Eggplant SmCYP82C1 gene and its application

Abstract

The invention belongs to the field of plant molecular biology and genetic engineering, and discloses an eggplant SmCYP82C1 The invention discloses a gene and its application, wherein the nucleotide sequence of the gene is shown in SEQ ID NO: 1, and the amino acid sequence encoded by the gene is shown in SEQ ID NO: 2, which plays a role in improving cold tolerance in plants. The invention successfully cloned the nucleotide sequence of the gene in eggplant by molecular biology technology. SmCYP82C1 Gene. Through heterologous overexpression experiments in Arabidopsis, the present invention shows that the gene can significantly improve the cold tolerance of transgenic plants, which is mainly manifested in the reduced accumulation of reactive oxygen species, the increased activity of antioxidant system enzymes, and the increased content of osmotic regulator proline in transgenic plants under cold stress conditions. The changes in these physiological and biochemical indicators indicate that the overexpression of the gene helps to protect plant cell membranes from oxidative damage caused by cold damage and improves the adaptability of plants to osmotic stress.

Description

Technical Field

[0001] The invention belongs to the field of plant molecular biology and genetic engineering and relates to eggplant SmCYP82C1 Genes and their application in improving cold tolerance in plants. Background Art

[0002] Eggplant (scientific name: Solanum melongena L.), as an important vegetable crop in the Solanaceae family, is widely planted around the world for its rich nutritional value and unique taste. Eggplant is a thermophilic plant with an optimal growth temperature of 25-30°C. Eggplant production in my country is mainly cultivated in early spring, which is susceptible to low temperature and chilling damage, resulting in slow plant growth, falling flowers and fruits, and fruit deformities, which seriously affects the yield and quality of eggplant and poses a huge threat to eggplant production. Low temperature and chilling damage has developed into one of the main abiotic stress factors affecting eggplant production and is a difficult problem that needs to be solved urgently in production.

[0003] To meet this challenge, scientists have been looking for ways to improve the cold resistance of eggplant. Traditional breeding methods improve crop resistance by selecting and hybridizing varieties with excellent traits, but this method has a long cycle, low efficiency, and is limited by the genetic background of the parents. With the development of modern molecular biology technology, especially the application of genetic engineering technology, new ideas and methods have been provided for the cultivation of new high-yield and stress-resistant varieties.

[0004] Therefore, exploring and utilizing cold-resistant genes in eggplant, analyzing their regulatory mechanisms, and applying them to cold-resistant molecular breeding of eggplant are of great significance for improving the cold tolerance of eggplant and ensuring the sustainable development of the eggplant industry. Summary of the invention

[0005] In view of this, the present invention successfully cloned a CYP450 family member in eggplant through modern molecular biology technology. SmCYP82C1 Gene, through cloning and functional verification, proved SmCYP82C1 The important role of genes in improving cold tolerance in eggplant.

[0006] The inventor has continuously innovated and reformed to solve the above technical problems through long-term exploration and attempts, as well as multiple experiments and efforts. The technical solution provided by the present invention is to provide an eggplant SmCYP82C1 A gene, the nucleotide sequence of which is shown in SEQ ID NO: 1.

[0007] Furthermore, the amino acid sequence encoded by the gene is shown in SEQ ID NO:2.

[0008] Compared with the prior art, the present invention has the following beneficial effects:

[0009] The present invention successfully cloned the eggplant SmCYP82C1 Gene, which plays a vital role in the response of eggplant to low temperature stress. Through heterologous overexpression experiments in Arabidopsis, the present invention shows SmCYP82C1 The gene can significantly improve the cold tolerance of transgenic plants, which is mainly manifested in the reactive oxygen species (such as O2 − and H2O2) accumulation decreased, the activity of antioxidant system enzymes increased, and the content of osmotic regulator proline increased. These changes in physiological and biochemical indicators indicate that SmCYP82C1 Overexpression of the gene helps protect plant cell membranes from oxidative damage caused by cold damage and improves the adaptability of plants to osmotic stress. Therefore, the present invention not only provides an important gene resource for cold-resistant molecular breeding of eggplant, but also provides new strategies and theoretical basis for cold stress response research and genetic improvement of other Solanaceae crops and even more plants. In addition, the application of the present invention may also be extended to improving other abiotic stress resistance through genetic engineering means, thereby realizing a wider range of application value in agricultural production.

[0010] The present invention also provides a method for cloning the eggplant SmCYP82C1 The primer composition for a gene comprises a first upstream primer whose sequence is shown as SEQ ID NO:3 and a first downstream primer whose sequence is shown as SEQ ID NO:4.

[0011] Compared with the prior art, the cloning primer composition of the present invention has the following beneficial effects:

[0012] The cloning primer combination of the present invention is specifically designed to accurately identify and amplify the SmCYP82C1 The specially designed primer combination reduces the risk of nonspecific amplification and improves the success rate of cloning the target gene. In addition, the primer combination of the present invention also helps to simplify the experimental operation process, shorten the experimental time, reduce the cost, and make eggplant SmCYP82C1 The gene cloning process is more efficient and economical. These advantages not only promote the rapid identification and functional research of eggplant cold-resistance-related genes, but also provide a powerful tool for eggplant molecular breeding and genetic improvement, helping to accelerate the development of new cold-resistance eggplant varieties.

[0013] The invention also provides a method for identifying eggplant SmCYP82C1 The primer composition for gene expression comprises a second upstream primer whose sequence is shown as SEQ ID NO:5 and a second downstream primer whose sequence is shown as SEQ ID NO:6.

[0014] Compared with the prior art, the identification primer composition of the present invention has the following beneficial effects:

[0015] The identification primer combination of the present invention is specially designed for use in eggplant SmCYP82C1 Gene expression analysis ensures the SmCYP82C1 Accurate detection of gene expression. This specially designed primer combination improves the sensitivity and specificity of detection, reduces nonspecific amplification, and thus provides more reliable gene expression data. In addition, the primer combination of the present invention also helps to achieve accurate detection of eggplant at different developmental stages or under different environmental stresses. SmCYP82C1 Rapid and accurate analysis of gene expression patterns is essential for a deeper understanding of the function of this gene in eggplant growth, development and stress response. These advantages not only promote the functional research of eggplant cold tolerance-related genes, but also provide a precise tool for molecular breeding and genetic improvement of eggplant, which will help to breed new varieties with excellent cold tolerance traits.

[0016] The present invention also provides a method for enhancing cold tolerance of plants, by heterologously expressing the eggplant SmCYP82C1 Genes to enhance the plant's tolerance to cold stress.

[0017] Compared with the prior art, the method of the present invention has the following beneficial effects:

[0018] The method of enhancing plant cold tolerance of the present invention uses molecular biological methods to directly genetically improve the cold tolerance of plants, which not only improves the growth vitality and survival rate of plants under low temperature conditions, but also reduces the negative impact of cold damage on plant growth and development. Through transgenic technology, SmCYP82C1 The expression of the gene can produce a series of physiological and biochemical reactions in plant cells, enhance the plant's antioxidant defense system, increase the accumulation of osmotic regulating substances, thereby protecting the plant cell structure and function, and reducing the oxidative damage and osmotic stress caused by cold stress. The application of this method not only provides an effective cold tolerance improvement strategy for eggplant, but also for other crops, which helps to improve the productivity and stability of crops under variable climate conditions, and has important practical significance for agricultural production and food safety.

[0019] The present invention also provides a method for measuring the response of eggplant to cold stress, by measuring the SmCYP82C1 The expression level of genes was used to evaluate the response of eggplant to cold stress.

[0020] Compared with the prior art, the method of the present invention has the following beneficial effects:

[0021] The method for measuring the response of eggplant to cold stress provides a rapid, accurate and direct molecular marker for evaluating the physiological state and cold tolerance of eggplant when facing a low temperature environment. SmCYP82C1By monitoring changes in gene expression, researchers and breeders can more accurately understand the adaptability and response mechanism of eggplant to cold stress, thereby providing important data support for cold-resistant breeding of eggplant.

[0022] The present invention also provides a method for molecular breeding of eggplant, using the eggplant SmCYP82C1 Gene development of molecular markers to screen eggplant varieties with enhanced cold tolerance.

[0023] Compared with the prior art, the method of the present invention has the following beneficial effects:

[0024] The breeding method of the present invention allows breeders to quickly identify and select those eggplant germplasm resources SmCYP82C1 Individuals with high gene expression levels may have stronger cold tolerance, thereby accelerating the breeding process of cold-resistant varieties. SmCYP82C1 Gene as a molecular marker can significantly improve the accuracy and efficiency of breeding because it is directly related to the cold tolerance trait of eggplant. This method not only reduces the dependence on environmental conditions and the long selection cycle in the traditional breeding process, but also helps to reduce breeding costs and resource consumption.

[0025] The present invention also provides a vector for preparing a transgenic plant, the vector comprising the eggplant SmCYP82C1 Gene.

[0026] Compared with the prior art, the method of the present invention has the following beneficial effects:

[0027] The vector for preparing transgenic plants provided by the present invention is prepared by SmCYP82C1 The gene is inserted into the vector, achieving efficient expression of the gene in different plants. The application of this vector not only improves the cold tolerance of transgenic plants, but also provides a stable and reliable gene delivery system for plant genetic improvement.

[0028] The present invention also provides a composition for improving the cold tolerance of plants, the composition comprising the eggplant SmCYP82C1 The expression product of a gene.

[0029] Compared with the prior art, the method of the present invention has the following beneficial effects:

[0030] The composition for improving the cold tolerance of plants provided by the present invention is SmCYP82C1 The expression product of the gene enhances the plant's ability to adapt to low temperature environments and significantly improves the plant's survival rate and growth performance under cold stress. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments will be briefly introduced below. It should be understood that the following drawings only show certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without paying creative work.

[0032] Figure 1 yes SmCYP82C1 Electrophoresis diagram of gene cloning.

[0033] Figure 2 yes SmCYP82C1 Bioinformatics analysis results.

[0034] Figure 3 It is the result of phylogenetic analysis of CYP450 proteins. Figure 3 The red five-pointed star indicates SmCYP82C1 .

[0035] Figure 4 Eggplant cold stress treatment SmCYP82C1 Expression pattern analysis.

[0036] Figure 5 In transgenic plants SmCYP82C1 Identification results of gene expression.

[0037] Figure 6 The figure shows the phenotypic observation and ROS content staining of wild-type and transgenic strains. Figure 6 In the figure, A is the comparison between wild type and transgenic plants, CK is the untreated group, and T is the cold stress treatment group; B is the DAB staining results of leaves of wild type and transgenic plants; C is the NBT staining results of leaves of wild type and transgenic plants.

[0038] Figure 7 Under normal conditions and cold stress SmCYP82C1 -Physiological indicators of OE and WT Arabidopsis; Figure 7 In the figure, A is MDA content; B is proline content; C is SOD enzyme activity; D is CAT enzyme activity; E is APX enzyme activity; F is POD enzyme activity; G is GR enzyme activity; H is chlorophyll content. p value: 0.1<*p<0.05, **p<0.01, ***p<0.001. DETAILED DESCRIPTION

[0039] The following describes the invention in conjunction with specific embodiments.

[0040] In order to make the purpose, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below in combination with the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention. Therefore, the following detailed description of the embodiments of the present invention is not intended to limit the scope of the invention claimed for protection, but merely represents selected embodiments of the present invention.

[0041] In the present invention, unless otherwise specified, all equipment and raw materials can be purchased from the market or are commonly used in the industry. The methods in the following embodiments, unless otherwise specified, are conventional methods in the art.

[0042] eggplant SmCYP82C1 Gene and its encoded amino acid sequence, used for cloning the eggplant SmCYP82C1 Primer composition for gene, vector for preparing transgenic plants (i.e., overexpression vector described in this embodiment), and vector for identifying eggplant SmCYP82C1 The primer composition for gene expression, the method for enhancing plant cold tolerance, the method for determining the response of eggplant to cold stress, the method for molecular breeding of eggplant, and the composition for improving plant cold tolerance are technically related to each other and are described together in this embodiment.

[0043] In the course of ongoing scientific research, the inventors discovered key genes related to cold stress regulation. SmCYP82C1 , and cloned the full-length gene. SmCYP82C1 The coding region sequence of the gene, the target fragment CDS sequence was sequenced to obtain a 2541 bp sequence, the nucleotide sequence is shown in SEQ ID NO:1; it encodes 846 amino acids, the sequence is shown in SEQ ID NO:2, and sequence analysis shows that it contains two complete p450 domains and belongs to the 450 superfamily (cl04677). The phylogenetic relationship shows SmCYP82C1 It is in the same branch as Arabidopsis AtCYP82C1 and belongs to the clan71 subfamily.

[0044] SmCYP82C1 The cloning primer sequences were designed by primerprimer 5 v5.5.0 software and synthesized by Beijing Qingke Biotechnology Co., Ltd. The detailed information of cloning primers is shown in Table 1, and the detailed information of gene fluorescence quantitative primers is shown in Table 2.

[0045] Table 1 Eggplant SmCYP82C1 Gene cloning primers

[0046]

[0047] Note a: The underlined part " ccatcgatgg "," aactgcaaaccaatgcattgg " is the restriction site.

[0048] Table 2 SmCYP82C1 Gene fluorescence quantitative primers

[0049]

[0050] In this embodiment, the low temperature stress (or "cold stress") treatment operation is as follows:

[0051] The experimental material eggplant "E7134" was preserved and provided by the Horticulture Research Institute of Sichuan Academy of Agricultural Sciences and planted in the Xindu Base of the Horticulture Research Institute of Sichuan Academy of Agricultural Sciences. Under natural conditions, when the seedlings grew to 5-6 leaves and one heart, they were placed in an artificial climate chamber for low temperature stress treatment for 1 week (growth conditions: temperature was 10°C during the day and 5°C at night; light and dark cycle was 16 / 8 hours). Eggplant leaves were collected at five time points, namely 0d, 1d, 2d, 4d, and 7d of treatment, and after liquid nitrogen treatment, they were placed in a -80°C ultra-low temperature refrigerator for subsequent RNA extraction.

[0052] 1. Eggplant SmCYP82C1 Gene amplification and sequence analysis

[0053] The plant materials stored at -80℃ were ground with liquid nitrogen, and the total RNA of eggplant leaves was extracted by TRIzol extraction method. The RNA integrity was detected by agarose gel electrophoresis. The RNA to be tested was reverse transcribed into cDNA using Takara's reverse transcription kit. After reverse transcription, 90μL of nuclease-free water was added and stored in a -20℃ refrigerator for later use.

[0054] The diluted first-strand cDNA product extracted from the eggplant leaves was used as a DNA template for PCR amplification. The polymerase chain reaction (PCR) was performed using the primers designed in Table 1 for sequence amplification, and the amplification system was shown in Table 3.

[0055] Table 3 PCR system

[0056]

[0057] The mixture was mixed, centrifuged briefly, and PCR amplification was performed according to the following reaction conditions:

[0058] 98 ℃ 2 min, 98 ℃ 10 s, Tm 64 ℃ 38 cycles, 72 ℃ 50 s, 72 ℃ 5 min, 4 ℃ 5 min.

[0059] The PCR reaction results were separated by 1% agarose gel electrophoresis. Under long-wave ultraviolet light, the DNA bands with the same size as the target sequence were cut and the PCR amplification product was recovered by gel according to the instructions of the Bomed agarose gel purification and recovery kit. The purified product was connected to the pMD-19T vector and the connected product was transformed into Escherichia coli at 4°C overnight. Single colonies were selected for PCR molecular detection, and the Escherichia coli positive clones were commissioned to Beijing Qingke Biotechnology Co., Ltd. for determination.

[0060] Electrophoresis showed that the extracted RNA bands were clear and intact, without degradation, and the quality met the experimental requirements. SmCYP82C1 The cloned electrophoresis diagram of the gene is shown in Figure 1 As shown, the target fragment was sequenced to obtain a 1536 bp coding sequence, as shown in SEQ ID NO: 1; encoding 512 amino acids, as shown in SEQ ID NO: 2.

[0061] 2. Eggplant SmCYP82C1 Protein phylogenetic analysis

[0062] The Arabidopsis CYP450 family protein sequences were obtained from the Cytochrome P450 Homepage (https: / / drnelson.uthsc.edu / ). MEGA (V10.2.2) was used to perform MUSCLE alignment of the CYP450 protein sequences of eggplant and Arabidopsis species, and an unrooted phylogenetic tree was constructed to explore their genetic relationships (phylogenetic tree parameter settings: Neighbor-Joining (NJ) algorithm, Jones-Taylor-Thornton (JTT) model, Pairwise deletion mode, Bootstrap value of 1000).

[0063] 3. Eggplant SmCYP82C1 Family gene structure and conserved motif analysis, promoter element analysis

[0064] Use SMART (http: / / smart.embl.de / ) online software to SmCYP82C1 The protein sequence was analyzed for domain structure. TBtools (V1.082) was used to analyze the eggplant genome data and related annotation GFF files to draw the gene structure map; the amino acid sequence of SmCYP82C1 protein was analyzed through the online website MEME (http: / / meme-suite.org / tools / meme) to predict the number and distribution of its motifs. SmCYP82C1The online website PlantCARE (http: / / bioinformatics.psb .ugent.be / webtools / plantcare) was used to SmCYP82C1 Start component analysis.

[0065] SMART results ( Figure 2 Middle A) shows that the cloned sequence has two complete p450 domains and two membrane transport regions, belonging to the cytochrome P450 superfamily. The gene is located on chromosome 4 of eggplant at 79549349-79553000. SmCYP82C1 The relative molecular mass of the protein is 95794.16Da, and the isoelectric point is 8.31. Gene structure analysis shows that the gene contains three exons and two introns ( Figure 2 Middle B). SmCYP82C1 The number of protein motifs is 20, excluding motif 9 and motif 13 ( Figure 2 Middle C). Extracted from the eggplant genome SmCYP82C1 Analysis of the 2000bp sequence upstream of the gene revealed SmCYP82C1 The promoter sequence contains three types of elements: Figure 2 Middle D): Hormone response elements (such as GA and SA response elements), light response elements and stress response elements (such as low temperature, drought, stress defense elements). SmCYP82C1 It may play an important role in eggplant growth and development, stress and photoperiod regulation. Phylogenetic analysis showed that SmCYP82C1 Arabidopsis thaliana AtCYP82C In the same branch, belonging to the 82C subfamily members ( Figure 3 ), named SmCYP82C1 .

[0066] 4. Analysis of gene expression patterns

[0067] The results of five time points under cold stress SmCYP82C1 Gene materials were tested by fluorescence quantitative PCR. Gene fluorescence quantitative primers are shown in Table 2, qPCR system is shown in Table 4, and qPCR reaction program is set as shown in Table 5. β-tubulin The gene (sequence shown in SEQ ID NO:7-8) was used as an internal reference for detection, and three biological replicates and technical replicates were set up. The expression level was calculated using the 2-∆Ct method.

[0068] Table 4 qPCR system

[0069]

[0070] The qPCR reaction program was set up as follows:

[0071] Table 5 qPCR reaction procedure

[0072]

[0073] SmCYP82C1 The expression patterns of eggplant at five time points of cold stress, the specific results are as follows Figure 4 As shown, SmCYP82C1 The expression of the gene was significantly upregulated. Compared with the control group (0d), the expression of the gene was significantly upregulated on the first day of cold treatment, about 2 times. By the second day, the gene expression was significantly downregulated. Then it was significantly upregulated on the fourth and seventh days, and the expression reached the highest level on the seventh day, which was 7.8 times that of the control group. These results show that SmCYP82C1 The gene may play a key role in the adaptive response of eggplant to cold stress.

[0074] 5. Construction of gene overexpression vector

[0075] Use the high-purity plasmid DNA extraction kit to extract the eggplant DNA with correct sequence determination. SmCYP82C1 The bacterial liquid plasmid was double-digested with restriction endonucleases EcoRI and PstI to obtain pCAMBIA3301 (stored in this laboratory). pCAMBIA3301 is a commonly used plant expression vector that contains the 35S promoter of cauliflower mosaic virus. The restriction enzyme system settings are detailed in Table 6. The reaction conditions are 37 °C, 30 min. After the reaction, 1% agarose gel electrophoresis was used for separation and detection. The enzyme gel was recovered using the instructions of the Bomed agarose gel purification and recovery kit. The pCAMBIA3301- SmCYP82C1 The recombinant was introduced into Agrobacterium GV3101 for subsequent infection.

[0076] Table 6 Enzyme digestion system preparation

[0077] .

[0078] Table 7 Ligation reaction system

[0079] .

[0080] 6. Wild-type Arabidopsis cultivation and infection

[0081] Arabidopsis thaliana (Col) seeds (stored in our laboratory).

[0082] A certain amount of Arabidopsis seeds were selected, and the impurities were first removed and placed in a clean centrifuge tube. Subsequently, sterile distilled water was added to the tube under sterile conditions, and a sodium hypochlorite solution with a volume ratio of 1 / 50 was added. The seeds were sterilized by shaking up and down for 10-15 minutes. After that, the seeds were thoroughly washed 4-5 times with sterile distilled water. Next, the sterilized seeds were evenly spread on 1 / 2 MS solid culture medium, first placed in a refrigerator at 4°C for low-temperature culture for 3 days to promote synchronous germination of the seeds, and then transferred to a light incubator for continued culture for about a week. When the seedlings grew to the appropriate stage, they were carefully transplanted into the pre-prepared culture soil (mixed with sterilized substrate soil and vermiculite) and placed in a light incubator for continued growth. The incubator was set to long-day conditions (16 hours of light / 8 hours of darkness), the temperature was maintained at 22°C, and the relative humidity was maintained at 70%.

[0083] For genetic transformation, Arabidopsis plants were treated with the floral dipping method. When Arabidopsis thaliana grew to the bolting stage and had 3 to 4 stem leaves, all plants were uniformly apexed to eliminate apical dominance and promote the luxuriant growth of lateral branches. When a large number of unopened flower buds were formed on the plants, the flower buds were briefly (about 15 seconds) immersed in the infection solution of Agrobacterium GV3101 containing the recombinant. After the infection, the plants were placed in a dark place for about 3 days to improve the transformation efficiency.

[0084] 7. Screening and identification of transgenic Arabidopsis

[0085] After the T0 generation seeds were treated with the above disinfection method, they were evenly placed on the surface of 1 / 2 MS solid culture medium containing 30 mg / L hygromycin. Plants that can develop normally on this culture medium are considered potential successful transgenic plants. Then, DNA is extracted from these plants showing resistance and used as a template for PCR amplification for molecular level confirmation. The amplified products are detected by gel electrophoresis technology to observe whether the expected specific bands appear, thereby verifying the success of the transgenic. Finally, the verified T2 generation transgenic strains are selected for subsequent phenotypic characteristic observations and functional characteristic analysis.

[0086] The wild type and 35S:: SmCYP82C1 Arabidopsis leaves, cDNA was obtained as a template for qPCR detection, and the test results were as follows Figure 5 As shown, Figure 5 In the table, WT represents wild-type Arabidopsis; OE represents 35S:: SmCYP82C1 The wild-type plants were used as controls. SmCYP82C1 The expression level was significantly upregulated, indicating that the exogenous gene was successfully SmCYP82C1 Transformed into Arabidopsis thaliana.

[0087] 8. Phenotypic observation of transgenic Arabidopsis

[0088] In wild-type and transgenic 35S:: SmCYP82C1 During the growth of Arabidopsis, the morphological changes of plant leaves were recorded and compared in real time. DAB staining: After 7 days of cold stress treatment, leaves of each strain were taken for DAB staining, with at least 10 leaves for each strain; the leaves were placed in a 2ml EP tube, with 3 leaves in each EP tube to avoid the leaves from pressing each other, 2ml DAB staining solution was added to the EP tube, and the EP tube was placed in a foam box to avoid light, and dyed at room temperature for 6h; the stained leaves were transferred to another EP tube, 2ml DAB staining decolorizing solution was added to the tube, and decolorized at room temperature for 30s in the dark, and the decolorizing solution was removed; the above step was repeated twice, and the decolorizing solution was left for the last time, and decolorized at room temperature in the dark overnight; the decolorized leaves were carefully clipped out with tweezers, and photographed and recorded. NBT staining: 16 hours after the injection of the bacterial solution, take the leaves of each strain for NBT staining, at least 10 leaves for each strain; put the leaves into a 2ml EP tube, put 3 leaves in each EP tube to avoid the leaves from pressing each other, add 2ml NBT staining solution into the EP tube, put the EP tube into a foam box to avoid light, and stain at room temperature for 16 hours in the dark; carefully clip out the leaves, transfer them to another EP tube, add 2ml 95% ethanol solution to decolorize in the dark, change the decolorizing solution every 30 minutes until the leaves are fully decolorized; carefully clip out the leaves for observation, and take pictures for record.

[0089] By comparing wild-type Arabidopsis and 35S:: SmCYP82C1 Comparative observation of plants revealed that Figure 6 Middle A), SmCYP82C1 Overexpression affects the cold resistance of Arabidopsis thaliana. SmCYP82C1 The plants showed different degrees of chilling damage, and the chilling damage of two lines was significantly different from that of wild-type plants. The leaves of wild-type plants became darker and wrinkled, and the leaves were narrow and curled downward. In order to detect the accumulation of reactive oxygen species in SmCYP82C1-OE and wild-type Arabidopsis under normal or cold treatment conditions, Arabidopsis leaves were stained with NBT and DAB, respectively ( Figure 6 In Figures B and C, there were no significant differences in NBT and DAB staining under normal conditions; however, under cold conditions, the leaf color depth of the two SmCYP82C1-OE lines was lower than that of the wild type, indicating that overexpression of SmCYP82C1 significantly reduced O2 − and H2O2 accumulation, alleviating the oxidative damage caused by cold stress.

[0090] The content of proline, an osmotic protective substance, the content of malondialdehyde (MDA), a harmful substance, and the activities of reactive oxygen scavenging enzymes SOD, POD, CAT, APX, and GR were detected using commercial kits (Nanjing Jiancheng Bioengineering Institute). Chlorophyll content: the absorbance at wavelengths of 665, 649, and 470 nm was measured using the ethanol extraction method and experimental instruments such as a microspectrophotometer.

[0091] Under normal growth conditions, there were no significant differences in morphology and physiological indicators between transgenic plants and wild-type plants. After 7 days of cold stress at 4°C, the MDA content of both transgenic and wild-type plants increased significantly, but the level of transgenic plants was significantly lower than that of wild-type plants ( Figure 7 In middle A, the proline content of both wild-type and transgenic lines increased ( Figure 7 (B). Compared with the control group, at 4°C, the SOD enzyme activity of SmCYP82C1#OE1 and SmCYP82C1#OE3 was higher than that of the wild type. Similarly, the increase in CAT, APX, POD, and GR enzyme activities in the transgenic lines was significantly higher than that in the wild type ( Figure 7 Under cold treatment, the chlorophyll content of the transgenic lines was higher than that of the wild type ( Figure 7 Therefore, these results suggest that overexpression of the SmCYP82C1 gene enhances cold tolerance in Arabidopsis by protecting the cell membrane from damage and alleviating osmotic stress by increasing the level of the osmoprotectant proline.

[0092] This example proves through cloning and functional verification that SmCYP82C1 Genes play an important role in improving cold tolerance in eggplant.

[0093] In the description of the present invention, it should be understood that "-" and "~" represent the range between two values, and the range includes the endpoints. For example: "AB" represents a range greater than or equal to A and less than or equal to B. "A~B" represents a range greater than or equal to A and less than or equal to B.

[0094] In the description of the present invention, the term "and / or" herein is merely a description of the association relationship of associated objects, indicating that three relationships may exist. For example, A and / or B may represent three situations: A exists alone, A and B exist at the same time, and B exists alone.

[0095] In the description of the invention, the numerical values ​​of time, temperature, ratio, mass, etc. involved may be based on actual measurements, standard parameters of equipment, simplified rounding results, or within an acceptable error range, ensuring the practicability and repeatability of the invention.

[0096] In the description of the present invention, the term "about" or "approximately" is used to express the approximate value of a numerical value or range, allowing a certain error to ensure the flexibility and practicality of the description while remaining within an acceptable error range, with the maximum error range not exceeding 10% of the corresponding numerical value or numerical range.

[0097] The above are only preferred embodiments of the present invention. It should be noted that the above preferred embodiments should not be regarded as limiting the present invention, and the protection scope of the present invention should be based on the scope defined by the claims. For ordinary technicians in this technical field, several improvements and modifications can be made without departing from the spirit and scope of the present invention, and these improvements and modifications should also be regarded as the protection scope of the present invention.

Claims

1. An eggplant SmCYP82C1 A gene characterized by The nucleotide sequence of the gene is shown in SEQ ID NO:

1.

2. A method for cloning the eggplant described in claim 1 SmCYP82C1 A primer composition for a gene, characterized in that It comprises a first upstream primer whose sequence is shown as SEQ ID NO:3 and a first downstream primer whose sequence is shown as SEQ ID NO:

4.

3. A method for identifying the eggplant according to claim 1 SmCYP82C1 A primer composition for gene expression, characterized in that It includes a second upstream primer whose sequence is shown as SEQ ID NO:5 and a second downstream primer whose sequence is shown as SEQ ID NO:

6.

4. A method for enhancing cold tolerance of plants, characterized in that: By heterologously expressing the eggplant of claim 1 in plants SmCYP82C1 Gene to enhance the tolerance of the plant to cold stress; the plant is Arabidopsis thaliana.

Images