A primer set, detection method and application for detecting influenza A virus subtype H3N2

Abstract

The application belongs to the technical field of biology, and discloses a primer group, a detection method and application for detecting influenza A virus H3N2 subtype, and specifically discloses a reagent, which comprises primers and a probe. The reagent provided by the application can be used for detecting influenza A virus, can quickly detect and identify influenza A virus, and has very high detection sensitivity and specificity, and the detection result is accurate and reliable.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biotechnology, and specifically relates to a primer set, a detection method and application for detecting influenza A virus subtype H3N2. BACKGROUND

[0002] According to the U.S. Centers for Disease Control and Prevention, H3N2 virus is a subtype of influenza A virus, which is associated with more severe illness and higher mortality, especially in young children, the elderly and people with underlying health conditions. The World Health Organization (WHO) reported that H3N2 is the cause of most influenza-related hospitalizations and deaths worldwide. Influenza A virus is one of the main pathogens causing severe respiratory disease, and there are multiple subtypes, among which the H3N2 subtype is widely prevalent in humans. Accurate and early detection of the H3N2 subtype is of great significance for influenza epidemic monitoring, vaccine development and clinical diagnosis. Traditional detection methods mainly use virus isolation and immunological techniques, but these methods are time-consuming and require high equipment and professional skills. Therefore, the development of a rapid, sensitive and specific primer set, detection method and application for the detection of H3N2 subtype is of great significance. In recent years, the development of molecular biology has provided new technical means for the detection of influenza virus. Primer sets and detection methods based on PCR technology have been widely used in the detection of influenza virus, with high specificity and sensitivity, and can obtain detection results in a short time.

[0003] H3N2 virus is highly contagious and can spread through respiratory droplets when infected people cough or sneeze. The symptoms of H3N2 infection are similar to seasonal influenza, including fever, sore throat, cough, fatigue and body aches. Although most people recover from H3N2 infection within a week, in some cases it can lead to serious complications such as pneumonia, bronchitis, and even death. H3N2 influenza virus dominated in 3 of the past 5 fairly severe influenza seasons. The H3N2 component of the influenza vaccine has a lower protective efficacy against infection with co-circulating strains (28-42%). Since its introduction into humans, H3N2 influenza virus has rapidly evolved genetically and antigenically, attempting to escape host immune pressure. The rapid mutation rate of human H3N2 IAV results in the emergence of antigenically novel viruses every 2 to 5 years. TaqMan PCR (Polymerase Chain Reaction) is a highly sensitive and specific nucleic acid detection technique commonly used to detect the presence of viruses, bacteria, fungi and other microorganisms. SUMMARY

[0004] The present application aims at solving one of the above problems, and provides a detection method for influenza A virus, which adopts TaqMan RT-qPCR method to detect and distinguish the original strain and mutant strain of influenza A virus, shortens the time for detection and identification, introduces TaqMan probe to improve the detection sensitivity and specificity, and can be applied to most of the fluorescence quantitative PCR instruments equipped in detection units to complete the accurate identification of virus mutant strains, thereby overcoming the dependence on expensive sequencers and reducing the test cost.

[0005] The first aspect of the present application aims to provide a reagent.

[0006] The second aspect of the present application aims to provide a kit.

[0007] The third aspect of the present application aims to provide the use of the reagent of the first aspect of the present application or the kit of the second aspect of the present application.

[0008] The fourth aspect of the present application aims to provide a RT-qPCR detection method for detecting influenza A virus.

[0009] In order to achieve the above-mentioned purposes, the technical solution adopted by the present application is:

[0010] The first aspect of the present application provides a reagent comprising primers and probes, the nucleotide sequences of the primers and probes are as follows,

[0011] H3-F: 5'-CGGGTACGGACAATGACCAA-3',

[0012] H3-R: 5'-TCTGCTGGGGACATCCCTTA-3',

[0013] H3-P: 5'-CCAAAAGAAGCCAACAAACCGTAATCCC-3'; and / or

[0014] N2-F: 5'-CCTTTGACAATGGAAATGACG-3',

[0015] N2-R: 5'-TGACTTGCCTATTTATCTGCGA-3',

[0016] N2-P: 5'-TGGATGGGAAGAACGATCAGCAA-3'.

[0017] In some embodiments of the present application, the sequence of the probe is labeled with a fluorescent group and a quencher group at both ends, respectively.

[0018] In some embodiments of the present application, the fluorescent group is at least one of FAM, Hex, VIC, TAMRA, ROX, Texas-Red and CY5.

[0019] In some embodiments of the present application, the quenching group is at least one of TAMRA, MGB, BHQ1, BHQ2 and BHQ3.

[0020] In some embodiments of the present application, the fluorescent group is connected to the 5' end of the probe.

[0021] In some embodiments of the present application, the quenching group is connected to the 3' end of the probe.

[0022] In some preferred embodiments of the present application, the 5' end of the H3-P is connected to the fluorescent group FAM and the 3' end is connected to the quenching group BHQ1.

[0023] In some preferred embodiments of the present application, the 5' end of the N2-P is connected to the fluorescent group Hex and the 3' end is connected to the quenching group BHQ1.

[0024] In a second aspect of the present application, a kit comprising the reagent of the first aspect of the present application is provided.

[0025] In some embodiments of the present application, the kit further comprises a PCR reaction solution and a positive standard.

[0026] In some embodiments of the present application, the PCR reaction solution comprises a plasmid template, primers, probes, 2x Taq Pro HS Universal U+Probe Master Mix (containing DNA polymerase, dNTPs, buffer, magnesium ions).

[0027] In a third aspect of the present application, the reagent of the first aspect of the present application or the kit of the second aspect of the present application is used in any one of (1) to (6):

[0028] (1) identifying influenza A virus;

[0029] (2) preparing a product for detecting or assisting in detecting influenza A virus;

[0030] (3) detecting whether a sample to be tested is influenza A virus;

[0031] (4) preparing a product for detecting or assisting in detecting whether a sample to be tested is influenza A virus;

[0032] (5) detecting whether a sample to be tested is infected with influenza A virus;

[0033] (6) preparing a product for detecting or assisting in detecting whether a sample to be tested is infected with influenza A virus;

[0034] The application is used for non-disease diagnosis and treatment.

[0035] In some embodiments of the application, the influenza A virus is influenza A virus H3N2.

[0036] In a fourth aspect of the application, an RT-qPCR detection method for detecting influenza A virus is provided, comprising the steps of using the reagent of the first aspect of the application and / or the kit of the second aspect of the application for detection, and the method is used for non-disease diagnosis and treatment.

[0037] In some embodiments of the application, the detection method comprises the following steps:

[0038] 1) extracting nucleic acid from a sample to be tested;

[0039] 2) using the reagent or the kit to perform RT-qPCR amplification reaction with the nucleic acid of step 1) as a template, and collecting fluorescence signals;

[0040] 3) determining whether the sample to be tested contains or is influenza A virus according to the fluorescence signals.

[0041] In some embodiments of the application, the RT-qPCR amplification reaction system in step 2) is: 10-15 μL of PCR reaction solution, 500-150 nM of final concentration of probe, 100-300 nM of final concentration of upper / lower stream primers, 1-3 μL of nucleic acid, and enzyme-free water added to 20 μL.

[0042] In some embodiments of the application, the RT-qPCR amplification reaction system in step 2) is: 10-15 μL of PCR reaction solution, 20-100 nM of final concentration of probe, 200-250 nM of final concentration of upper / lower stream primers, 1-3 μL of nucleic acid, and enzyme-free water added to 20 μL.

[0043] In some embodiments of the application, the RT-qPCR amplification reaction program in step 2) is: 40-55℃, 4-6 min; 94-96℃, 20-40 s; 94-96℃, 2-10 s, 55-65℃, 15-30 s, 35-45 cycles.

[0044] In some embodiments of the application, the RT-qPCR amplification reaction program in step 2) is: 50-55℃, 5-6 min; 94-96℃, 30-40 s; 95-96℃, 5-10 s, 60-65℃, 20-30 s, 35-40 cycles.

[0045] In some embodiments of the present application, the result determination method of the detection method is to determine whether the sample to be detected contains or is the influenza A virus according to the fluorescence signal.

[0046] In some embodiments of the present application, the influenza A virus is influenza A virus H3N2.

[0047] The present application has the following advantages:

[0048] The reagent provided by the present application can be used for detecting the influenza A virus, can quickly detect and identify the influenza A virus, and has very high detection sensitivity and specificity, and the detection result is accurate and reliable.

[0049] The RT-qPCR detection method provided by the present application has the following advantages:

[0050] The detection speed is improved, and the dependence on expensive instruments is reduced. The application of the present application in virus identification can shorten the speed from 6 to 8 hours to 1 hour, and the technical method does not depend on expensive sequencers, but only needs ordinary fluorescent optical quantitative PCR instruments to complete, reduces the dependence on expensive instruments such as sequencers, saves sample transfer time, and maximally reduces uncontrollable factors.

[0051] The detection sensitivity is improved. The detection sensitivity of the virus nucleic acid variation based on the TaqMan probe RT-qPCR detection can be as high as 1 copies / μL, the RT-qPCR amplification signal can realize the virus nucleic acid variation detection, and the influence of weak amplification signal on the nucleic acid variation detection based on gene sequencing is avoided.

[0052] The detection cost is reduced, and the detection throughput is improved. The whole experimental process of the present application only includes two steps of virus nucleic acid extraction and QRT PCR, the experimental steps are few, the required material and labor cost are greatly reduced, and the high throughput of samples can be conveniently realized through 96 or 384 hole reaction plates.

[0053] The pollution rate is low, and the operation is easy. The current sequencing technology for detecting virus mutation needs virus RNA extraction, RT-PCR amplification, PCR product purification, and machine sequencing steps, and batch operation is easy to introduce operation pollution. This method only needs two steps of virus RNA extraction and RT-qPCR operation, and the corresponding operation pollution is reduced, and a large number of samples can be detected at one time.

[0054] When used alone or in combination with other primers and probes, the performance of the primer and probe of each identification site is different: when used alone, it is not affected by other primers. When combined with other primers, it is easily affected, and the amount of primer and probe, reaction conditions, positive result determination threshold and other sites are optimized. BRIEF DESCRIPTION OF DRAWINGS

[0055] Figure 1 Standard curve of the detection method of the application (two gene sites).

[0056] Figure 2 Gradient fluorescence amplification curve of H3 gene fragment H3 site.

[0057] Figure 3 Gradient fluorescence amplification curve of N2 gene fragment N2 site.

[0058] Figure 4 Double PCR gradient fluorescence amplification curve of H3, N2 sites.

[0059] Figure 5 Specificity test results of the detection method of the application. DETAILED DESCRIPTION

[0060] The content of the application will be further described in detail through specific examples.

[0061] It should be understood that these examples are only used to illustrate the application and not to limit the scope of the application.

[0062] In order to make the purpose, technical solutions and advantages of the embodiments of the application more clear, the technical solutions in the embodiments of the application will be clearly and completely described below. If specific conditions are not indicated in the embodiments, conventional conditions or manufacturer recommended conditions are used. If the reagents or instruments used are not indicated by the manufacturer, they are all conventional products that can be purchased on the market.

[0063] TaqMan RT-qPCR nucleic acid virus detection technology: a technology that combines reverse transcriptase (RT) and polymerase chain reaction (PCR) for detecting and quantifying nucleic acid viruses. It is widely used in clinical diagnosis, virus research and epidemiological investigation, and has become the mainstream method of pathogen detection

[0064] The features and performance of the application will be further described in detail below in combination with examples.

[0065] Example 1 Design of primers and probes

[0066] The full genome sequence of influenza A virus H3N2 subtype was analyzed, and the conserved region of the full genome was analyzed and aligned. According to the design principles of primers and probes, specific probes and primers were designed in the conserved region H3 and N2. The primer and probe sequences are shown in Table 1.

[0067] Table 1 Primer and probe sequences

[0068] Primer name Sequence (5'-3') Number [H3-F] CGGGTACGGACAATGACCAA SEQ ID NO: 1 H3-R TCTGCTGGGGACATCCCTTA SEQ ID NO: 2 [H3-P] CCAAAAGAAGCCAACAAACCGTAATCCC SEQ ID NO: 3 [N2-F] CCTTTGACAATGGAAATGACG SEQ ID NO: 4 [N2-R] TGACTTGCCTATTTATCTGCGA SEQ ID NO: 5 [N2-P] TGGATGGGAAGAACGATCAGCAA SEQ ID NO: 6

[0069] The above primers and probes are synthesized by Shenguo Bioengineering (Shanghai) Co., Ltd.

[0070] The 5' end of H3-P is labeled with a FAM fluorescent group, and the 3' end is labeled with a quenching group BHQ1.

[0071] The 5' end of N2-P is labeled with a HEX fluorescent group, and the 3' end is labeled with a quenching group BHQ1.

[0072] Preparation of standard positive template in Example 2

[0073] The gene sequences of SARS-CoV-2 were searched using the NCBI database and subjected to BLAST comparative analysis, and finally high-quality gene sequences with a similarity of more than 95% to the gene sequences of each typical strain were selected, and Shenguo Shanghai Bioengineering Co., Ltd. was commissioned to synthesize standard recombinant plasmids of each pathogenic microorganism.

[0074] Establishment of detection method in Example 3

[0075] An RT-qPCR method for identifying influenza A virus H3N2 subtype, comprising the following steps:

[0076] (1) Obtain the nucleic acid of the sample to be detected;

[0077] (2) Using the nucleic acid in step (1) as a template, using the primers and probes selected in Example 1, perform RT-qPCR. The 20 μL qPCR amplification reaction system is: 2x Taq Pro HS Universal U+Probe Master Mix 10 μL, 0.4 μL of each of the upstream and downstream primers (10 μM), 0.2 μL of TaqMan probe (10 μM), 2 μL of nucleic acid, and 20 μL of sterile RNase-free water. The amplification reaction conditions are: 50℃, 5min; 95℃, 30s; 95℃, 5s, 60℃, 20s, 40 cycles;

[0078] (3) Perform amplification using the above reaction conditions and system to obtain the amplification kinetics curve. Taking the common logarithm (lgC) of the initial copy number of the standard (prepared in Example 2) as the abscissa and the threshold cycle number (Ct value) as the ordinate, a standard linear regression equation (standard curve) is derived to obtain its sensitivity test data.

[0079] (4) Result determination:

[0080] The qPCR amplification curve is used to observe the amplification efficiency and Ct value of the PCR reaction. The Ct value is the cycle number when the PCR amplification curve crosses the threshold line. The lower the Ct value, the higher the concentration of the initial template.

[0081] Establishment of standard curve in Example 4

[0082] The standard positive template (Example 2) was used as a template, and was diluted by 10-fold gradient to 1 x 10 5 copies / μL, then was aliquoted and stored at -20℃; the diluted template was amplified using the reaction system and reaction procedure of Example 3 to obtain the template copy number and cycle number (Ct value), and after the detection was completed, the concentration lg value (X axis) of each standard was plotted against its corresponding Ct value (Y axis) to draw a standard curve. 0

[0083] The results are shown in Table 1 and Figure 1. Figure 1 .

[0084] Example 5 Sensitivity test

[0085] The standard positive template (Example 2) was diluted to 1 x 10 5 copies / μL, and 3 replicates were set for each gradient, the minimum detection concentration of the detection method of Example 3 was determined by observing the standard curve, and a standard curve was established with the Ct value as the ordinate and the copy number as the abscissa to evaluate the linear relationship and assess the sensitivity of the detection method. 0

[0086] The results are shown in Table 1 and Figure 1. Figures 2-4 and Table 2, when the detection site was H3, the detection sensitivity was 2.36 copies / μL; when the detection site was N2, the detection sensitivity was 2.98 copies / μL.

[0087] Table 2 Positive detection rate of 4 detection sites

[0088]

[0089] Example 6 Specificity test

[0090] The recombinant plasmid of each pathogenic microorganism with a concentration of 10 2 copies / μL was used as a positive template, and the recombinant plasmids of adenovirus, chlamydia pneumoniae, streptococcus pneumoniae, and influenza B virus, as well as pure water ddH2O were used as negative controls for respiratory diseases.

[0091] The test results showed that in the specificity test of respiratory disease-related pathogenic microorganisms, the influenza A virus showed a positive reaction, had no cross-reaction, and was negative and had no cross-reaction with other respiratory pathogens adenovirus, chlamydia pneumoniae, streptococcus pneumoniae, and influenza B virus. Figure 5

[0092] ​​​The specificity of the TaqMan RT-qPCR method was verified by specific tests of respective pathogenic microorganisms, and it was proved that the established TaqMan RT-qPCR detection method has good specificity, and can provide reliable technical support for accurate diagnosis of related diseases.

[0093] The above has described the embodiments of the present application in detail in combination with the drawings, but the present application is not limited to the above-described embodiments, and various changes can be made within the knowledge range possessed by those skilled in the art without departing from the gist of the present application. In addition, the embodiments of the present application and the features in the embodiments can be combined with each other without conflict.

Claims

1. A reagent for detecting influenza A virus subtype H3N2, comprising a primer and a probe, the nucleotide sequence of the primer and the probe is shown as follows, H3-F: 5'-CGGGTACGGACAATGACCAA-3', H3-R: 5'-TCTGCTGGGGACATCCCTTA-3', H3-P: 5'-CCAAAAGAAGCCAACAAACCGTAATCCC-3'; and N2-F: 5'-CCTTTGACAATGGAAATGACG-3', N2-R: 5'-TGACTTGCCTATTTATCTGCGA-3', N2-P: 5'-TGGATGGGAAGAACGATCAGCAA-3'.

2. The agent of claim 1, wherein The sequence of the probe is labeled with a fluorescent group and a quencher group at both ends, respectively.

3. The agent of claim 2, wherein The fluorescent group is at least one of FAM, Hex, VIC, TAMRA, ROX, Texas-Red and CY5; and / or, the quencher group is at least one of TAMRA, MGB, BHQ1, BHQ2 and BHQ3.

4. A kit characterized in that, The kit comprises the reagent of any one of claims 1-3.

5. The kit of claim 4, wherein The kit further comprises a PCR reaction solution and a positive standard.

6. The reagent of any one of claims 1-3 or the kit of claim 4 or 5 for use in any one of (1)-(6): (1) identifying influenza A virus; (2) preparing a product for detecting or assisting in detecting influenza A virus; (3) detecting whether a sample to be tested is influenza A virus; (4) preparing a product for detecting or assisting in detecting whether a sample to be tested is influenza A virus; (5) detecting whether a sample to be tested is infected with influenza A virus; (6) preparing a product for detecting or assisting in detecting whether a sample to be tested is infected with influenza A virus; The above uses are for non-disease diagnosis and treatment. The influenza A virus is influenza A virus subtype H3N2.

7. An RT-qPCR detection method for detecting influenza A virus, comprising the step of detecting using the reagent of any one of claims 1-3 and / or the kit of claim 4 or 5, the method being used for non-disease diagnosis and treatment.

8. The detection method according to claim 7, characterized in that, The detection method comprises the following steps: 1) extracting nucleic acid from a sample to be tested; 2) using the reagent or the kit to perform an RT-qPCR amplification reaction with the nucleic acid of step 1) as a template, and collecting a fluorescent signal; 3) determining whether the sample to be tested contains or is influenza A virus according to the fluorescent signal; The influenza A virus is influenza A virus subtype H3N2.

9. The detection method according to claim 8, characterized in that, In step 2), the RT-qPCR amplification reaction system is: 10-15 μL of PCR reaction solution, a final concentration of the probe of 50-150 nM, a final concentration of the upper / lower primer of 100-300 nM, 1-3 μL of nucleic acid, and enzyme-free water added to 20 μL.

10. The detection method according to claim 9, characterized in that, The RT-qPCR amplification reaction procedure in step 2) is as follows: 40-55℃, 4-6 min; 94-96℃, 20-40 s; 94-96℃, 2-10 s, 55-65℃, 15-30 s, 35-45 cycles.

Images