis. AHPND .

[0016] Further, the amplification curve analysis is used to detect whether the sample contains EHP, DIV1, IHHNV, WSSV and V AHPND Specifically: if there is no amplification curve in the negative control, and there is an amplification curve in the positive control, and the Ct value is ≤37, the test is considered valid. Otherwise, the test is invalid and should be repeated; if the Ct value of the sample is ≤37, the test result is that EHP, DIV1, IHHNV, WSSV and V are present in the sample AHPND; If 37<the Ct value of the sample≤40, the sample should be tested again. When testing again, add 2.5 μL template and reduce the volume of water accordingly. If the sample shows an amplification curve and the Ct value is ≤37, the RT-qPCR test result is determined to be the presence of EHP, DIV1, IHHNV, WSSV and V in the sample. AHPND , otherwise it is judged as negative; if the sample has no amplification curve, the test result is judged as negative.

[0017] Further, the melting curve analysis is used to detect whether the sample contains EHP, DIV1, IHHNV, WSSV and V AHPND Specifically, if a single peak appears in the melting curve, if the TM value is the same as the TM value of the EHP positive control, the sample contains EHP; if the TM value is the same as the TM value of the WSSV positive control, the sample contains WSSV; if the TM value is the same as the V AHPND If the positive control TM value is the same, the sample contains V AHPND ; If the TM value is the same as the TM value of the IHHNV positive control, the sample contains IHHNV; if the TM value is the same as the TM value of the DIV1 positive control, and a peak appears, the sample contains DIV1. If there are two or more peaks in the melting curve, the peak is the same as the corresponding positive control peak TM value, and the sample contains the corresponding virus. If there is no peak in the melting curve, the sample does not contain EHP, DIV1, IHHNV, WSSV, V AHPND Five pathogens.

[0018] The total volume of the EvaGreen fluorescent quantitative reaction system is 25 μL, including 2× EvaGreen-containing Mix (50U / μL Taq DNA polymerase, 2 mM dNTPs, 50×ROX azide, EvaGreen, 20 mM Tris-HCl, 0.1mM EDTA, 100 mM Nacl, 0.5% Tween-20, 1 mM dithiothreitol, 50% (v / v) glycerol) 12.5 μL, primers EHP-2-F and EHP-2-R 0.56 μM each, primers IHHNV-P-3F, IHHNV-P-3R, WSSV-Y-2F and WSSV-Y-2R 0.40 μM each, primers DIV1-M-4F, DIV1-M-4R, VP-PB-3F, VP-PB-3R 0.32 μM each, genomic DNA template 1 μL, the balance was deionized water.

[0019] The reaction conditions of the EvaGreen fluorescence quantitative reaction are preferably: 95°C for 3 min; 95°C for 10 s, 64°C for 20 s, 40 cycles; 95°C for 15 s, 64°C for 1 min, and collecting the melting curve at 68°C-85°C.

[0020] The beneficial effects of the present invention compared with the prior art are as follows: the present invention is based on the gene sequence corresponding to the SWP protein of EHP (GenBank accession number KX258197.1), the gene sequence corresponding to the MCP protein of DIV1 (GenBank accession number KY681039.1), the gene sequence corresponding to the NS1 protein of IHHNV (GenBank accession number JN616415.1), the gene sequence corresponding to the WSV313 protein of WSSV (GenBank accession number NC_075105.1) and V AHPND The gene sequence corresponding to the PirB protein of the genotype (GenBank accession number KM067908.1) was used as the specific target gene to design a specific primer set with good specificity, which can simultaneously detect EHP, DIV1, IHHNV, WSSV and V AHPND The present invention designs and screens a set of specific detection primers and detection methods to determine whether EHP, DIV1, IHHNV, WSSV and V are present in the sample tested. AHPND The detection primer set and detection method of the present invention have strong specificity, simple and convenient operation, short detection time and high sensitivity, and can simultaneously detect whether the sample contains EHP, DIV1, IHHNV, WSSV and V AHPND With advantages such as five pathogens, it is particularly suitable for multiple detection in farms and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 This is the result of the amplification curve in the specificity experiment; 1: Contains EHP, DIV1, IHHNV, WSSV and V AHPND Mixture of recombinant plasmids; 2: EHP; 3: DIV1; 4: IHHNV; 5: WSSV; 6: V AHPND ; 7: Vibrio orientalis; 8: Photobacterium mermani subsp. piscicidalis; 9: Vibrio rotifer; 10: cDNA of yellowhead virus genotype 8 (YHV-8); 11: cDNA of infectious myonecrosis virus (IMNV); 12: cDNA of Nodamura virus (CMNV); 13: cDNA of infectious precocious virus (IPV); 14: cDNA of Taura syndrome virus (TSV); 15: cDNA of Macrobrachium rosenbergii Gouda virus (MrGV); 16: ultrapure water;

[0022] Figure 2 This is the result of the melting curve in the specificity experiment; 1: Contains EHP, DIV1, IHHNV, WSSV and V AHPND Mixture of recombinant plasmids;

[0023] Figure 3This is the result of the melting curve in the specificity experiment; 2: EHP; 3: DIV1; 4: IHHNV; 5: WSSV; 6: V AHPND ; 7: Vibrio orientalis; 8: Photobacterium mermani subsp. piscicidalis; 9: Vibrio rotifer; 10: cDNA of yellowhead virus genotype 8 (YHV-8); 11: cDNA of infectious myonecrosis virus (IMNV); 12: cDNA of Nodamura virus (CMNV); 13: cDNA of infectious precocious virus (IPV); 14: cDNA of Taura syndrome virus (TSV); 15: cDNA of Macrobrachium rosenbergii Gouda virus (MrGV); 16: ultrapure water;

[0024] Figure 4 is a sensitivity test diagram; a is the recombinant plasmid containing the gene sequence corresponding to the SWP protein of EHP (1×10 8 - 1×10 1 copies / µL), b is the amplification curve of the recombinant plasmid containing the gene sequence corresponding to the SWP protein of EHP (1×10 8 - 1×10 1 copies / µL), c is the recombinant plasmid containing the gene sequence corresponding to the WSV313 protein of WSSV (1×10 8 - 1×10 1 copies / µL), d is the amplification curve of the recombinant plasmid containing the gene sequence corresponding to the WSV313 protein of WSSV (1×10 8 - 1×10 1 copies / µL), e is the recombinant plasmid containing the gene sequence corresponding to the NS1 protein of IHHNV (1×10 8 - 1×10 1 copies / µL), f is the recombinant plasmid containing the gene sequence corresponding to the NS1 protein of IHHNV (1×10 8 - 1×10 1 copies / µL); g is the standard curve containing V AHPND The recombinant plasmid containing the gene sequence corresponding to the PirB protein (1×10 8 - 1×10 1 copies / µL), h is the amplification curve containing V AHPND The recombinant plasmid containing the gene sequence corresponding to the PirB protein (1×10 8 - 1×10 1 copies / µL), i is the recombinant plasmid containing the gene sequence corresponding to the MCP protein of DIV1 (1×10 8 - 1×10 1copies / µL) amplification curve, j is the recombinant plasmid containing the gene sequence corresponding to the MCP protein of DIV1 (1×10 8 - 1×10 1 copies / µL) standard curve. DETAILED DESCRIPTION

[0025] The following examples are provided to further illustrate the present invention, rather than to limit the present invention.

[0026] Example 1: Design and synthesis of primers

[0027] According to the design principle of EvaGreen fluorescent quantitative primers, EHP, DIV1, IHHNV, WSSV and V were searched in the GenBank database. AHPND The target gene sequences suitable for fluorescence quantitative amplification were finally selected, including the gene sequence corresponding to the SWP protein of EHP (GenBank accession number KX258197.1), the gene sequence corresponding to the MCP protein of DIV1 (GenBank accession number KY681039.1), the gene sequence corresponding to the NS1 protein of IHHNV (GenBank accession number JN616415.1), the gene sequence corresponding to the WSV313 protein of WSSV (GenBank accession number NC_075105.1), and the gene sequence corresponding to the V AHPND The gene sequence corresponding to the PirB protein of the gene (GenBank accession number KM067908.1) was used as the target gene. According to the specific region of the specific gene and the principle of real-time fluorescence quantitative PCR primer design, multiple sets of primers were designed using the National Center for Biotechnology Information of the United States, and a set of primers with the best specificity was screened out.

[0028] The multiplex EvaGreen fluorescence quantitative detection primers designed are:

[0029] EHP-2-F:CGAGTTTTGGCGGCACAATTCTCA,

[0030] EHP-2-R:TCCTACAAATGCTGTGTCTGTGTAA;

[0031] IHHNV-P-3F: CCAGGCAAGGTGGGACTCCG,

[0032] IHHNV-P-3R: TCGCGCTCTAAGTGACGGCG;

[0033] DIV1-M-4F:ACCGTGGCTCTCCCAGTCGGTGGT,

[0034] DIV1-M-4R: GCGGTTGAGGGGGCAACGGCGATA;

[0035] VP-PB-3F: CGCGAGCTAGACGGTGAATGAATGGC,

[0036] VP-PB-3R: ATCAGCCCACGCAGCGAGTTCT;

[0037] WSSV-Y-2F:GGGAGATCTTCGAACCCTGG,

[0038] WSSV-Y-2R: TGAATCTCGGCACACACTCG.

[0039] Example 2: Nucleic acid extraction

[0040] The contents of EHP, DIV1, IHHNV, WSSV, and V AHPND The DNA was extracted from tissue samples containing Vibrio orientalis, Photorhabditis ilicifolia subspecies and Vibrio rotifer using a DNA extraction kit and used as templates for EvaGreen fluorescence quantitative reaction; the viral genomic RNA was extracted from tissue samples containing IMNV, CMNV, YHV-8, IPV, TSV and MrGV using a viral genomic RNA extraction kit, and reverse transcribed using a reverse transcription kit as templates for EvaGreen fluorescence quantitative reaction.

[0041] Example 3: Construction of SWP, MCP, NS1, WSV313 and PirB recombinant plasmids

[0042] The gene sequences corresponding to the SWP protein of EHP, the MCP protein of DIV1, the NS1 protein of IHHNV, the WSV313 protein of WSSV and the V AHPND The preparation method is as follows: using pUC57 as a vector, the gene sequence corresponding to the SWP protein of EHP, the gene sequence corresponding to the MCP protein of DIV1, the gene sequence corresponding to the NS1 protein of IHHNV, the gene sequence corresponding to the WSV313 protein of WSSV and the gene sequence corresponding to the V AHPNDThe gene sequence corresponding to the PirB protein of was taken as the DNA target fragment. The SWP, MCP, NS1, WSV313 and PirB target fragments were connected to pUC57 by ligase to construct recombinant plasmids pUC57-swp, pUC57-mcp, pUC57-ns1, pUC57-wsv313 and pUC57-pirB, and transformed into Escherichia coli DH5α competent cells. Positive clones were screened by ampicillin at a final concentration of 100 μg / mL, and the DNA of the recombinant plasmid was extracted with a plasmid extraction kit. Finally, PCR detection and sequencing were performed to detect whether the recombinant plasmid was successfully constructed.

[0043] Example 4: Specificity of EvaGreen fluorescence quantification method

[0044] The EvaGreen fluorescence quantitative reaction system of the sample was 25 μL, including 2× EvaGreen-containing Mix (50U / μL Taq DNA polymerase, 2 mM dNTPs, 50× ROX azide, EvaGreen, 20 mM Tris-HCl, 0.1 mM EDTA, 100 mM Nacl, 0.5% Tween-20, 1 mM dithiothreitol, 50% (v / v) glycerol) 12.5 μL, primers EHP-2-F and EHP-2-R 0.56 μM each, primers IHHNV-P-3F, IHHNV-P-3R, WSSV-Y-2F and WSSV-Y-2R 0.40 μM each, primers DIV1-M-4F, DIV1-M-4R, VP-PB-3F, VP-PB-3R 0.32 μM each, genomic DNA template 1 μL, the balance was deionized water.

[0045] After the above system is mixed evenly, it is placed in a fluorescence quantitative machine. The reaction conditions are 95℃ for 3 min; 95℃ for 10 s, 64℃ for 20 s, 40 cycles; 95℃ for 15 s, 64℃ for 1 min, and the melting curve is collected at 68℃-85℃.

[0046] like Figure 1 and Figure 2 As shown in the figure, the melting curve has a single peak. If the TM value is the same as the TM value of the EHP positive control, the sample contains EHP; if the TM value is the same as the TM value of the WSSV positive control, the sample contains WSSV; if the TM value is the same as the TM value of the V AHPND If the positive control TM value is the same, the sample contains V AHPND; If the TM value is the same as the TM value of the IHHNV positive control, the sample contains IHHNV; if the TM value is the same as the TM value of the DIV1 positive control, and a peak appears, the sample contains DIV1. If there are two or more peaks in the melting curve, the peak is the same as the corresponding positive control peak TM value, and the sample contains the corresponding virus. If there is no peak in the melting curve, the sample does not contain EHP, DIV1, IHHNV, WSSV, V AHPND Five pathogens.

[0047] Example 5: Sensitivity of EvaGreen fluorescence quantification

[0048] The extracted recombinant plasmids pUC57-swp, pUC57-mcp, pUC57-ns1, pUC57-wsv313 and pUC57-pirB were diluted to the same concentration, so that the final concentration of the plasmid was 100 ng / µL, and then diluted 10-fold with ddH2O to 1×10 8 Copies / µL, 1×10 7 Copies / µL, 1×10 6 Copies / µL, 1×10 5 Copies / µL, 1×10 4 Copies / µL, 1×10 3 Copies / µL, 1×10 2 Copies / µL, 1×10 1 copies / µL, as DNA template for sensitive detection by EvaGreen fluorescence quantitative assay.

[0049] The EvaGreen fluorescence quantitative reaction system of the sample was 25 μL, including 2× EvaGreen-containing mixed solution (50U / μL Taq DNA polymerase, 2 mM dNTPs, 50×ROX azide, EvaGreen, 20 mM Tris-HCl, 0.1 mMEDTA, 100 mM Nacl, 0.5% Tween-20, 1 mM dithiothreitol, 50% (v / v) glycerol) 12.5 μL, primers EHP-2-F and EHP-2-R 0.56 μM each, primers IHHNV-P-3F, IHHNV-P-3R, WSSV-Y-2F and WSSV-Y-2R 0.40 μM each, primers DIV1-M-4F, DIV1-M-4R, VP-PB-3F, VP-PB-3R 0.32 μM each, genomic DNA template 1 μL, the balance was deionized water.

[0050] After the above system is mixed evenly, it is placed in a fluorescence quantitative machine. The reaction conditions are 95℃ for 3 min; 95℃ for 10 s, 64℃ for 20 s, 40 cycles; 95℃ for 15 s, 64℃ for 1 min, and the melting curve is collected at 68℃-85℃.

[0051] The results are as follows Figure 3 and Figure 4 As shown, the sensitivity of the EvaGreen fluorescence quantitative detection method of the present invention is: 1×10 1 This shows that the sensitivity of the multiplex EvaGreen fluorescence quantitative detection method of the present invention is 1×10 1 copies / µL.

[0052] Example 6: Sensitivity of EvaGreen fluorescence quantification

[0053] The extracted recombinant plasmids pUC57-swp, pUC57-mcp, pUC57-ns1, pUC57-wsv313 and pUC57-pirB were diluted to the same concentration, so that the final concentration of the plasmid was 100 ng / µL, and then diluted 10-fold with ddH2O to 1×10 8 Copies / µL, 1×10 7 Copies / µL, 1×10 6 Copies / µL, 1×10 5 Copies / µL, 1×10 4 Copies / µL, 1×10 3 Copies / µL, 1×10 2 Copies / µL, 1×10 1 copies / µL, as DNA template for sensitive detection by EvaGreen fluorescence quantitative assay.

[0054] The EvaGreen fluorescence quantitative reaction system of the sample was 25 μL, including 2× EvaGreen-containing mixed solution (50U / μL Taq DNA polymerase, 2 mM dNTPs, 50×ROX azide, EvaGreen, 20 mM Tris-HCl, 0.1 mMEDTA, 100 mM Nacl, 0.5% Tween-20, 1 mM dithiothreitol, 50% (v / v) glycerol) 12.5 μL, primers EHP-2-F and EHP-2-R 0.56 μM each, primers IHHNV-P-3F, IHHNV-P-3R, WSSV-Y-2F and WSSV-Y-2R 0.40 μM each, primers DIV1-M-4F, DIV1-M-4R, VP-PB-3F, VP-PB-3R 0.32 μM each, genomic DNA template 1 μL, the balance was deionized water.

[0055] Three parallel experiments were performed in each group and three batches were conducted to analyze the inter-group and inter-batch differences of this method. The inter-group and inter-batch differences were both less than 3%, indicating that this method has good repeatability.

[0056] Example 7: Accuracy of EvaGreen fluorescence quantification

[0057] The contents of EHP, DIV1, IHHNV, WSSV, and V AHPND The viral genomic DNA was extracted from tissue samples containing Vibrio orientalis, Photorhabditis ilicifolia subspecies and Vibrio rotifer using a viral genomic DNA extraction kit and used as templates for EvaGreen fluorescence quantitative reaction; the viral genomic RNA was extracted from tissue samples containing IMNV, CMNV, YHV-8, IPV, TSV and MrGV using a viral genomic RNA extraction kit, and reverse transcribed using a reverse transcription kit as templates for EvaGreen fluorescence quantitative reaction.

[0058] The EvaGreen fluorescence quantitative reaction system of the above samples was 25 μL, including 2× EvaGreen-containing mixed solution (50U / μL Taq DNA polymerase, 2 mM dNTPs, 50×ROX azide, EvaGreen, 20 mM Tris-HCl, 0.1mM EDTA, 100 mM Nacl, 0.5% Tween-20, 1 mM dithiothreitol, 50% (v / v) glycerol) 12.5 μL, primers EHP-2-F and EHP-2-R 0.56 μM each, primers IHHNV-P-3F, IHHNV-P-3R, WSSV-Y-2F and WSSV-Y-2R 0.40 μM each, primers DIV1-M-4F, DIV1-M-4R, VP-PB-3F, VP-PB-3R 0.32 μM each, genomic DNA template 1 μL, the balance was deionized water.

[0059] After the above system is mixed evenly, it is placed in a fluorescence quantitative machine. The reaction conditions are 95℃ for 3 min; 95℃ for 10 s, 64℃ for 20 s, 40 cycles; 95℃ for 15 s, 64℃ for 1 min, and the melting curve is collected at 68℃-85℃.

[0060] The samples were compared with the fluorescence quantitative method recommended by WOAH for five pathogens, and the analysis results were consistent, proving that the data of this method is reliable. The melting curve can be used to directly determine whether the sample contains EHP, DIV1, IHHNV, WSSV, V AHPND , greatly shortening the detection time.

[0061] In summary, the EHP, DIV1, IHHNV, WSSV, V AHPND The multiplex EvaGreen fluorescence quantitative detection primer set and detection method based on melting curve can not only quickly, easily and sensitively detect EHP, DIV1, IHHNV, WSSV, V AHPND , and has strong specificity and high accuracy.

Claims

1. A primer set for simultaneously qualitatively and quantitatively detecting five pathogens, characterized in that: The five pathogens are EHP, DIV1, HHNV, WSSV and V AHPND The EHP is shrimp hepatocellular carcinoma, DIV1 is decapod iridovirus 1, IHHNV is infectious hypodermal and hematopoietic necrosis virus, WSSV is white spot syndrome virus, V AHPND For Vibrio causing acute hepatopancreatic necrosis, the specific sequence of the primer set is as SEQ ID NO.1-10.

2. A multiplex EvaGreen fluorescence quantitative detection kit for simultaneously qualitatively and quantitatively detecting five pathogens, characterized in that: The kit comprises the primer set according to claim 1, wherein the five pathogens are EHP, DIV1, HHNV, WSSV and V AHPND .

3. Use of the primer set according to claim 1 or the kit according to claim 2 for simultaneously qualitatively and quantitatively detecting multiple pathogens, characterized in that: The multiple pathogens are EHP, DIV1, IHHNV, WSSV and V AHPND , the application is for purposes other than disease diagnosis and treatment.

4. A multiplex EvaGreen fluorescence quantitative detection method for simultaneously qualitatively and quantitatively detecting multiple pathogens, characterized in that: The detection is for non-disease diagnosis and treatment purposes, and the pathogens are EHP, DIV1, IHHNV, WSSV and V AHPND , the method specifically comprises the following steps: (1) Collecting samples and extracting genomic DNA from the samples as a template for fluorescence quantitative reaction; (2) using the primer set described in claim 1, mixing with EvaGreen fluorescence quantitative premix and sample genomic DNA to form an amplification reaction system, and performing EvaGreen fluorescence quantitative amplification reaction; (3) After the amplification reaction, the samples were tested for the presence of EHP, DIV1, IHHNV, WSSV and V by melting curve analysis. AHPND .

5. The detection method according to claim 4, characterized in that: After the amplification reaction, the samples were analyzed by amplification curve to detect whether they contained EHP, DIV1, IHHNV, WSSV and V AHPND Specifically: if there is no amplification curve in the negative control, and an amplification curve appears in the positive control, and the Ct value is ≤37, the test is considered valid; otherwise, the test is invalid and the test should be repeated; if the Ct value of the sample is ≤37, the test result is that EHP, DIV1, IHHNV, WSSV and V are present in the sample AHPND Any one or more of the following; if 37<Ct value of the sample≤40, the sample should be tested again; when testing again, 2.5μL template is added and the volume of water is reduced accordingly. If the sample is tested again and an amplification curve appears and the Ct value is ≤37, the RT-qPCR test result is determined to be the presence of EHP, DIV1, IHHNV, WSSV and V AHPND Any one or more of the above, otherwise it is judged as negative; if the sample has no amplification curve, the test result is judged as negative.

6. The detection method according to claim 4, characterized in that: A peak appears on the melting curve. If the TM value is the same as the TM value of the EHP positive control, the sample contains EHP; if the TM value is the same as the TM value of the WSSV positive control, the sample contains WSSV; if the TM value is the same as the TM value of the V AHPND If the TM value of the positive control is the same, then the sample contains V AHPND ; If the TM value is the same as the TM value of the IHHNV positive control, the sample contains IHHNV; if the TM value is the same as the TM value of the DIV1 positive control and a peak appears, the sample contains DIV1; if there are two or more peaks in the melting curve, the peak is the same as the corresponding positive control peak TM value, then the sample contains the corresponding virus; if there is no peak in the melting curve, the sample does not contain EHP, DIV1, IHHNV, WSSV, V AHPND Five pathogens.

7. The detection method according to claim 4, characterized in that: The reaction conditions of the EvaGreen fluorescence quantitative reaction are: 95°C for 3 min; 95°C for 10 s, 64°C for 20 s, 40 cycles; 95°C for 15 s, 64°C for 1 min, and collecting the melting curve at 68°C-85°C.

Images