A fusion-type adeno-associated virus and its applications

By developing a fusion-type adeno-associated virus capsid protein, the problems of poor tissue specificity and low infection efficiency of adeno-associated virus vectors in cochlear and ophthalmic cells were solved, and specific gene expression in cochlear supporting cells and retinal RPE layer was achieved, improving the precision and safety of gene therapy.

CN119032100BActive Publication Date: 2026-06-30STARRYGENE THERAPEUTICS CO LTD

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
STARRYGENE THERAPEUTICS CO LTD
Filing Date
2023-04-11
Publication Date
2026-06-30

AI Technical Summary

Technical Problem

Existing adeno-associated virus vectors suffer from poor tissue specificity and low infection efficiency when infecting cochlear and ophthalmic cells, affecting the precision and efficacy of gene therapy.

Method used

Develop a fusion-type adeno-associated virus capsid protein comprising peptide fusions of AAV1, AAV2, AAV6, and AAV7 for constructing specific infections of cochlear support cells and ophthalmic cells, particularly the retinal RPE layer, to improve the specificity and efficiency of gene delivery.

Benefits of technology

This technology enables specific gene expression in cochlear supporting cells and the RPE layer of the retina, improving the flexibility, safety, and cost-effectiveness of gene therapy and providing precise treatment options for otological and ophthalmic diseases.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure HSB0000209493790000011
    Figure HSB0000209493790000011
  • Figure HSB0000209493790000012
    Figure HSB0000209493790000012
  • Figure HSB0000209493790000021
    Figure HSB0000209493790000021
Patent Text Reader

Abstract

This invention relates to the field of biomedicine and discloses a fusion-type adeno-associated virus (AAV) and its applications in ear and eye diseases. The fusion-type AAV comprises a fusion peptide or variant thereof formed by fusing peptides of serotypes AAV1, AAV2, AAV6, and AAV7, which can efficiently infect the RPE layer for the treatment of eye diseases. As a safe vector, the fusion-type AAV has broad application prospects in the treatment of eye diseases.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biomedicine, to a fusion-type adeno-associated virus and its applications, particularly to its applications in the prevention and / or treatment of ear and / or eye diseases. Background Technology

[0002] There are approximately 7,000 known human diseases to date, of which about 80% are caused by genetic issues, affecting more than 300 million people worldwide. Current chemotherapy and protein therapy can only treat fewer than 500 human diseases and are generally ineffective against diseases caused by genetic problems, thus necessitating the development of new drugs and treatments.

[0003] Gene therapy is an emerging treatment method that delivers functional genes into a patient's body to counteract or replace dysfunctional genes, thereby curing diseases without the need for chemotherapy, radiation therapy, or surgery. Gene therapy uses viral or non-viral vectors to introduce genetic material into target cells, treating or preventing diseases by correcting or supplementing defective genes. The therapeutic effects can be long-lasting and do not require repeated interventions. Gene therapy can be implemented using ex vivo or in vivo strategies. Ex vivo gene therapy involves collecting target cells from the patient, genetically modifying them, and then reinfusing them into the patient. In vivo gene therapy involves directly delivering genetic material to the patient's target organs or tissues. Currently, various types of gene delivery strategies have been used to treat a wide range of diseases, including cancer, blindness, immune disorders, and neurological diseases.

[0004] Viral vectors are the most commonly used gene therapy delivery vectors due to their high efficiency in entering cells and introducing genetic material. Commonly used vectors include adenoviruses, retroviruses, lentiviruses, and adeno-associated viruses (AAVs). Currently, AAV vectors have shown promising results in in vivo gene therapy clinical trials, while retroviral and lentiviral vectors are the preferred vectors in in vitro gene therapy clinical trials. The main factors contributing to AAV's success as a therapeutic gene delivery vector are its low immunogenicity and lack of pathogenicity. Multiple drug approvals and ongoing clinical trials demonstrate that AAV vectors have become one of the main gene delivery tools for gene therapy. In 2012, Glybera became the first AAV therapy approved in Europe for the treatment of lipoprotein lipase deficiency. The approval of these drugs clearly demonstrates the safety and efficacy of AAV-based treatments. Subsequently, Luxturna for the treatment of Leber congenital amaurosis and Zolgensma for the treatment of spinal muscular atrophy (SMA) received approval from the U.S. Food and Drug Administration (FDA) in 2017 and 2019, respectively. Current clinical research focuses on treating monogenic diseases through gene replacement, gene silencing, or gene editing. In addition to its potential applications in treating a variety of diseases, including cancer, blindness, immune disorders, and neuronal diseases, AAV also holds promise for vaccine development.

[0005] Although AAVs are characterized by low immunogenicity and low pathogenicity, and AAV-based gene therapies have achieved remarkable success, up to 50% of patients are currently excluded from this treatment due to the pre-existing neutralizing antibodies against the natural AAV capsid protein in the human immune system. To circumvent this immune barrier, engineered AAV capsids can be used to evade pre-existing neutralizing antibodies, or methods can be employed to temporarily clear neutralizing antibodies before treatment. Engineered AAV capsids can not only evade neutralizing antibodies but also target AAVs to the desired tissue and cell types, achieving precision medicine. Directed evolution is a powerful tool for modifying AAV capsids. In principle, directed evolution uses high-throughput techniques to introduce mutations into genes and their encoded proteins, mimicking natural evolution to greatly accelerate protein diversification and selection processes. This method includes three basic steps: establishing a sequence diversification library of the target gene, screening from a protein library encoded by the mutated gene library, and amplifying the gene sequence encoding the desired trait. These three steps constitute one round of directed evolution, which can be iteratively performed in multiple rounds of evolutionary screening until a specific gene / protein with modified properties is obtained.

[0006] However, current methods of using adeno-associated virus (AAV) as a vector for gene therapy in the hearing system still suffer from drawbacks such as poor tissue specificity and low infection efficiency. For example, it is known that AAV vectors infect both hair cells and supporting cells; however, supporting cells and hair cells express different pathogenic genes, and this non-specificity of vector infection has an adverse effect on disease treatment. Therefore, to achieve precision gene therapy, highly efficient and specific novel recombinant AAV vectors are needed. Summary of the Invention

[0007] The purpose of this invention is to overcome the shortcomings of existing technologies and propose a novel adeno-associated virus (AAV) vector capable of efficiently and specifically delivering genes to tissues such as the cochlea and retina for gene therapy. This invention involves in vivo infection of the mouse cochlea with the modified AAV vector, which mediates the specific expression of the target gene in cochlear supporting cells, thereby specifically labeling or manipulating these cells. This novel AAV has broad application value and market prospects in the structural and functional analysis of cochlear supporting cells, disease model establishment, and gene therapy. Furthermore, intravitreal injection of the virus into the mouse eyeball revealed that this viral vector exhibits superior infectivity compared to existing vectors, demonstrating similar broad application value and market prospects in the structural and functional analysis of ophthalmic cells, disease model establishment, and gene therapy.

[0008] One objective of this invention is to provide a fusion-type adeno-associated virus capsid protein comprising fusion peptides of serotypes AAV1, AAV2, AAV6, and AAV7, or variants thereof.

[0009] Another object of the present invention is to provide a nucleic acid that encodes the fusion-type adeno-associated virus capsid protein as described above.

[0010] Another object of the present invention is to provide a construct containing the nucleic acid as described above.

[0011] Another object of the present invention is to provide a host cell comprising the constructs described above or having exogenous nucleic acids as described above integrated into its genome, or the host cell comprising a fusion adeno-associated virus as described above.

[0012] Another object of the present invention is to provide a fusion adeno-associated virus, wherein the capsid structure of the fusion adeno-associated virus contains the fusion adeno-associated virus capsid protein as described in any of the preceding claims.

[0013] Host cells transformed with the fusion-type adeno-associated virus as described above.

[0014] Another object of the present invention is to provide a fusion-type adeno-associated virus vector system comprising a packaging plasmid containing nucleic acid or nucleic acid fragments as described above.

[0015] Another object of the present invention is to provide a fusion-type adeno-associated virus, obtained by viral packaging from the fusion-type adeno-associated virus vector system described above.

[0016] Another object of the present invention is to provide a pharmaceutical composition comprising a fusion adeno-associated virus as described in any of the preceding claims and pharmaceutically acceptable excipients.

[0017] Another object of the present invention is to provide the use of the fusion adeno-associated virus capsid protein, nucleic acid, construct, fusion adeno-associated virus, host cell, fusion adeno-associated virus vector system, pharmaceutical composition or conjugate as described above in the preparation of a medicament for treating diseases; preferably, in the preparation of a medicament for gene therapy of diseases.

[0018] Compared with the prior art, the present invention has the following advantages and beneficial effects: (1) It provides a novel adeno-associated virus vector specific to supporting cells, which can mediate the specific expression of the target gene in the supporting cells of the cochlea of ​​newborn mice; (2) It provides a novel adeno-associated virus vector, which can mediate the specific expression of the target gene in the hair cells of the cochlea of ​​adult mice; (3) It provides a novel adeno-associated virus vector, which can mediate the specific expression of the target gene in the RPE layer of the retina of adult mice; (4) The novel adeno-associated virus vector mediates the expression of the target gene more flexibly, with higher safety, more convenient application, and lower cost than the traditional transgenic method; (5) The novel specific adeno-associated virus vector makes it possible to develop gene therapies for the precise treatment of otological and ophthalmic diseases. Attached Figure Description

[0019] Figure 1 The in vivo screening process for DNA family truncation libraries is illustrated.

[0020] Figure 2 A computer-simulated diagram of the AAV-M9 structure is shown.

[0021] Figure 3 The infection characteristics of adeno-associated virus in newborn mice are shown. Figure 3 Image a shows an immunochromatogram of green fluorescent protein (EGFP) and hair cell-specific marker protein Myo7a after AAV-ie and AAV-M9 were injected into the cochlea of ​​newborn mice. The image was taken 14 days later and the cochlear tissue was dissected. The image shows the hair cell layer. Figure 3Image b shows an immunochromatogram of green fluorescent protein (EGFP) and hair cell-specific marker protein Myo7a after AAV-ie and AAV-M9 were injected into the cochlea of ​​newborn mice. The images were taken 14 days later and were then dissected. The images were taken at the supporting cell level. Figure 3 c shows the pair Figure 3 Statistical results of data on hair cells and Dieterscells in a, 3b.

[0022] Figure 4 The safety of adeno-associated virus in newborn mice was demonstrated. Figure 4 Image a shows an immunostaining photograph of cochlear tissue extracted 14 days after AAV-M9 was injected into the cochlea of ​​a newborn mouse, and the hair cell-specific marker protein Myo7a after cochlear dissection in a normal mouse. Figure 4 b shows the... Figure 4 Statistical results of data on outer and inner hair cells.

[0023] Figure 5 The infection characteristics of adeno-associated virus in adult mice are shown. Figure 5 Image a shows an immunostaining image of green fluorescent EGFP and hair cell-specific marker protein Myo7a after cochlear tissue was removed and dissected 14 days after AAV-ie and AAV-M9 were injected into the cochlea of ​​adult mice. Figure 5 b shows the... Figure 5 Statistical results of data on outer and middle hair cells. Figure 5 c shows the pair Figure 5 Statistical results of data on inner hair cells in a.

[0024] Figure 6 The safety of adeno-associated virus in adult mice was demonstrated. Figure 6 Image a shows an immunostaining photograph of cochlear tissue extracted 14 days after AAV-M9 was injected into the cochlea of ​​an adult mouse, and of the hair cell-specific marker protein Myo7a after cochlear dissection in a normal mouse. Figure 6 b shows the... Figure 6 Statistical results of data on outer and inner hair cells.

[0025] Figure 7 The infection status of AAV-M9-CMV-EGFP in the RPE layer of the eyeball is shown.

[0026] Figure 8 The eye transfection characteristics of AAV-M9-CMV-EGFP in non-human primates are shown. Detailed Implementation

[0027] The following specific examples illustrate the implementation of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention.

[0028] The present invention provides a fusion-type adeno-associated virus capsid protein, wherein the capsid protein comprises a peptide (fusion peptide or chimeric peptide) formed by fusing peptides of serotypes AAV1, AAV2, AAV6 and AAV7, or a variant thereof.

[0029] In some preferred embodiments, in the fusion adeno-associated virus capsid protein, the fusion peptide comprises a first peptide, a second peptide, a third peptide, a fourth peptide, and a fifth peptide connected in sequence; the first peptide comprises a peptide from AAV1, the second peptide comprises a peptide from AAV7, the third peptide comprises a peptide from AAV2, the fourth peptide comprises a peptide from AAV1, and the fifth peptide comprises a peptide from AAV6. Preferably, the first peptide segment comprises amino acid fragments from position 1 to position 262 of SEQ ID No:2 (SEQ ID NO:3), the second peptide segment comprises amino acid fragments from position 263 to position 325 of SEQ ID No:2 (SEQ ID NO:4), the third peptide segment comprises amino acid fragments from position 326 to position 417 of SEQ ID No:2 (SEQ ID NO:5), the fourth peptide segment comprises amino acid fragments from position 418 to position 583 of SEQ ID No:2 (SEQ ID NO:6), the fifth peptide segment comprises amino acid fragments from position 584 to position 736 of SEQ ID No:2 (SEQ ID NO:7), and the fusion adeno-associated virus capsid protein contains an S430I mutation.

[0030] Table 1. Sequence Information

[0031]

[0032]

[0033] In the fusion-type adeno-associated virus capsid protein of the present invention, the peptide segments are directly fused together.

[0034] In the fusion-type adeno-associated virus capsid protein of the present invention, the peptides of serotypes AAV1 and AAV6 assemble into triple-symmetry axis protrusions of the capsid protein; the peptides of serotypes AAV2, AAV6, and AAV7 assemble into five-symmetry axis channels of the capsid protein; and the peptide of serotype AAV6 forms a depression at the double-symmetry axis of the capsid protein. A computer simulation structural diagram is shown below. Figure 2 As shown.

[0035] Under an electron microscope, the nucleocapsid of adeno-associated virus (AAV) is generally nearly circular. This nearly circular capsid is actually a closed, icosahedral, hollow capsid composed of multiple protein capsomeres, within which the genomic nucleic acid is enclosed. An icosahedral symmetry structure contains three types of rotational symmetry: 3-fold, 2-fold, and 5-fold symmetry. That is, this symmetrical three-dimensional structure has a 3-fold symmetry axis passing through the center points of two opposite faces of the virus particle, with the capsomeres rotating 120° around the 3-fold symmetry axis three times to reset, forming triangular faces; it has a 2-fold symmetry axis (edge), with the capsomeres rotating 180° around the 2-fold symmetry axis twice to reset, forming two intersecting triangular faces; and it also has a 5-fold symmetry axis passing through two opposite vertices, with the capsomeres rotating 72° around the 5-fold symmetry axis five times to reset, forming a pentamel. Therefore, the icosahedral symmetric shell is composed of 20 equilateral triangular faces, of which every two triangular faces intersect to form edges, for a total of 30 edges; every five triangular faces connect to form 12 vertices.

[0036] In some preferred embodiments, the capsid protein comprises:

[0037] The amino acid sequence shown in SEQ ID No:2;

[0038] A polypeptide fragment having more than 90% sequence identity with SEQ ID No:2 and having the function of the amino acid sequence shown in SEQ ID No:2.

[0039] Specifically, the polypeptide fragment in b) refers to a polypeptide fragment obtained by substituting, deleting, or adding one or more amino acids (specifically, 1-50, 1-30, 1-20, 1-10, 1-5, 1-3, 1, 2, or 3) of the amino acid sequence shown in SEQ ID No:2, or obtained by adding one or more amino acids (specifically, 1-50, 1-30, 1-20, 1-10, 1-5, 1-3, 1, 2, or 3) to the N-terminus and / or C-terminus, and having the function of the polypeptide fragment with the amino acid sequence shown in SEQ ID No:2. The amino acid sequence in b) may have 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more sequence identity with SEQ ID No:2.

[0040] In some preferred embodiments, the nucleic acid sequence of the gene encoding the capsid protein comprises the nucleotide sequence shown in SEQ ID No:1. Preferably, the nucleic acid sequence of the gene encoding the capsid protein is as shown in SEQ ID No:1. In some preferred embodiments, the nucleic acid sequence of the gene encoding the capsid protein comprises a nucleotide sequence having a sequence identity of 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more with SEQ ID No:1.

[0041] The present invention also provides a nucleic acid that encodes the fusion-type adeno-associated virus capsid protein as described above.

[0042] The present invention also provides a construct containing the aforementioned nucleic acid. The construct can typically be obtained by inserting the aforementioned nucleic acid into a suitable expression vector, and those skilled in the art can select a suitable expression vector.

[0043] The present invention also provides a host cell comprising the above-described construct or genome in which exogenous nucleic acids described above are integrated, or the host cell comprises a fusion adeno-associated virus as described in any of the preceding claims.

[0044] Representative examples of suitable host cells include mammalian cells (such as CHO or COS), plant cells, human cells (human embryonic kidney cells such as HEK293FT), bacterial cells (such as Escherichia coli, Streptomyces, and Salmonella typhimurium), fungal cells (such as yeast), and insect cells (such as Sf9). Those skilled in the art can select a suitable host based on the teachings herein. Preferably, the host cell is an animal cell, and more preferably a human cell. The host cell can be a cultured cell or a primary cell, i.e., directly isolated from an organism (such as a human). The host cell can be an adhesive cell or a suspension cell, i.e., a cell growing in suspension.

[0045] The present invention also provides a fusion adeno-associated virus, wherein the fusion adeno-associated virus contains the fusion adeno-associated virus capsid protein as described in any of the preceding claims.

[0046] Furthermore, the fusion-type adeno-associated virus also includes a heterologous nucleotide sequence encoding the target product, which can be carried by various capsid proteins. The heterologous nucleotide sequence encoding the target product is typically a construct, which usually contains nucleic acid encoding the target product. The construct is typically obtained by inserting the nucleic acid encoding the target product into a suitable expression vector. Those skilled in the art can select suitable expression vectors; for example, the expression vectors may include, but are not limited to, pAAV-CAG, pAAV-TRE, pAAV-EF1a, pAAV-GFAP promoter, pAAV-Lgr5 promoter, and pAAV-Sox2 promoter expression vectors. In this invention, when the fusion-type adeno-associated virus encodes a heterologous nucleotide sequence of the target product, the fusion-type adeno-associated virus contains a capsid, and the viral vector carries a transgene encoding the gene product, which is regulated by a regulatory sequence guiding its expression in the host cell; in some preferred embodiments, the amino acid sequence of the capsid protein is shown in SEQ ID NO:2.

[0047] Furthermore, the target product can be a nucleic acid or a protein, wherein the nucleic acid includes, but is not limited to, small guide RNA (sgRNA), interfering RNA (RNAi), etc., and the protein encoding gene includes, but is not limited to, Prestin and Atoh1.

[0048] The fusion-type adeno-associated virus can be used as a vector material to introduce exogenous genes into the cells of test individuals. Compared with adeno-associated viruses such as AAV-ie, the fusion-type adeno-associated virus can specifically infect the supporting cells of juvenile individuals and specifically infect the inner hair cells of adult individuals.

[0049] The present invention also provides an engineered host cell obtained by transformation using the fusion-type adeno-associated virus as described above. The engineered host cell comprises the aforementioned fusion-type adeno-associated virus. The host cell may be a eukaryotic cell and / or a prokaryotic cell.

[0050] Representative examples of suitable host cells include mammalian cells (such as CHO or COS), plant cells, human cells (human embryonic kidney cells such as HEK293FT), bacterial cells (such as Escherichia coli, Streptomyces, and Salmonella typhimurium), fungal cells (such as yeast), and insect cells (such as Sf9). Those skilled in the art can select a suitable host based on the teachings herein. Preferably, the host cell is an animal cell, and more preferably a human cell. The host cell can be a cultured cell or a primary cell, i.e., directly isolated from an organism (such as a human). The host cell can be an adhesive cell or a suspension cell, i.e., a cell growing in suspension.

[0051] The present invention also provides a fusion-type adeno-associated virus vector system, the vector system comprising a packaging plasmid containing nucleic acid or nucleic acid fragments as described above.

[0052] Furthermore, the packaging plasmid also contains a fragment of the adeno-associated virus (AAV) rep gene. The rep gene fragment contains introns, and the introns contain transcription termination sequences.

[0053] Furthermore, the adeno-associated virus vector system further includes an expression plasmid containing heterologous nucleotides responsible for encoding the target product. Furthermore, the target product can be a nucleic acid or a protein, wherein the nucleic acid includes, but is not limited to, small guide RNA (sgRNA), interfering RNA (RNAi), etc., and the protein-coding gene includes, but is not limited to, Prestin and Atoh1.

[0054] Furthermore, the adeno-associated virus vector system further includes helper viral plasmids or helper viruses. Furthermore, the adeno-associated virus vector system further includes host cells.

[0055] This invention involves transferring the packaging plasmid, expression plasmid, and helper virus plasmid into a host cell, where all nucleic acid sequences are integrated into the host cell to produce the fusion-type adeno-associated virus. In some embodiments, all nucleic acid sequences are integrated together at a single locus within the host cell's genome. In some embodiments, the nucleic acid sequences encoding various genes exist as separate expression cassettes, preventing any risk of recombination leading to the formation of a replicating virus; the nucleic acid sequences encoding the rep and cap genes are contained within the same expression cassette.

[0056] The present invention also provides a fusion-type adeno-associated virus, obtained by viral packaging from the fusion-type adeno-associated virus vector system described above.

[0057] The present invention also provides a pharmaceutical composition comprising the fusion adeno-associated virus as described above and pharmaceutically acceptable excipients. The fusion adeno-associated virus or pharmaceutical composition provided by the present invention can be adapted to suitable routes of administration, such as injection into the cochlea, eye, muscle, nervous system, or circulatory system. Those skilled in the art can select appropriate dosages based on the route of administration.

[0058] The excipients may include various excipients and diluents, which are not essential active ingredients themselves and do not cause excessive toxicity after application. Suitable excipients should be well known to those skilled in the art. Acceptable carriers include, for example, sterile water or saline solution, stabilizers, excipients, antioxidants (ascorbic acid, etc.), buffers (phosphate, citric acid, other organic acids, etc.), preservatives, surfactants (PEG, Tween, etc.), chelating agents (EDTA, etc.), binders, etc. Furthermore, they may also contain other low molecular weight peptides; proteins such as serum albumin, gelatin, or immunoglobulins; amino acids such as glycine, glutamine, asparagine, arginine, and lysine; sugars or carbohydrates such as polysaccharides and monosaccharides; and sugar alcohols such as mannitol or sorbitol. When preparing aqueous solutions for injection, such as physiological saline, isotonic solutions containing glucose or other adjuvant drugs, such as D-sorbitol, D-mannose, D-mannitol, sodium chloride, appropriate solubilizers such as alcohols (ethanol, etc.), polyols (propylene glycol, PEG, etc.), and nonionic surfactants (Tween 80, HCO-50, etc.) may be used.

[0059] In the pharmaceutical composition provided by this invention, the fusion-type adeno-associated virus (AAV-M9) can be a single active ingredient, or it can be combined with one or more other active ingredients useful for the treatment of hearing impairment or eye diseases to form a combined formulation. The other active ingredients can be various other drugs that can be used to treat hearing impairment or eye diseases. The content of the active ingredient in the composition is generally a safe and effective amount, which should be adjustable by those skilled in the art. For example, the dosage of the active ingredient in the fusion adeno-associated virus AAV-M9 and pharmaceutical composition generally depends on the patient's weight, the type of application, the condition and severity of the disease. For example, the dosage of the bifunctional compound as the active ingredient can generally be 1-1000 mg / kg / day, 1-3 mg / kg / day, 3-5 mg / kg / day, 5-10 mg / kg / day, 10-20 mg / kg / day, 20-30 mg / kg / day, 30-40 mg / kg / day, 40-60 mg / kg / day, 60-80 mg / kg / day, 80-100 mg / kg / day, 100-200 mg / kg / day, 200-500 mg / kg / day, or greater than 500 mg / kg / day.

[0060] The present invention also provides a conjugate comprising the fusion adeno-associated virus AAV-M9 or a linked bioactive polypeptide as described above.

[0061] The present invention also provides the use of the above-mentioned fusion adeno-associated virus AAV-M9 capsid protein, nucleic acid, construct, fusion adeno-associated virus AAV-M9, host cell, fusion adeno-associated virus vector system, pharmaceutical composition or conjugate in the preparation of medicaments for the prevention and / or treatment of diseases; preferably, the use in the preparation of medicaments for the prevention and / or gene therapy of diseases; the diseases include, but are not limited to, one or more of hearing impairment diseases, ophthalmic diseases, inflammation, tumors, metabolic diseases, pain, neurodegenerative inflammatory diseases, etc.

[0062] The hearing impairment diseases mentioned are selected from hearing loss, deafness, and tinnitus.

[0063] The ophthalmic diseases shown include, but are not limited to, dry AMD, wet AMD, or choroidal neovascularization (CNV); for example, they may be selected from age-related macular degeneration (AMD), choroidal neovascularization (CNV), choroidal neovascular membrane (CNVM), cystoid macular edema (CME), epiretinal membrane (ERM), and macular hole; myopia-related choroidal neovascularization, vascular streaks, retinal detachment, diabetic retinopathy, diabetic macular edema (DME), atrophic lesions of retinal pigment epithelial cells (RPE), hypertrophic lesions of retinal pigment epithelial cells (RPE), and retinal diseases. Retinal vein occlusion, choroidal retinal vein occlusion, macular edema; corneal angiogenesis due to hypoxia, pterygium conjunctiva, subretinal edema and intraretinal edema; macular edema due to retinal vein occlusion, retinitis pigmentosa, Sturgeon's disease, glaucoma, inflammatory diseases, cataracts, refractory abnormalities, keratoconus, retinopathy of prematurity, anterior segment angiogenesis, post-keratitis corneal angiogenesis, one or more of the following: corneal transplantation or keratoplasty; congenital amaurosis (LCA), retinitis pigmentosa, Stargardt's disease, etc., caused by RPE cell-related gene mutations. In some preferred embodiments, the ophthalmic disease refers to RPE layer-related diseases, meaning that gene therapy for ophthalmic diseases can be achieved by infecting the RPE layer with a virus.

[0064] The inflammation is selected from skin inflammation, vasculitis, allergic reaction, autoimmune disease, fibrosis, scleroderma, or graft rejection; the autoimmune disease is selected from one or more of rheumatoid arthritis, systemic sclerosis, systemic lupus erythematosus, xerostomia syndrome, polymyositis, etc.

[0065] The cancers mentioned are selected from lymphomas, hematologic malignancies, or solid tumors; specifically, they are selected from adrenocortical carcinoma, bladder urothelial carcinoma, breast cancer, cervical squamous cell carcinoma, cervical endogenous adenocarcinoma, bile duct carcinoma, colonic adenocarcinoma, lymphoid tumors, diffuse large B-cell lymphoma, esophageal cancer, glioblastoma multiforme, head and neck squamous cell carcinoma, renal chromophobe carcinoma, renal clear cell carcinoma, renal papillary cell carcinoma, acute myeloid leukemia, low-grade glioma of the brain, hepatocellular carcinoma, lung adenocarcinoma, lung squamous cell carcinoma, mesothelial cell carcinoma, and oocytes. One or more of the following tumor cells: ovarian cancer, pancreatic cancer, pheochromocytoma and paraganglioma, prostate cancer, rectal cancer, malignant sarcoma, melanoma, gastric cancer, testicular germ cell tumor, thyroid cancer, thymic cancer, endometrial cancer, uterine sarcoma, uveal melanoma, multiple myeloma, acute lymphoblastic leukemia, chronic lymphoblastic leukemia, chronic myeloid leukemia, T-cell lymphoma, and B-cell lymphoma; preferably, the tumor is one or more of colorectal cancer and / or melanoma.

[0066] The metabolic diseases are selected from diabetes, including type I and type II diabetes, as well as diseases and conditions related to diabetes; the metabolic diseases include, but are not limited to, one or more of the following: atherosclerosis, cardiovascular disease, nephropathy, neuropathy, retinopathy, β-cell dysfunction, dyslipidemia, hyperglycemia, insulin resistance, chronic obstructive pulmonary disease, etc.

[0067] In some preferred embodiments, the gene therapy refers to the treatment of hearing impairment. The fusion-type adeno-associated virus or pharmaceutical composition can achieve the treatment of hearing impairment by delivering the target product to the hair cells and / or supporting cells of an individual.

[0068] In the use of the fusion-type adeno-associated virus (AAV-M9), host cells, vector systems, pharmaceutical compositions, or conjugates described in this invention for delivering a target product to hair cells and / or supporting cells of an individual, the delivery of the target product may be for non-diagnostic or therapeutic purposes, for example, it may be in vitro, delivering the target product to isolated hair cells and / or supporting cells. The hair cells typically include outer hair cells and / or inner hair cells; preferably, the hair cells are inner hair cells of an adult individual.

[0069] Furthermore, the target product is a nucleic acid or a protein, and the nucleic acid can be a small guide RNA (sgRNA), interfering RNA (RNAi), etc.

[0070] In this invention, the hearing impairment can be caused by cochlear damage due to environmental factors. Therefore, this invention also provides the use of the aforementioned fusion-type adeno-associated virus in a medicament for treating environmentally induced hearing impairment in individuals.

[0071] Further, the hearing impairment is a hair cell and / or supporting cell-related disease. In some preferred embodiments, for juvenile individuals, the hearing impairment is preferably a supporting cell-related disease. In some preferred embodiments, for adult individuals, the hearing impairment is preferably an inner hair cell-related disease. In some preferred embodiments, the hearing impairment is prevented or treated by inducing inner hair cell regeneration. In another preferred embodiment, the hearing impairment is prevented or treated by overexpressing Wnt2b and Atoh1 to induce inner hair cell regeneration.

[0072] Furthermore, the hearing impairment disease is a disease related to gene defects, environmental damage, or aging. For example, it may be a disease caused by gene mutations, or a disease caused by noise or drugs, or a disease caused by aging.

[0073] Furthermore, hearing impairment can be related to cell damage, specifically cochlear hair cell damage, supporting cell damage, etc. More specifically, it can be cochlear hair cell damage caused by gene mutation, supporting cell damage caused by gene mutation, noise-induced cell damage, drug-induced cell damage, or cell damage caused by aging.

[0074] Furthermore, the fusion-type adeno-associated virus serves as a vector for delivering the target product.

[0075] The present invention also provides a method for treating hearing impairment, the method comprising administering to a subject in need an effective amount of the fusion-type adeno-associated virus, the host cell, the vector system, or a pharmaceutical composition or conjugate described herein. Typically, physicians can determine the most suitable practical dose for a single patient, and this dose varies depending on the individual's age, weight, and response.

[0076] In this invention, the fusion adeno-associated virus, host cell, vector system, or pharmaceutical composition of this invention can be administered to a patient. Those skilled in the art can determine the appropriate route of administration and dosage.

[0077] The fusion-type adeno-associated virus described in this invention delivers one or more therapeutic genes, which can be used alone or in combination with other therapeutic methods or components.

[0078] The fusion-type adeno-associated virus of the present invention is used to infect cells, thereby delivering genes and / or linked (e.g., but not limited to, covalently linked) bioactive polypeptides into the cells. Therefore, the present invention provides a method for delivering transgenes into cells, the method being used to infect cells by introducing one or more fusion-type adeno-associated viruses or conjugates of the present invention into the cells, wherein the fusion-type adeno-associated virus or conjugate comprises one or more transgenes.

[0079] The present invention also provides a method for producing a stable production cell line of a fusion-type adeno-associated virus vector, comprising:

[0080] The fusion-type adeno-associated virus vector as defined herein is introduced into a culture of mammalian host cells; and mammalian host cells having a nucleic acid sequence encoded on the vector integrated into the endogenous chromosome of the mammalian host cells are selected within the culture.

[0081] The AAV vector production cells are mammalian cells. In some embodiments, the mammalian cells are selected from HEK293 cells, CHO cells, Jurkat cells, K562 cells, PerC6 cells, HeLa cells, or derivatives thereof. In some embodiments, the mammalian host cell is a HEK293 cell or a cell derived from a HEK293 cell. In some embodiments, the HEK293 cell is a HEK293T cell.

[0082] The genomic sequences of various serotypes of AAV, as well as the sequences of the native ITR, Rep protein, and capsid protein, are known in the art. These sequences are available in the literature or in public databases such as GenBank. Their publications are incorporated herein by reference for the AAV nucleic acid and amino acid sequences.

[0083] In the compounds of this invention and their applications, when the fusion-type adeno-associated virus is used in combination with other therapeutic agents, the active compound is administered co-administered with the other therapeutic agents. "Co-administered" means administered simultaneously in the same formulation or in two different formulations via the same or different routes, or administered sequentially via the same or different routes. "Sequentially administered" means that there is a time difference, measured in seconds, minutes, hours, or days, between the administration of two or more different compounds.

[0084] In some embodiments, the fusion-type adeno-associated virus and its method of the present invention can be used to prevent hearing loss, and can be administered as a preventive treatment before hearing loss or some time after exposure to an environment that may cause hearing loss.

[0085] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those familiar to those skilled in the art.

[0086] The term "vector" refers to a macromolecule or combination of macromolecules containing or bound to a polypeptide and used to mediate the delivery of the polypeptide to cells. Illustrative vectors include, for example, plasmids, viral vectors, liposomes, or other gene delivery vectors.

[0087] The term "AAV" is an abbreviation for adeno-associated virus and can be used to refer to the virus itself or its derivatives.

[0088] The term "recombinant AAV vector" refers to an AAV vector containing a heterologous polynucleotide sequence, typically the sequence of interest for genetically transformed cells. Generally, the heterologous polynucleotide is flanked by at least one, usually two, AAV terminal inverted repeat (ITR) sequences.

[0089] The terms “AAV virus” or “AAV virus particle” or “AAV vector particle” refer to a viral particle containing at least one AAV capsid protein and an AAV vector encapsulating a polynucleotide.

[0090] The term "packaging" refers to a series of intracellular processes that lead to the assembly and encapsulation of AAV particles.

[0091] The terms AAV "rep" and "cap" refer to the polynucleotide sequences encoding the replication and packaging proteins of adeno-associated virus (AAV). In this text, AAV rep and cap refer to the AAV "packaging genes".

[0092] The term "helper virus" in AAV refers to a virus that enables AAV to be replicated and packaged by mammalian cells. Various such AAV helper viruses are known in the art, including adenoviruses, herpesviruses, and poxviruses (e.g., cowpox).

[0093] The term "infectious" virus or viral particle refers to a virus that is tropism-dependent on cells that can deliver polynucleotide components into the virus species. This term does not imply any replication capability of the virus.

[0094] The term "production cell" refers to a cell line that has AAV packaging genes (rep and cap genes) stably integrated into the host cell genome, the required helper viral genes, and the DNA genome of a recombinant AAV vector (e.g., a target transgene flanked by two AAV inverted terminal repeats (ITRs)).

[0095] The terms “include” and “contain” should be understood as inclusive, without the meaning of exclusivity or exhaustion; that is, “including but not limited to”.

[0096] The term "individual" generally includes humans and non-human primates such as mammals, dogs, cats, horses, sheep, pigs, cattle, etc., who may benefit from treatment using the said formulation, kit, or combination formulation.

[0097] The term "therapeutic effective dose" generally refers to a dose that, after an appropriate period of administration, is effective in treating the diseases listed above.

[0098] The terms "therapeutic" and "preventative" should be understood in their broadest sense. The term "therapeutic" does not necessarily imply that a mammal receives treatment until it is fully recovered. Similarly, "preventative" does not necessarily mean that the subject will ultimately not contract the disease. Therefore, treatment and prevention include alleviating the symptoms of a specific condition or preventing or reducing the risk of developing a specific condition. The term "prevention" can be understood as reducing the severity of a specific condition's onset. Treatment can also reduce the severity of an existing condition or the frequency of acute attacks.

[0099] In this invention, the object or individual for therapeutic or preventative treatment is preferably a mammal, such as, but not limited to, humans, primates, livestock (e.g., sheep, cattle, horses, donkeys, pigs), pets (e.g., dogs, cats), laboratory test animals (e.g., mice, rabbits, rats, guinea pigs, hamsters), or captured wild animals (e.g., foxes, deer). The object is preferably a primate. The most preferred object is a human.

[0100] Before further describing specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terminology used in the embodiments of the present invention is for describing specific embodiments and not for limiting the scope of protection of the present invention; in the specification and claims of the present invention, unless otherwise expressly stated in the text, the singular forms "a", "an" and "this" include the plural forms.

[0101] When numerical ranges are given in the embodiments, it should be understood that, unless otherwise stated in the present invention, both endpoints of each numerical range and any value between the two endpoints may be selected. Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art. In addition to the specific methods, apparatus, and materials used in the embodiments, based on the knowledge of the prior art possessed by one of ordinary skill in the art and the description of this invention, any prior art methods, apparatus, and materials similar to or equivalent to those described, apparatus, and materials in the embodiments of this invention may be used to implement the present invention.

[0102] Unless otherwise stated, the experimental methods, detection methods, and preparation methods disclosed in this invention all employ conventional techniques in molecular biology, biochemistry, chromatin structure and analysis, analytical chemistry, cell culture, recombinant DNA technology, and related fields. These techniques have been well described in existing literature.

[0103] Example 1. Obtaining a novel adeno-associated virus (AAV-M9) (also known as AAV-WM01)

[0104] a. Construction of DNA family reorganization library

[0105] The capsid sequences of 13 AAV serotypes (AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, and AAV13) found in humans and non-human primates were used as parents for DNA family shuffling. A total of 4 μg of parental capsid sequences were mixed in equimolar ratios for DNA family shuffling and treated with 0.04 U of DNase I at 25°C for 30 seconds to randomly fragment the intact parental capsid sequences into fragments of different lengths. DNA fragments of 100-500 bp were recovered and purified, and 500 ng of each fragment was used for primerless PCR to extend them into complete chimeric capsid sequences. After obtaining sufficient chimeric capsid sequences, the chimeric capsid sequences were recombined into a library vector containing the AAV2Rep gene and terminal repeat sequences. The recombinant product was electroporated into competent cells. A portion of the bacterial culture was plated, and the colonies that grew on the plates were counted and identified by sequencing to determine their diversity. The remaining bacterial culture was inoculated into 500 mL of culture medium and incubated overnight at 37°C. The plasmid extracted the next day was the DNA family shuffle library plasmid. The in vivo screening procedure for the DNA family shuffle library is as follows: Figure 1 As shown.

[0106] b. Packaging of DNA family reorganization library viruses

[0107] The obtained DNA family shuffle library plasmid and adenovirus helper plasmid pHelper were co-transfected into HEK-293T cells in appropriate amounts. The pHelper plasmid (the full sequence of which is identical to SEQ ID NO:12 of AAV-ie patent document CN110437317A) was used to transfect cells in each 15cm dish with only 20 ng of the DNA family shuffle library plasmid.

[0108] Culture medium was collected 72 hours after transfection, and cells and culture medium were collected again 48 hours later. Cells were lysed with 110 mM citrate buffer (pH 4.2) to release AAV. After centrifugation, the virus-containing supernatant was neutralized with 1 / 5 volume of 2 M HEPES, and then polyethylene glycol 8000 and 500 mM sodium chloride were added to a final concentration of 8%. The mixture was incubated overnight at 4°C to precipitate the virus. After centrifugation, the precipitate was resuspended in a solution containing 2 mM MgSO4. 2+The virus suspension was added to PBS with benzonase at a final concentration of 100 U / mL and digested at 37°C for at least 1 hour. The virus suspension was purified by ultracentrifugation using iodixanol density gradient solutions (15%, 25%, 40%, and 60%). The viral titer was then determined by qPCR using AAV2Rep gene-specific primers (WPRE-F: GTCAGGCAACGTGGCGTGGTGTG (SEQ ID NO. 8); WPRE-R: GGCGATGAGTTCCGCCGTGGC (SEQ ID NO: 9)).

[0109] c. In vivo screening

[0110] We screened for novel adeno-associated viruses that can efficiently infect cochlear cells by injecting them into the cochlea of ​​mice in vivo.

[0111] Approximately 1E+10–11 vg of viral library was injected into the cochlea of ​​2–3 day old mice through a round window. Seven to ten days later, the mice were euthanized, and the cochleas were collected. At this point, AAVs in the viral library capable of infecting cochlear cells entered the cells, while AAVs that failed to infect cells were cleared by the immune and circulatory systems. Therefore, this invention allows the recovery of the capsid gene of AAVs infecting cells from total DNA in tissue cells. Total DNA was extracted from tissues using Trizol, and the AAV capsid gene was recovered from the total DNA using PCR, completing the first in vivo screening of the AAV library. The fragment obtained from PCR was cloned into a library vector to obtain the next round of library plasmids, which were then repackaged into viruses. This in vivo screening process can be repeated. After 3–5 rounds of screening, the recovered AAV capsid genes were subjected to third-generation sequencing. This yielded information on some AAV mutant capsid genes enriched in cochlear cells, among which some highly abundant mutant AAVs theoretically could efficiently transduce cochlear cells. Among them, AAV-M9, as shown in SEQ ID NO:1, is one of the high-abundance mutants.

[0112] Sequencing results showed that AAV-M9 is a chimeric structure of AAV1, 2, 6, and 7, and contains an S430I mutation. 3D homology modeling of the AAV-M9 capsid was generated using residues in its VP3 region, based on amino acid sequence alignment with its parental serotype. Both the inner (B) and outer (C) surfaces of the capsid showed the presence of capsid fragments from the four parental AAVs, indicating that the triple symmetry axis protrusions of AAV-M9 are composed of AAV1 and AAV6, AAV2, 6, and 7 assemble into a five-fold symmetry axis channel, and AAV6 forms a depression at the double symmetry axis. Figure 2 The sequence of the coding gene for AAV-M9 is shown in SEQ ID No:1, and the amino acid sequence is shown in SEQ ID No:2. A computer-simulated structural diagram of AAV-M9 is shown below. Figure 2 As shown.

[0113] Example 2: In vivo validation of novel adeno-associated virus AAV-M9-CMV-EGFP in the hearing system

[0114] 2.1 Construction of adeno-associated virus AAV-M9-CMV-EGFP

[0115] The sequence of the AAV-M9 encoding gene obtained from the above sequencing results was synthesized by Suzhou Genewiz Biotechnology Co., Ltd., resulting in the AAV-M9 Rep-Cap plasmid, pAAV-M9. The obtained AAV-M9 Rep-Cap plasmid pAAV-M9 was then co-transfected with a green fluorescent protein (EGFP) genomic plasmid, pAAV-CMV-EGFP, and the pHelper plasmid was co-transfected into HEK-293T cells at an appropriate amount. The AAV virus was purified using iododialkylol gradient ultracentrifugation, and the viral titer was measured to be within the range of 1E+12-1E+13 GC / mL for optimal concentration. The cells were then stored at -80℃ for later use.

[0116] 2.2 Infection characteristics of adeno-associated virus (AAV-M9-CMV-EGFP) in newborn mice

[0117] AAV-ie and AAV-M9-CMV-EGFP of the same titer were injected into the cochlea of ​​2-3 day old C57BL / 6J mice through a round window. After 10-14 days of sufficient viral infection and EGFP expression, the mice were euthanized by cervical dislocation, and the cochlea from the injected ear was removed and fixed in 4% paraformaldehyde at room temperature for 2 hours. The ears were washed three times with PBS for 5 minutes each time. Then, the ears were decalcified with 0.5 mM EDTA and soaked at room temperature for 2 hours to soften the cochlea. The basement membrane was dissected using an ophthalmic scalpel under a stereomicroscope. Hair cells were labeled with anti-Myo7a antibody using immunofluorescence staining to prepare cochlear samples. The samples were imaged using a laser confocal scanning microscope; the virus-infected cells expressed green fluorescent protein in their nuclei. The excitation wavelengths were 488 nm and 647 nm. In vivo detection results are as follows: Figure 3 As shown in a, 3b. Figure 3 a is a cochlear patch at the hair cell level after injection of AAV-ie and AAV-M9-CMV-EGFP viruses; Figure 3 b is a cochlear patch at the supporting cell level after injection of AAV-ie and AAV-M9-CMV-EGFP viruses; in the image, purple indicates Myo7a, a marker protein of hair cells, and green indicates fluorescent proteins expressed in virus-infected cells. Figure 3c represents statistical data on hair cells and Dieters Cells (a type of supporting cell) caused by AAV-ie and AAV-M9-CMV-EGFP viruses. The results indicate that AAV-M9-CMV-EGFP specifically infects supporting cells in the cochlea of ​​young mice, but does not infect hair cells. Dieters Cells are considered to be the supporting cells with the greatest regenerative potential; therefore, AAV-M9 has great potential in gene therapy for supporting cells and hair cell regeneration.

[0118] 2.3 Safety of adeno-associated virus (AAV-M9-CMV-EGFP) in newborn mice

[0119] AAV-M9-CMV-EGFP was injected into the cochlea of ​​2-3 day old C57BL / 6J mice through a round window. After 10-14 days of sufficient viral expression, the mice were euthanized by cervical dislocation, and the cochlea from the injected ear was removed. Cochlea from age-matched C57BL / 6J mice served as controls. The cochleas were fixed in 4% paraformaldehyde at room temperature for 2 hours. They were then washed three times with PBS for 5 minutes each time. Next, they were decalcified with 0.5 mM EDTA and soaked at room temperature for 2 hours to soften the cochlea. The basement membrane was dissected using an ophthalmic scalpel under a stereomicroscope. Hair cells were labeled with anti-Myo7a antibody using immunofluorescence staining to prepare cochlear samples. Imaging was performed using a laser confocal scanning microscope; virus-infected cells expressed green fluorescent protein in their nuclei. In vivo detection results are shown below. Figure 4 As shown in a and 4b. Statistical results indicate that the number and morphology of cochlear cells in mice injected with AAV-M9 virus were consistent with those in normal mice, suggesting that AAV-M9 virus is not toxic to newborn mice.

[0120] 2.4 Infection characteristics of adeno-associated virus (AAV-M9-CMV-EGFP) in adult mice

[0121] AAV-ie and AAV-M9-CMV-EGFP were injected into the cochlea of ​​30-day-old C57BL / 6J mice via the posterior semicircular canal. After 10-14 days of sufficient viral infection and EGFP expression, the mice were euthanized by cervical dislocation, and the cochlea from the injected ear was removed and fixed in 4% paraformaldehyde at room temperature for 2 hours. The ears were then washed three times with PBS for 5 minutes each time. Next, the ears were decalcified with 0.5 mM EDTA and soaked overnight at room temperature to soften the cochlea. The basement membrane was dissected using an ophthalmic scalpel under a stereomicroscope. Hair cells were labeled with anti-Myo7a antibody using immunofluorescence staining to prepare cochlear samples. The samples were imaged using a laser confocal scanning microscope; the virus-infected cells expressed green fluorescent protein in their nuclei. The excitation wavelengths were 488 nm and 647 nm. In vivo detection results are as follows: Figure 5Figure a shows a cochlear patch after injection of AAV-ie and AAV-M9-CMV-EGFP viruses. Purple indicates Myo7a, a marker protein for hair cells, and green indicates fluorescent proteins expressed in virus-infected cells. The results show that AAV-M9 specifically infects inner hair cells in the cochlea of ​​adult mice, but not outer hair cells. Statistical results show that the infection rate of AAV-M9 in the outer hair cells of adult mice was 0.33% ± 0.333, while the infection rate of AAV-ie in the outer hair cells of adult mice was 56.33% ± 1.202. Figure 5 As shown in b; the infection rate of AAV-M9 in the inner hair cells of adult mice was 98.67% ± 0.667, and the infection rate of AAV-ie in the inner hair cells of adult mice was 100% ± 0. Figure 5 As shown in c. AAV-M9 exhibits high efficiency and specificity in infecting inner hair cells in the cochlea of ​​adult mice, and can be used for gene therapy of inner hair cells.

[0122] 2.5 Safety of adeno-associated virus (AAV-M9-CMV-EGFP) in adult mice

[0123] AAV-M9-CMV-EGFP was injected into the cochlea of ​​30-day-old C57BL / 6J mice via a round window. After 10-14 days of sufficient viral expression, the mice were euthanized by cervical dislocation, and the cochlea from the injected ear was removed. Cochlea from age-matched C57BL / 6J mice served as controls. The cochleas were fixed in 4% paraformaldehyde at room temperature for 2 hours. They were then washed three times with PBS for 5 minutes each time. Next, they were decalcified with 0.5 mM EDTA and soaked at room temperature for 2 hours to soften the cochlea. The basement membrane was dissected using an ophthalmic scalpel under a stereomicroscope. Hair cells were labeled with anti-Myo7a antibody using immunofluorescence staining to prepare cochlear samples. Imaging was performed using a laser confocal scanning microscope; virus-infected cells expressed green fluorescent protein in their nuclei. In vivo detection results are shown below. Figure 6 As shown in a and 6b. Statistical results indicate that the number and morphology of cochlear cells in mice injected with AAV-M9 virus were consistent with those in normal mice, suggesting that AAV-M9 virus is not toxic to adult mice.

[0124] Example 3: In vivo validation of adeno-associated virus (AAV-M9-CMV-EGFP) in the visual system

[0125] Anesthetized adult mice were placed under a microscope, and 1-2 drops of tropicamide eye drops were instilled into the eyeball to dilate the pupil. Using curved forceps in the left hand, the eyeball was lifted and fixed from the optic disc, while the cornea was punctured with a 1mL syringe or glass needle in the right hand to reduce intraocular pressure. Periorbital fluid was gently wiped away with a tissue. The eyeball was fixed with forceps in the left hand, and a glass needle containing 2μL of virus was inserted at a 50° angle to the iris plane at the posterior margin of the cornea and sclera, slowly injecting the adeno-associated virus AAV-M9-CMV-EGFP constructed in Example 2.2.1 at a titer of 1.5E13gc / mL. After injection, the glass needle was left in place for 30 seconds before being slowly withdrawn. Erythromycin ointment was applied to the wound, and the mice were kept warm in a cage in a 41°C water bath until they awoke, at which point they were transferred to a mouse house. After 10 days, the eye cup was removed. The mice were euthanized by spinal dislocation, and the eyeball was removed. The cornea was punctured with a 1mL syringe to release the aqueous humor. The eyeball was placed in a small petri dish containing PBS solution and dissected under a microscope. The cornea was grasped with pointed forceps, and ophthalmic scissors were inserted through the corneal wound to circumferentially excise the cornea. The lens was removed with forceps, leaving approximately 2 mm of the optic nerve intact. The eye cups were fixed in 4% PFA for 12 hours at 4°C. The fixed eye cups were then dehydrated in 30% sucrose for 12 hours at 4°C. After freezing and sectioning, sections with good appearance and intact tissue were selected under a fluorescence microscope for staining. Immunofluorescence results showed that AAV-M9 could infect the RPE layer. In vivo detection results are as follows... Figure 7 As shown in the figure, this is a retinal slice injected with AAV-M9-CMV-EGFP virus. The green area represents the fluorescent protein expressed by the virus infection, and the blue area represents the cell nucleus. The results indicate that AAV-M9-CMV-EGFP also has a high infection rate in the retinal RPE layer and can be used for ophthalmic gene therapy.

[0126] Example 4: Eye transfection characteristics of AAV-M9-CMV-EGFP in non-human primates

[0127] In this experiment, adult healthy male rhesus monkeys underwent a single intravitreal injection of 50 μL of adeno-associated virus (AAV-M9-CMV-EGFP) into both eyes, with a viral titer of 3.89 × 10⁻⁶. 12 vg / mL. On day 63 post-injection (D63), the animals were euthanized, and their eyeballs were removed. The retina and choroid were prepared for pathological examination and staining to analyze the transfection characteristics of the ocular tissues. Results are shown below. Figure 8 GFP expression is mainly found in the rod and cone layer (RCL) and pigment epithelial layer (RPE) of the retina, and is also expressed in some vascular endothelial cells of the choroid and / or sclera.

[0128] The present invention relates to the fusion type adeno-associated virus AAV-M9 and its application in the prevention and / or treatment of ear or eye diseases, which effectively overcomes the various shortcomings of the prior art and has high industrial application value.

[0129] The above embodiments are for illustrating the implementation schemes disclosed in this invention and should not be construed as limiting the invention. Furthermore, various modifications listed herein, as well as variations in the methods and compositions of the invention, will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been specifically described in conjunction with various specific preferred embodiments, it should be understood that the invention should not be limited to these specific embodiments. In fact, various modifications as described above that are obvious to those skilled in the art to obtain the invention should be included within the scope of this invention.

Claims

1. A fusion-type adeno-associated virus capsid protein, characterized in that, The capsid protein comprises a fusion peptide of peptides from serum AAV1, AAV2, AAV6, and AAV7, wherein the fusion peptide is a first peptide, a second peptide, a third peptide, a fourth peptide, and a fifth peptide connected in sequence; the first peptide is from AAV1, the second peptide is from AAV7, the third peptide is from AAV2, the fourth peptide is from AAV1, and the fifth peptide is from AAV6; the first peptide is an amino acid fragment as shown in SEQ ID NO:3, the second peptide is an amino acid fragment as shown in SEQ ID NO:4, the third peptide is an amino acid fragment as shown in SEQ ID NO:5, the fourth peptide is an amino acid fragment as shown in SEQ ID NO:6, and the fifth peptide is an amino acid fragment as shown in SEQ ID NO:

7.

2. The fusion-type adeno-associated virus capsid protein as described in claim 1, characterized in that, Includes at least one of the following: 1) The peptides of the serum AAV1 and AAV6 assemble into the triple symmetric axons of the capsid protein; 2) The peptides of the serum AAV2, AAV6, and AAV7 are assembled into channels of the five-fold symmetry axis of the capsid protein; 3) The peptide of the serum type AAV6 forms a depression at the double symmetry axis of the capsid protein.

3. A nucleic acid, characterized in that, The nucleic acid encodes the fusion-type adeno-associated virus capsid protein as described in claim 1 or 2.

4. A construct comprising the nucleic acid as described in claim 3.

5. A fusion-type adeno-associated virus, characterized in that, The capsid structure of the fusion adeno-associated virus contains the fusion adeno-associated virus capsid protein as described in claim 1 or 2.

6. The fusion-type adeno-associated virus as described in claim 5, characterized in that, The fusion-type adeno-associated virus also includes a heteronucleotide sequence encoding the target product.

7. The fusion adeno-associated virus as described in claim 6, wherein the target product is a nucleic acid or a protein.

8. The fusion adeno-associated virus of claim 7, wherein the nucleic acid comprises small guide RNA or interfering RNA.

9. A host cell, characterized in that, The host cell comprises the construct as described in claim 4, or the host cell genome integrates exogenous nucleic acid as described in claim 3, or the host cell comprises the fusion adeno-associated virus capsid protein as described in claim 1 or 2, or the host cell is derived from the fusion adeno-associated virus as described in any one of claims 5 to 8.

10. A fusion-type adeno-associated virus vector system, characterized in that, It includes a packaging plasmid containing the nucleic acid of claim 3.

11. The fusion-type adeno-associated virus vector system as described in claim 10, characterized in that, The packaging plasmid also contains a fragment of the rep gene from adeno-associated virus.

12. The fusion-type adeno-associated virus vector system as described in claim 10, characterized in that, The adeno-associated virus vector system further includes an expression plasmid containing heterologous nucleotides responsible for encoding the target product.

13. The fusion-type adeno-associated virus vector system of claim 12, wherein the target product is a nucleic acid or a protein.

14. The fusion-type adeno-associated virus vector system of claim 13, wherein the nucleic acid comprises small guide RNA or interfering RNA.

15. The fusion-type adeno-associated virus vector system according to any one of claims 10 to 14, characterized in that, The adeno-associated virus vector system further includes helper virus plasmids or helper viruses, and the adeno-associated virus vector system also includes host cells.

16. A fusion adeno-associated virus, obtained by viral packaging from the fusion adeno-associated virus vector system of any one of claims 10 to 15.

17. Use of the fusion adeno-associated virus capsid protein of claim 1 or 2, the nucleic acid of claim 3, the construct of claim 4, the fusion adeno-associated virus of any one of claims 5 to 8 and 16, or the fusion adeno-associated virus vector system of any one of claims 10 to 15 in the preparation of a gene delivery vector.

18. The use as described in claim 17, characterized in that, The gene delivery vector is used to deliver drugs for the prevention and / or treatment of diseases selected from hearing impairment or ophthalmological diseases.

19. The use as described in claim 18, characterized in that, The ophthalmic disease in question is an RPE layer-related disease.

20. The use as described in claim 18, characterized in that, The ophthalmic diseases mentioned are dry AMD, wet AMD, or choroidal neovascularization.

21. The use as described in claim 18, characterized in that, The ophthalmic diseases mentioned are selected from age-related macular degeneration, choroidal neovascularization, macular cystoid edema, epiretinal membrane, and macular hole; myopia-related choroidal neovascularization, vascular streaks, retinal detachment, diabetic retinopathy, diabetic macular edema, atrophic lesions of retinal pigment epithelial cells, hypertrophic lesions of retinal pigment epithelial cells, retinal vein occlusion, choroidal retinal vein occlusion, and macular edema; corneal angiogenesis, pterygium conjunctiva, subretinal edema, and intraretinal edema due to hypoxia; or macular edema, retinitis pigmentosa, Sturges' disease, glaucoma, inflammatory diseases, cataracts, refractory abnormalities, keratoconus, retinopathy of prematurity, anterior angiogenesis, post-keratitis corneal angiogenesis, corneal transplantation, or keratoplasty, one or more of the following: RPE cell-related gene mutations leading to congenital amaurosis, retinitis pigmentosa, and Stargardt's disease.

22. The use as described in claim 18, characterized in that, Includes at least one of the following: 1) The hearing impairment disease mentioned refers to cochlear supporting cell-related hearing impairment diseases in young individuals; 2) The hearing impairment disease mentioned refers to hearing impairment diseases related to the hair cells in the cochlea of ​​an adult individual; 3) The drug is used to induce the regeneration of inner hair cells; 4) The ophthalmic disease mentioned is an RPE layer-related disease; 5) The hearing impairment described is caused by cochlear damage; 6) The hearing impairment described is a cell damage-related disease; 7) The hearing impairment described is a disease caused by a gene defect; 8) The hearing impairment is a disease caused by environmental factors; the environmental factors are selected from noise or ototoxic drugs; 9) The hearing impairment disease mentioned is an age-related disease.